Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5 > Z2185 > Z2186 > L1066 > BY4110 > A6113

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
231060
BigY2
231060
6182885-T-A 6314844-T-A IR3_Dst ***A*
6317469-C-T 6449428-C-T IR3_Dst ***A*
18828754-A-C 16716874-A-C A6270 YY++
21891703-T-C 19729817-T-C A6271 YY++
17049634-AC-A 14937754-AC-A ++
9770514-A-G 9932905-A-G A6274 Y++
22081347-A-AC 19919461-A-AC ++
22081350-T-A 19919464-T-A A6275 YY++
14254903-G-C 12134197-G-C YY+
9091372-T-C 9253763-T-C A6273 Y++
8493621-A-G 8625580-A-G A6272 YY++
14600913-C-T 12489115-C-T A6268 YY++
18787255-G-T 16675375-G-T A10286 YY++
8318793-G-T 8450752-G-T A6277 YY++
13694445-C-T 11538769-C-T BY32277 ***+
15681587-C-A 13569707-C-A A6269 Y++
8318792-G-A 8450751-G-A A6276 YY++
13471388-C-A 11315712-C-A *
14923724-CT-C 12811789-CT-C 10×T****
13843762-ATGGAG-A,ATGGAA 11723056-ATGGAG-A,ATGGAA *
22345818-A-T 20183932-A-T DYZ19 ****
24417006-A-AAAAGAAAG 22270859-A-AAAAGAAAG 18×AAAG****
13470632-C-T 11314956-C-T *
10809583-C-T **
11014260-G-T **
21435447-T-A 19273561-T-A **
10802156-C-A **
10868995-G-C **
10811714-TC-T **
10940396-C-T **
10813906-T-A **
10850524-C-A **
10869093-C-A **
10861854-G-T **
10688864-C-T **
4757693-C-A 4889652-C-A **
11022959-CTCAAT-C **
14458075-C-A 12337348-C-A **
10850296-C-A **
6996755-T-C 7128714-T-C **
10845728-T-G **
10841009-CT-C **
24878327-G-T 22732180-G-T g1 **
24359587-CAAA-C 22213440-CAAA-C 13×A**
10821687-C-A **
18479590-A-AG 16367710-A-AG P6_Dst **
10796184-T-A **
10764639-C-G **
10782972-ACTCCACC-A **
7095158-C-A 7227117-C-A **
4049558-C-A 4181517-C-A **
5214388-G-A 5346347-G-A **
5214395-C-T 5346354-C-T **
9982658-G-A 10145049-G-A **
21176999-C-A 19015113-C-A **
23832940-C-A 21671054-C-A **
9823480-C-A 9985871-C-A **
10984947-A-T **
2665134-T-C 2797093-T-C **
10031862-A-G 10194253-A-G **
13487786-G-T 11332110-G-T **
14584595-C-A 12472795-C-A **
28621831-G-T 26475684-G-T **
4778368-C-A 4910327-C-A **
9764062-G-A 9926453-G-A **
14557562-G-T 12445763-G-T **
10858805-C-A **
20579292-C-T 18417406-C-T P5_Dst **
24523549-A-G 22377402-A-G **
9221652-G-T 9384043-G-T **
10776335-A-G **
17907816-C-A 15795936-C-A **
28465099-C-A 26318952-C-A **
14369789-C-A 12249085-C-A **
10693507-C-A **
10846787-C-G **
10846821-G-A **
10846845-C-A **
10846862-CCATTT-C **
10846895-TTTCATTCCATTCCAC-T **
10677778-C-A **
20433815-G-T 18271929-G-T P5_Dst **
10625715-C-A **
6465537-C-CT 6597496-C-CT 11×T**
16007336-C-A 13895456-C-A **
10060650-C-G 10223041-C-G **
7866597-C-A 7998556-C-A **
18440411-G-GAT 16328531-G-GAT P6_Dst **
6996778-T-C 7128737-T-C **
17842308-C-A 15730428-C-A **
25524742-T-C 23378595-T-C P1_gr1 **
10846894-T-A **
10892083-C-T **
27994690-A-AG 25848543-A-AG P1_Y2 **
10846854-T-A **
10809601-T-A **
11014680-C-AA **
11014677-T-A **
2701021-C-A 2832980-C-A **
10770666-T-A **
10770699-A-T **
11014669-T-CC **
11014667-T-C **
10796210-TGCTCC-T **
10755408-G-C **
11014662-TC-T **
10994490-T-A **
10984963-CCATT-C **
10984956-T-C **
10845645-C-G **
10974060-G-T **
11015692-C-A **
11018454-C-G **
21428685-C-A 19266799-C-A **
15151434-T-A 13039521-T-A **
11017624-G-C **
19720709-A-AT 17608829-A-AT P5_Prx 23×T**
7863212-C-A 7995171-C-A **
19231358-C-T 17119478-C-T **
13486547-T-A 11330871-T-A **
13486576-C-T 11330900-C-T **
7001658-CT-C 7133617-CT-C 11×T**
10992266-C-CGTACT **
11026089-A-G **
10992276-C-A **
10992300-C-A **
13462275-C-A 11306599-C-A **
13202699-C-A 11047023-C-A **
21945434-C-A 19783548-C-A **
13199306-C-A 11043630-C-A **
19449428-GAAAAA-G 17337548-GAAAAA-G 23×A**
10995824-C-G **
6359730-C-A 6491689-C-A **
15619532-G-GA 13507652-G-GA 9×A**
10914385-GAA-G **
6028262-C-A 6160221-C-A **
10971193-TGCAATC-T **
10846795-G-C **
10846806-C-A **
10944509-CAG-C **
10942972-C-A **
10938770-A-G **
10892088-T-C **
10971201-ACTAC-A **
11017704-T-A **
11017724-C-A **
6996767-T-A 7128726-T-A **
10892073-C-T **
4449118-C-A 4581077-C-A **
10884968-A-G **
10796218-A-C **
10993041-G-T **
10971217-A-C **
11009282-C-T **
11017648-C-G **
17874259-C-A 15762379-C-A **
10974040-TC-T **
11017665-C-A **
11017621-T-C **
11017622-T-C **
11017632-T-C **
11017635-A-G **
11017658-C-T **
10929966-C-A **
11017671-C-G **
11017674-A-T **
11017677-C-G **
11017693-T-A **
11017699-G-C **
11017710-C-T **
11017714-C-G **
10892101-T-C **
20839430-C-A 18677544-C-A P4_Gap **
19464140-G-T 17352260-G-T **
10868890-T-C **
3728703-T-C 3860662-T-C **
3298289-G-T 3430248-G-T **
3378851-C-CAA 3510810-C-CAA 13×A**
3436454-G-T 3568413-G-T **
3535730-C-A 3667689-C-A **
3535746-A-T 3667705-A-T **
3545988-C-A 3677947-C-A **
3560155-C-A 3692114-C-A **
7862225-C-A 7994184-C-A **
3012932-C-A 3144891-C-A **
3990914-CA-C 4122873-CA-C **
4115112-C-A 4247071-C-A **
4129721-C-A 4261680-C-A **
4179076-C-A 4311035-C-A **
4342361-T-C 4474320-T-C **
4357415-C-A 4489374-C-A **
4472542-C-A 4604501-C-A **
4509126-A-T 4641085-A-T **
7986096-C-A 8118055-C-A **
8017102-C-A 8149061-C-A Y62984 **
4604880-C-A 4736839-C-A **
8253771-C-A 8385730-C-A **
19411740-C-A 17299860-C-A **
18993472-T-C 16881592-T-C **
10866132-C-A **
7236397-C-A 7368356-C-A **
17646802-C-A 15534922-C-A **
18297918-C-T 16186038-C-T P6_Prx **
17876348-A-C 15764468-A-C **
20893455-A-AG 18731569-A-AG P4_Dst **
22202587-GA-G 20040701-GA-G **
2836359-T-C 2968318-T-C **
2652031-C-A 2783990-C-A **
2682753-C-A 2814712-C-A **
2696522-G-T 2828481-G-T **
2717079-T-C 2849038-T-C **
2741297-G-A 2873256-G-A **
2755449-T-C 2887408-T-C **
2806131-C-A 2938090-C-A **
8066175-C-A 8198134-C-A **
4604516-G-A 4736475-G-A **
4769438-A-AT 4901397-A-AT **
8379507-G-T 8511466-G-T **
7043372-C-A 7175331-C-A **
6769775-G-T 6901734-G-T **
6803844-C-A 6935803-C-A **
6806658-G-A 6938617-G-A **
6861963-T-C 6993922-T-C **
6873236-C-A 7005195-C-A **
6996753-T-C 7128712-T-C **
6996795-T-C 7128754-T-C **
7014216-A-G 7146175-A-G **
7126561-A-G 7258520-A-G **
6720389-C-A 6852348-C-A **
7225612-G-T 7357571-G-T **
7228164-C-A 7360123-C-A **
7242576-G-A 7374535-G-A **
7683380-G-T 7815339-G-T **
7252427-T-C 7384386-T-C **
7312011-C-T 7443970-C-T **
7416864-T-C 7548823-T-C **
7436433-A-G 7568392-A-G **
6757878-G-T 6889837-G-T **
6715075-GCTT-G 6847034-GCTT-G **
7829047-C-T 7961006-C-T **
5785850-C-A 5917809-C-A **
5211918-C-A 5343877-C-A **
5214361-T-C 5346320-T-C **
5214365-T-G 5346324-T-G **
5443971-C-A 5575930-C-A **
7733767-C-A 7865726-C-A **
5471808-C-T 5603767-C-T **
5495307-A-G 5627266-A-G **
5591680-G-T 5723639-G-T **
5821799-G-A 5953758-G-A **
6513408-C-A 6645367-C-A **
5870010-C-A 6001969-C-A **
5969113-C-A 6101072-C-A **
6097094-G-A 6229053-G-A **
6133632-C-A 6265591-C-A **
6226811-T-A 6358770-T-A IR3_Dst **
6244244-T-C 6376203-T-C IR3_Dst **
6401334-T-C 6533293-T-C **
6445111-C-A 6577070-C-A **
15038240-G-T 12926330-G-T **
17876367-C-A 15764487-C-A **
13462292-C-A 11306616-C-A **
18299543-T-TTATGC 16187663-T-TTATGC P6_Prx **
9110866-G-A **
18370845-A-ATC 16258965-A-ATC P6_Prx **
17081239-A-T 14969359-A-T **
9125381-C-T **
6213657-C-A 6345616-C-A IR3_Dst **
19036755-G-T 16924875-G-T **
8855651-T-C 8987610-T-C **
8853430-G-T 8985389-G-T **
14184456-T-G 12063750-T-G **
10669550-A-G **
8806540-C-T 8938499-C-T **
14106947-C-A 11986241-C-A **
14108920-C-A 11988214-C-A **
27902197-CTTTT-C 25756050-CTTTT-C P1_Y2 34×T**
11022944-TTCCTC-T **
11022977-C-T **
14824246-C-A 12712313-C-A **
8979173-GAC-G 9141564-GAC-G **
16582-G-T **
10972004-T-A **
22010268-C-A 19848382-C-A **
4701197-G-T 4833156-G-T **
10892070-T-C **
7824925-C-A 7956884-C-A **
5214408-C-T 5346367-C-T **
7172675-C-A 7304634-C-A **
19271542-C-A 17159662-C-A **
9028422-G-A 9190813-G-A **
16243119-C-A 14131239-C-A **
9040745-G-A 9203136-G-A **
16240862-C-A 14128982-C-A **
56839319-C-T **
13224743-C-A 11069067-C-A **
16860721-C-A 14748841-C-A **
13866154-C-G 11745448-C-G **
16816623-C-T 14704743-C-T **
17940070-C-A 15828190-C-A **
24071442-CCA-C 21925295-CCA-C P3_b1 **
16681571-C-A 14569691-C-A **
5243667-C-A 5375626-C-A **
22903771-C-A 20741885-C-A **
19438684-C-A 17326804-C-A **
10988373-C-A **
15392552-C-A 13280672-C-A **
7231186-C-A 7363145-C-A **
10984958-G-C **
8409230-C-A 8541189-C-A **
15572573-C-A 13460693-C-A **
11001285-T-C **
23007169-G-T 20845283-G-T **
8689360-C-A 8821319-C-A **
8409216-A-G 8541175-A-G **
23779975-C-A 21618089-C-A **
21768892-C-A 19607006-C-A **
17876370-A-G 15764490-A-G **
10984952-C-T **
8409198-A-G 8541157-A-G **
16539787-G-T 14427907-G-T **
13976426-C-A 11855720-C-A **
8409194-A-G 8541153-A-G **
21297494-T-C 19135608-T-C **
15785942-C-A 13674062-C-A **
10937630-C-A **
19558151-C-A 17446271-C-A **
13238410-C-A 11082734-C-A **
10971215-G-C **
4888665-C-A 5020624-C-A **
20888588-TAAAA-T 18726702-TAAAA-T P4_Dst 15×A**
6792565-C-A 6924524-C-A **
8720664-C-A 8852623-C-A **
4497305-G-T 4629264-G-T **
18137239-A-ATG 16025359-A-ATG 8×TG**
5368202-G-T 5500161-G-T **
28091455-A-C 25945308-A-C P1_Y2 10×AC**
13855659-C-A 11734953-C-A **
16605-A-T **
17750977-C-A 15639097-C-A **
14473672-C-A 12352941-C-A **
15406682-T-A 13294802-T-A **
7105158-C-A 7237117-C-A **
8689366-C-A 8821325-C-A **
16277960-C-A 14166080-C-A **
18754865-G-T 16642985-G-T **
7524740-T-G 7656699-T-G **
13212828-T-C 11057152-T-C **
13488684-A-T 11333008-A-T **
17876385-G-C 15764505-G-C **
18132459-G-T 16020579-G-T **
18078625-A-G 15966745-A-G **
18059828-A-G 15947948-A-G **
17951729-C-A 15839849-C-A **
17912981-C-A 15801101-C-A **
17876386-G-A 15764506-G-A **
17876384-C-T 15764504-C-T **
18191227-T-C 16079347-T-C **
17876383-G-C 15764503-G-C **
17876359-G-C 15764479-G-C **
17876358-T-A 15764478-T-A **
17876355-C-T 15764475-C-T **
17863391-T-A 15751511-T-A **
17806455-C-A 15694575-C-A **
17806454-A-G 15694574-A-G **
14886357-C-T 12774423-C-T P98 **
18260772-C-A 16148892-C-A **
17774852-G-T 15662972-G-T **
19079374-C-A 16967494-C-A **
19787562-T-G 17675682-T-G P5_Prx **
19677889-T-A 17566009-T-A P5_Prx **
19677884-C-A 17566004-C-A P5_Prx **
19439542-C-A 17327662-C-A **
19312318-A-G 17200438-A-G **
19310152-T-C 17198272-T-C **
18923271-G-A 16811391-G-A **
18262468-C-A 16150588-C-A **
18810896-C-A 16699016-C-A **
18763644-C-A 16651764-C-A **
18742260-C-A 16630380-C-A **
18631804-C-A 16519924-C-A **
18546253-C-A 16434373-C-A **
18531163-C-A 16419283-C-A P6_Dst **
18299536-A-G 16187656-A-G P6_Prx **
17803336-C-A 15691456-C-A **
17661361-T-C 15549481-T-C **
20023853-C-A 17911973-C-A P5_Prx **
9978690-A-G 10141081-A-G PF410 **
13217717-TGTG-T 11062041-TGTG-T **
16833411-C-A 14721531-C-A **
16824951-GA-G 14713071-GA-G **
16815290-A-G 14703410-A-G **
16714706-C-A 14602826-C-A **
16689938-C-A 14578058-C-A **
16666013-C-A 14554133-C-A **
16921462-C-A 14809582-C-A **
16539778-A-G 14427898-A-G **
16519527-C-A 14407647-C-A BZ1101 **
16463343-G-A 14351463-G-A **
16445529-T-C 14333649-T-C **
16428171-C-A 14316291-C-A **
16354916-G-A 14243036-G-A **
16273609-G-T 14161729-G-T **
13856841-A-G 11736135-A-G **
16938209-CTTTCT-C 14826329-CTTTCT-C **
17661285-C-A 15549405-C-A **
17413205-C-A 15301325-C-A **
17644472-G-T 15532592-G-T **
17616832-C-A 15504952-C-A **
17605005-C-T 15493125-C-T **
17552076-A-G 15440196-A-G **
17550761-C-A 15438881-C-A **
17463989-C-A 15352109-C-A **
17408354-G-A 15296474-G-A **
17006672-C-A 14894792-C-A **
17375490-AG-A 15263610-AG-A **
17243876-A-G 15131996-A-G **
17195019-C-A 15083139-C-A **
17192995-ACACT-A 15081115-ACACT-A **
17146527-G-C 15034647-G-C **
17142590-GC-G 15030710-GC-G **
17061628-G-T 14949748-G-T **
19932027-T-A 17820147-T-A P5_Prx **
20579301-TA-T 18417415-TA-T P5_Dst **
16211164-C-A 14099284-C-A **
21768877-A-AC **
26122068-C-A 23975921-C-A P1_Y1 **
25429818-T-G 23283671-T-G P2_r2 **
24523550-T-C 22377403-T-C **
24523543-A-G 22377396-A-G **
24523542-C-A 22377395-C-A **
23983552-C-A 21837405-C-A **
23848800-C-A 21686914-C-A **
26740547-A-T 24594400-A-T P1_g2 **
23801673-C-A 21639787-C-A **
23792026-G-T 21630140-G-T **
23790042-G-T 21628156-G-T **
23723549-A-G 21561663-A-G **
13805191-G-T 11684485-G-T ****
23495630-C-A 21333744-C-A **
23495610-GA-G 21333724-GA-G **
26224812-T-TAA 24078665-T-TAA P1_Y1 **
28091458-A-ACG 25945311-A-ACG P1_Y2 **
23455251-GT-G 21293365-GT-G **
28744979-T-C 26598832-T-C **
16596-GT-G **
56885633-T-TAAAA **
56841430-A-G **
28772867-C-A 26626720-C-A **
28763152-A-G 26617005-A-G **
28744980-G-C 26598833-G-C **
28744973-T-C 26598826-T-C **
28479551-C-A 26333404-C-A **
28741268-C-A 26595121-C-A **
13805194-T-A 11684488-T-A **
28738574-G-T 26592427-G-T **
28622529-C-A 26476382-C-A **
28549288-G-T 26403141-G-T **
28549276-G-T 26403129-G-T **
28514823-T-C 26368676-T-C **
13138814-C-T 10628300-C-T **
23397123-G-A 21235237-G-A **
20587811-ATATAT-A 18425925-ATATAT-A P5_Dst **
21351754-CT-C 19189868-CT-C **
21523940-G-A 19362054-G-A **
21483364-C-A 19321478-C-A **
21456130-C-A 19294244-C-A **
21405925-C-A 19244039-C-A **
21378727-T-C 19216841-T-C **
21355451-C-A 19193565-C-A **
21249102-G-T 19087216-G-T **
21956993-A-T 19795107-A-T **
21174562-C-A 19012676-C-A **
21133241-C-A 18971355-C-A **
21090950-G-A 18929064-G-A **
21046874-C-A 18884988-C-A **
20931937-C-A 18770051-C-A P4_Dst **
20888574-G-T 18726688-G-T P4_Dst **
20829735-A-C 18667849-A-C P4_Gap **
21584378-AT-A 19422492-AT-A **
21972281-C-A 19810395-C-A **
23395707-AT-A 21233821-AT-A **
23019899-G-A 20858013-G-A Y79056 **
13805183-A-T 11684477-A-T ****
13858431-C-A 11737725-C-A **
23377763-C-T 21215877-C-T **
23333719-C-A 21171833-C-A **
23199319-G-T 21037433-G-T **
23152613-G-C 20990727-G-C **
22782105-C-A 20620219-C-A **
22165012-C-T 20003126-C-T **
22659508-C-A 20497622-C-A **
22539297-C-A 20377411-C-A **
22499845-C-T 20337959-C-T DYZ19 **
22499839-T-A 20337953-T-A DYZ19 **
22303785-G-T 20141899-G-T DYZ19 **
22292129-C-A 20130243-C-A DYZ19 **
22236909-G-T 20075023-G-T DYZ19 **
16221069-AT-A 14109189-AT-A **
3436218-G-A 3568177-G-A L705L706 **
16045335-G-A 13933455-G-A **
14225189-C-A 12104483-C-A **
13601939-A-T 11446263-A-T **
13641183-C-A 11485507-C-A **
11671004-A-G **
22244979-G-T 20083093-G-T DYZ19 **
13800749-G-C 11680043-G-C **
13871979-G-T 11751273-G-T **
13895859-C-A 11775153-C-A **
16729978-G-A 14618098-G-A **
13996347-G-A 11875641-G-A **
15676525-G-A 13564645-G-A **
14021882-T-C 11901176-T-C **
14027703-T-C 11906997-T-C **
14054103-C-A 11933397-C-A **
14195744-C-T 12075038-C-T **
14249087-C-A 12128381-C-A PH1058 **
13593858-C-A 11438182-C-A **
14527241-C-A 12415442-C-A **
14822844-C-A 12710911-C-A **
14779708-CT-C 12667778-CT-C **
14754101-G-A 12642170-G-A **
14751613-C-A 12639682-C-A **
14718974-G-A 12607042-G-A **
14606014-C-A 12494216-C-A **
14486131-C-A 12365400-C-A **
14279999-C-A 12159293-C-A **
14451277-G-C 12330550-G-C **
14439664-A-T 12318937-A-T **
16045332-A-G 13933452-A-G **
14424049-C-A 12303324-C-A **
14376557-C-T 12255853-C-T **
14328388-G-T 12207682-G-T **
13598767-C-A 11443091-C-A **
22722425-A-C 20560539-A-C **
14836381-G-A 12724448-G-A **
13394906-T-C 11239230-T-C **
59019321-C-T 56873174-C-T **
2866407-C-A 2998366-C-A **
5214373-C-T 5346332-C-T FGC40678 Y19463 **
13460907-A-T 11305231-A-T **
13571646-A-C 11415970-A-C **
13453628-C-CTTTTT 11297952-C-CTTTTT **
13324525-C-A 11168849-C-A **
22903820-ATG-A 20741934-ATG-A **
13316275-C-A 11160599-C-A **
13298572-G-A 11142896-G-A **
13293673-T-C 11137997-T-C **
17950825-AATATATATATATATATATATATATATATATATATATATAT-A 15838945-AATATATATATATATATATATATATATATATATATATATAT-A 27×AT**
13252645-C-A 11096969-C-A **
13249658-A-G 11093982-A-G **
58985443-C-T 56839296-C-T **
21574544-TTTA-T 19412658-TTTA-T 6×TTA**
13550847-C-A 11395171-C-A **
13482014-C-A 11326338-C-A **
13522196-G-T 11366520-G-T **
13488702-T-C 11333026-T-C **
13488661-CA-C 11332985-CA-C **
13487706-C-A 11332030-C-A **
13486548-G-T 11330872-G-T **
13485172-C-A 11329496-C-A **
13480903-T-A 11325227-T-A **
18238869-AAT-A 16126989-AAT-A **
23808115-T-C 21646229-T-C **
16146484-AAAG-A 14034604-AAAG-A P8_Dst **
9936558-C-T 10098949-C-T **
13445504-T-C 11289828-T-C **
13467876-C-A 11312200-C-A **
15922345-A-T 13810465-A-T Y28401 **
14825869-A-C 12713936-A-C **
14432375-G-T 12311648-G-T **
15011565-C-A 12899653-C-A **
15653780-G-A 13541900-G-A **
15464454-C-A 13352574-C-A **
13441613-CCA-C 11285937-CCA-C **
6953311-A-T 7085270-A-T PF4503 CTS687 **
3960352-A-G 4092311-A-G 16×TG**
15531620-A-T 13419740-A-T **
15583581-T-A 13471701-T-A **
22499831-A-G 20337945-A-G DYZ19 **
15584544-C-A 13472664-C-A **
18639018-A-AGTGT 16527138-A-AGTGT 26×GT**
15334323-C-A 13222441-C-A ****
15622649-T-G 13510769-T-G **
15623255-G-A 13511375-G-A **
15676410-TTGTG-T 13564530-TTGTG-T **
15422931-G-T 13311051-G-T **
15699904-G-GAC 13588024-G-GAC **
15741848-C-A 13629968-C-A **
22499843-A-T 20337957-A-T DYZ19 **
15747916-G-T 13636036-G-T **
15793649-C-A 13681769-C-A **
15841758-C-A 13729878-C-A **
15909221-C-A 13797341-C-A **
13486545-T-G 11330869-T-G **
16007345-A-T 13895465-A-T **
16016795-C-A 13904915-C-A **
16017828-CA-C 13905948-CA-C **
16044893-C-A 13933013-C-A **
15438938-C-A 13327058-C-A **
7471058-C-A 7603017-C-A IR1_L **
15084445-A-C 12972535-A-C **
15391403-C-A 13279523-C-A **
3436215-G-A 3568174-G-A **
3436202-T-C 3568161-T-C **
15234061-C-A 13122147-C-A **
15392152-C-A 13280272-C-A **
15011824-A-G 12899912-A-G **
15049453-C-A 12937544-C-A **
7280947-C-G 7412906-C-G **
15150513-G-T 13038600-G-T **
7704511-G-C 7836470-G-C ***
14391828-C-A 12271124-C-A ***
10009855-C-A 10172246-C-A ***
24604568-G-T 22458421-G-T P3_t2 ***
15950384-C-A 13838504-C-A ***
25520895-G-A 23374748-G-A P1_gr1 ***
7703291-C-A 7835250-C-A ***
14745268-C-A 12633337-C-A ***
24399959-T-C 22253812-T-C ***
16665529-TATTA-T 14553649-TATTA-T ***
9144443-G-T 9306834-G-T ***
21754340-G-T ***
13453654-A-AC 11297978-A-AC ***
9063928-C-A 9226319-C-A ***
13470230-G-C 11314554-G-C ***
15754516-G-T 13642636-G-T ***
14653234-C-A 12541299-C-A ***
13453653-C-CTTTC,T 11297977-C-CTTTC,T ***
9653465-G-A 9815856-G-A IR3_Prx ***
11030711-C-A ***
13301190-T-C 11145514-T-C ***
13230662-C-T 11074986-C-T ***
16242883-C-A 14131003-C-A ***
7646384-C-A 7778343-C-A ***
9814149-C-A 9976540-C-A ***
56836200-G-T ***
18262422-C-A 16150542-C-A ***
16345107-G-T 14233227-G-T ***
9938232-C-A 10100623-C-A ***
7697366-C-A 7829325-C-A ***
9989939-G-T 10152330-G-T ***
13210609-C-A 11054933-C-A ***
16022571-G-T 13910691-G-T ***
10845639-TCCT-T,TCCC ***
28657362-T-A 26511215-T-A ***
13446717-T-A 11291041-T-A ***
13446784-C-A 11291108-C-A ***
13448876-T-A 11293200-T-A ***
18406623-C-A 16294743-C-A P6_Gap ***
16874649-C-A 14762769-C-A ***
13470241-CCAGT-C 11314565-CCAGT-C ***
13470259-C-T 11314583-C-T ***
13470248-C-A 11314572-C-A ***
21456023-CT-C 19294137-CT-C ***
14512660-G-A 12400865-G-A ***
8237604-C-A 8369563-C-A ***
19436878-CAAGG-C 17324998-CAAGG-C ***
21810055-T-A 19648169-T-A ***
10887127-G-A ***
10973832-T-C ***
8913653-G-A 9045612-G-A ***
8254975-C-A 8386934-C-A ***
17596864-C-A 15484984-C-A ***
17387294-GTATATA-G,GTATATATA 15275414-GTATATA-G,GTATATATA 12×TA***
10755378-A-C,T ***
21358798-G-T 19196912-G-T ***
17631052-C-A 15519172-C-A ***
10755384-C-G,T ***
21228141-C-A 19066255-C-A ***
10764441-A-G ***
15507535-T-C 13395655-T-C ***
10965184-G-T ***
14432434-G-T 12311707-G-T ***
21990501-A-G 19828615-A-G ***
19284975-GC-G 17173095-GC-G ***
15208821-A-G 13096907-A-G ***
13488849-C-G,T 11333173-C-G,T ***
13470249-T-A 11314573-T-A ***
8494842-C-T 8626801-C-T ***
14555936-C-A 12444137-C-A ***
14550488-C-A 12438689-C-A ***
17045847-A-G 14933967-A-G ***
23280511-C-A 21118625-C-A ***
19111548-C-A 16999668-C-A ***
17081365-C-A 14969485-C-A ***
19128804-AG-A,AA 17016924-AG-A,AA ***
10656986-G-T ***
22297844-A-G 20135958-A-G DYZ19 ***
8494834-C-A 8626793-C-A ***
22519013-A-T 20357127-A-T ***
19197524-G-A 17085644-G-A ***
15618044-C-A 13506164-C-A ***
10845674-TCCATTC-T,TCATGTC ***
22297905-G-T 20136019-G-T DYZ19 ***
22297867-T-A,C 20135981-T-A,C DYZ19 ***
22297857-A-T 20135971-A-T DYZ19 ***
22297853-T-A 20135967-T-A DYZ19 ***
17295871-T-C 15183991-T-C ***
13838961-G-C 11718255-G-C ***
7363604-T-G 7495563-T-G ***
13813660-G-T 11692954-G-T ***
13854322-G-T 11733616-G-T ***
16108662-A-T 13996782-A-T P8_Prx ***
13858065-A-G 11737359-A-G ***
13676255-C-A 11520579-C-A ***
13677926-C-A 11522250-C-A ***
13686147-G-A 11530471-G-A ***
13686155-A-T 11530479-A-T ***
13698408-C-G 11542732-C-G ***
13852607-C-G 11731901-C-G ***
13853638-G-A 11732932-G-A ***
13853682-C-G 11732976-C-G ***
13857856-T-C 11737150-T-C ***
13867285-A-C 11746579-A-C ***
13674681-CGGAAT-C 11519005-CGGAAT-C 4×GGAAT***
9640889-TTGTGTG-T 9803280-TTGTGTG-T IR3_Prx 22×TG***
13822025-A-T 11701319-A-T ***
13862293-C-A 11741587-C-A ***
13138788-T-C 10628274-T-C ***
13828549-A-G 11707843-A-G ***
22423737-G-A 20261851-G-A DYZ19 ***
13850547-C-A 11729841-C-A 7×ATGGA***
28787351-A-G 26641204-A-G ***
13809992-T-A 11689286-T-A ***
28787306-A-G 26641159-A-G ******
28804258-T-C 26658111-T-C KMS171 ***
13839918-A-G 11719212-A-G ***
13647834-T-C 11492158-T-C ***
17919842-T-A 15807962-T-A M10051 PF894 ***
22342883-T-G 20180997-T-G DYZ19 ***
8477577-AT-A 8609536-AT-A 10×T***
58973926-GAGTCCATTCCATTCCATTCT-G,GAGTCAATTCCATTCCATTCT 56827779-GAGTCCATTCCATTCCATTCT-G,GAGTCAATTCCATTCCATTCT ***
13458980-G-C 11303304-G-C ***
14186816-GCA-G 12066110-GCA-G 8×CA***
22460187-G-T 20298301-G-T DYZ19 ***
13819964-G-C 11699258-G-C ***
13822006-G-A 11701300-G-A ***
13658958-G-A 11503282-G-A FGC40602 ***
13698409-C-T 11542733-C-T ***
13842096-C-T 11721390-C-T ***
13846299-A-C,G 11725593-A-C,G ***
13831670-A-AT 11710964-A-AT ***
20043379-G-GT 17931499-G-GT P5_Prx 10×T***
13451913-C-A 11296237-C-A ***
13846445-G-A 11725739-G-A FGC40689 ***
13713156-A-G 11557480-A-G ***
13858015-C-G 11737309-C-G ***
13682910-G-A 11527234-G-A ***
13821137-T-A 11700431-T-A ***
28787346-G-A 26641199-G-A 5×TGGAA***
13822122-C-A 11701416-C-A ***
13863285-G-A 11742579-G-A 4×ATGGA***
58908843-CCCATT-C,T 56682023-AATGGG-A,G 12×CCATT***
13664307-C-T 11508631-C-T ***
22242981-ATTCT-A 20081095-ATTCT-A DYZ19 ***
13674617-T-G 11518941-T-G ***
58979984-T-C 56833837-T-C ***
13819168-A-G 11698462-A-G ***
13447204-A-C,T 11291528-A-C,T ***
28805413-G-T 26659266-G-T ***
13663811-G-A 11508135-G-A ***
13663825-G-T 11508149-G-T ***
13844390-A-G 11723684-A-G ZS5629 ***
8566930-A-T 8698889-A-T ***
14407169-CT-G 12286467-CT-G 16×T***
13846473-T-A 11725767-T-A ***
13454223-TTTCCA-T 11298547-TTTCCA-T 12×TTCCA***
13813656-A-G 11692950-A-G ***
13817166-C-T 11696460-C-T ***
25955976-CTGTG-C 23809829-CTGTG-C P1_Y1 16×TG***
13650661-T-A 11494985-T-A ***
13813666-A-G 11692960-A-G ***
13841495-T-C 11720789-T-C ***
13859464-A-C,G 11738758-A-C,G ***
28799244-C-G 26653097-C-G ***
13659320-T-C 11503644-T-C ***
13844378-C-T 11723672-C-T ***
13844385-C-G 11723679-C-G S14819 ***
22481411-A-G 20319525-A-G DYZ19 ***
13452472-A-C 11296796-A-C ***
13810679-T-G 11689973-T-G ***
13813926-C-T 11693220-C-T BY26327 ***
13841992-T-G 11721286-T-G ***
13828537-G-A 11707831-G-A ***
13853668-T-G 11732962-T-G ***
13856759-A-ATC 11736053-A-ATC ***
13859963-T-C 11739257-T-C ***
10007100-C-T 10169491-C-T ***
14637667-T-G 12525736-T-G ***
22508779-G-C 20346893-G-C DYZ19 ***
13839914-T-A 11719208-T-A ***
13860319-G-T 11739613-G-T ***
13858083-T-A 11737377-T-A ***
13849124-T-A 11728418-T-A ***
24013847-CTATATATATATA-C 21867700-CTATATATATATA-C 21×TA***
13693929-T-A 11538253-T-A ***
13680793-A-G 11525117-A-G ***
13812944-T-A 11692238-T-A ***
13663802-T-A 11508126-T-A 4×ATGGA***
24088849-ATG-A 21942702-ATG-A P3_b1 8×TG***
58982137-T-A 56835990-T-A ***
13653021-C-T 11497345-C-T ***
13822135-C-A 11701429-C-A ***
13856716-T-G 11736010-T-G ***
58981827-A-ATCGAT 56835680-A-ATCGAT ***
13861914-C-T 11741208-C-T ***
58975017-T-A 56828870-T-A ***
22357553-G-A 20195667-G-A DYZ19 ***
58974788-G-T 56828641-G-T ***
58974801-G-C 56828654-G-C ***
13196125-T-C 11040449-T-C ***
13655616-T-C 11499940-T-C ***
13683047-G-C 11527371-G-C ***
13453105-C-A,T 11297429-C-A,T ***
13831587-A-T 11710881-A-T ***
13847217-T-G 11726511-T-G ***
13680778-C-G 11525102-C-G 4×TGGAA***
28787260-G-A 26641113-G-A ***
27791854-T-G 25645707-T-G P1_Y2 ***
28800249-A-G 26654102-A-G ***
13869422-A-C,T 11748716-A-C,T ***
13455401-C-T 11299725-C-T ***
13697417-A-G 11541741-A-G ***
13841932-C-G 11721226-C-G ***
13822129-T-A 11701423-T-A ***
13822130-T-A 11701424-T-A ***
13725209-C-T 11569533-C-T ***
13856773-T-C 11736067-T-C ***
25462513-A-AG 23316366-A-AG P2_r2 ***
13813886-GGAATT-G 11693180-GGAATT-G ***
58982988-T-C 56836841-T-C ***
13820786-A-G 11700080-A-G YSC0000142 ***
13838065-T-A 11717359-T-A ***
13853675-T-A 11732969-T-A ***
25870893-CTG-C 23724746-CTG-C P1_Y1 10×TG***
28805499-G-C 26659352-G-C ***
28805503-A-G 26659356-A-G ***
28805505-T-G 26659358-T-G ***
58908927-C-T 56681944-G-A ***
58980069-T-C 56833922-T-C ***
13868425-G-C 11747719-G-C ***
13667206-T-G 11511530-T-G ***
13812248-G-T 11691542-G-T ***
13862248-A-C 11741542-A-C ***
13822140-C-A 11701434-C-A ***
13839140-T-G 11718434-T-G ***
13869515-GA-G 11748809-GA-G ***
13859949-G-T 11739243-G-T ***
13451920-G-T 11296244-G-T ***
58974837-A-T 56828690-A-T ***
23563321-TAC-T 21401435-TAC-T 9×AC***
13806188-T-G 11685482-T-G ***
13862232-A-C 11741526-A-C ***
25194604-CTTCT-C 23048457-CTTCT-C g1 5×TTCT***
13650651-T-A 11494975-T-A ***
13196247-T-C 11040571-T-C 5×CACTC******
13828038-T-A 11707332-T-A ***
13859477-C-A 11738771-C-A ***
13862296-A-G 11741590-A-G ***
24417105-A-C 22270958-A-C BY25497 ***
28798947-G-A 26652800-G-A ***
13831617-CG-C 11710911-CG-C ***
13831622-G-GC 11710916-G-GC ***
58977196-T-C 56831049-T-C ***
13650683-A-G 11495007-A-G ***
13650649-T-G 11494973-T-G ***
13667207-C-G 11511531-C-G ***
58981804-C-G 56835657-C-G ***
13813085-A-T 11692379-A-T ***
13651253-A-G 11495577-A-G ***
13809023-C-G 11688317-C-G ***
15505494-CTA-C 13393614-CTA-C ***
20669272-TTTG-T 18507386-TTTG-T P4_Prx 11×TTG***
28790595-G-C 26644448-G-C ***
28790598-A-T 26644451-A-T ***
28790599-T-A 26644452-T-A ***
28804246-G-T 26658099-G-T BY2550 ***
13813091-T-C 11692385-T-C Z17432 ***
13451491-C-T 11295815-C-T ***
13815712-G-C 11695006-G-C ***
13459116-G-C 11303440-G-C 10×ATTCC***
13663789-A-T 11508113-A-T ***
13663790-A-G 11508114-A-G ***
13663838-C-A 11508162-C-A ***
13676156-A-T 11520480-A-T ***
13676282-C-G 11520606-C-G ***
13680776-G-C 11525100-G-C ***
13868889-C-T 11748183-C-T ***
16040802-CTTTTT-C 13928922-CTTTTT-C 16×T***
3790892-A-G 3922851-A-G ***
7246710-C-A 7378669-C-A ***
13489815-C-A 11334139-C-A ***
13254002-G-GTT 11098326-G-GTT 17×T***
10755321-C-T ***
10755328-A-C ***
10755426-C-T ***
7108615-G-GTA 7240574-G-GTA 9×TA***
13453293-T-G 11297617-T-G ***
17861334-A-AT 15749454-A-AT 13×T***
13453634-A-C 11297958-A-C ***
13468283-G-T 11312607-G-T ***
10669507-T-A ***
13478241-GC-G 11322565-GC-G ***
56839415-A-G ***
10764466-A-G ***
23207189-GTT-G 21045303-GTT-G 14×T***
28805818-A-C 26659671-A-C ***
28805820-A-T 26659673-A-T ***
28805826-C-T 26659679-C-T ***
15565488-C-A 13453608-C-A ***
6402528-A-T 6534487-A-T ***
10666963-C-G ***
10755333-A-T ***
24485675-C-CT,CTT 22339528-C-CT,CTT 15×T***
13488837-G-C 11333161-G-C ***
13453651-T-G 11297975-T-G ***
10807242-C-A ***
8602218-A-AT 8734177-A-AT 11×T***
28786679-GAA-G 26640532-GAA-G ***
21110131-C-A 18948245-C-A ***
10950886-C-T ***
15749575-C-CTT 13637695-C-CTT 15×T***
10973810-G-A ***
11037152-C-A ***
6911651-C-A 7043610-C-A ***
10845627-A-C ***
10911548-C-A ***
10845632-A-C ***
10845637-A-C ***
10845685-C-T ***
14817419-ATT-A 12705490-ATT-A 12×T***
16246029-C-T 14134149-C-T ***
10755437-C-A ***
10993040-A-T ***
10755373-A-T ***
17458930-ATTT-A 15347050-ATTT-A 17×T***
19431604-C-CA 17319724-C-CA 11×A***
13488844-G-C,GGC 11333168-G-C,GGC ***
13489635-AC-A 11333959-AC-A ***
13448860-A-T 11293184-A-T ***
17146579-TA-T 15034699-TA-T 8×A***
16424045-C-A 14312165-C-A ***
16519316-CA-C,CAAA 14407436-CA-C,CAAA 15×A***
19508410-C-A 17396530-C-A ***
10808602-A-C ***
10013327-A-G 10175718-A-G ***
13489816-C-A 11334140-C-A ***
14391874-TAAA-T,TA 12271170-TAAA-T,TA 15×A***
14771649-CTTTTTT-C 12659718-CTTTTTT-C 17×T***
2728075-TAACCCTATATTTCATG-T 2860034-TAACCCTATATTTCATG-T ***
14619721-C-A 12507919-C-A ***
2806293-A-C 2938252-A-C ***
2876721-G-A 3008680-G-A ***
3151751-CT-C 3283710-CT-C ***
3790855-T-C 3922814-T-C ***
4841656-A-G 4973615-A-G ***
5455093-T-C 5587052-T-C ***
6144704-C-A 6276663-C-A IR3_Dst ***
6354082-C-A 6486041-C-A ***
7129922-C-A 7261881-C-A ***
21238025-C-A 19076139-C-A ***
56836598-A-ACTACT ***
10792703-CAGTCA-C,CACTCA ***
10807225-C-G ***
4100902-C-A 4232861-C-A ***
30943-T-C ***
30949-C-T ***
13483417-A-G 11327741-A-G ***
13488839-CGGT-C,CGGG 11333163-CGGT-C,CGGG ***
30938-A-T ***
9165510-C-A 9327901-C-A ***
28547088-TAA-T,TA 26400941-TAA-T,TA 14×A***
13449891-T-A,G 11294215-T-A,G ***
16666299-C-A 14554419-C-A ***
10892510-A-C,T ***
6869659-CA-C 7001618-CA-C 10×A***
10892563-CA-C ***
18857575-CTTTT-C 16745695-CTTTT-C 15×T***
18739678-C-A 16627798-C-A ***
19189226-C-A 17077346-C-A ***
23234067-C-A 21072181-C-A ***
13196078-C-A 11040402-C-A ***
13868174-T-C 11747468-T-C ***
13489828-C-A 11334152-C-A ***
13451044-T-C 11295368-T-C ***
10764617-C-T ***
13825620-T-C 11704914-T-C ***
13663783-G-A 11508107-G-A ***
13451919-A-T 11296243-A-T ***
13453104-T-G 11297428-T-G ***
13457322-CCCTCGTTTTG-C 11301646-CCCTCGTTTTG-C ***
13458782-A-C 11303106-A-C ***
13459187-G-A,T 11303511-G-A,T ***
13464981-C-A 11309305-C-A ***
13466533-G-A 11310857-G-A ***
13478842-AC-A 11323166-AC-A ***
13483113-A-T 11327437-A-T ***
13663945-C-G 11508269-C-G ***
13417079-A-G 11261403-A-G ***
13680784-T-G 11525108-T-G ***
13699242-GACTAT-A,G 11543566-GACTAT-A,G ***
13703530-CGGCCTGCAAT-C 11547854-CGGCCTGCAAT-C ***
13806300-G-A 11685594-G-A ***
13806302-A-G 11685596-A-G ***
13813679-G-A 11692973-G-A BY18905 ***
13814457-A-G 11693751-A-G ***
13814526-CGAATG-C 11693820-CGAATG-C 4×GAATG***
13821128-GGAGTC-G 11700422-GGAGTC-G ***
13451914-A-C 11296238-A-C ***
13140132-A-ACTCCACTCCA,G 10629618-A-ACTCCACTCCA,G ***
13837930-T-G 11717224-T-G ***
13651236-G-A 11495560-G-A ***
13825632-T-G 11704926-T-G ***
13825634-T-A 11704928-T-A ***
13674605-G-A 11518929-G-A ***
18511565-CAT-C 16399685-CAT-C P6_Dst 20×AT***
58977294-G-C 56831147-G-C ***
13846244-G-C 11725538-G-C ***
9730464-ATGTG-A 9892855-ATGTG-A IR3_Prx 11×TG***
13927656-TA-T 11806950-TA-T 9×A***
7333253-GTC-G 7465212-GTC-G 8×TC***
17071190-C-A 14959310-C-A 6×GAAA***
13138812-A-T 10628298-A-T ***
58994792-C-G 56848645-C-G ***
6117986-GCCTAA-G 6249945-GCCTAA-G ***
6347814-G-GAAAGAGAA 6479773-G-GAAAGAGAA 12×AGAA***
7354998-CCATA-C 7486957-CCATA-C 4×CATA***
8755817-GGAGA-G 8887776-GGAGA-G 12×GA***
9160320-AACACAC-A 9322711-AACACAC-A 17×AC***
9185787-TGAGAAAC-T 9348178-TGAGAAAC-T ***
9191076-AACAC-A 9353467-AACAC-A 20×AC***
13138803-T-A 10628289-T-A ***
13825296-C-T 11704590-C-T ***
13822123-A-G 11701417-A-G ***
13846498-T-A 11725792-T-A ***
10013333-C-T 10175724-C-T ***
58866135-CTCTA-C 56724728-CAGAT-C ***
58862415-TATCCA-T 56728450-ATGGAT-A ***
58977271-T-A 56831124-T-A ***
4554311-CAGGG-C 4686270-CAGGG-C 6×AGGG***
13451109-G-A 11295433-G-A ***
13477052-G-T 11321376-G-T ***
13471349-C-T 11315673-C-T ***
13453096-T-C 11297420-T-C ***
58985626-G-A 56839479-G-A ***
28799250-GA-A,G 26653103-GA-A,G ***
28805510-A-G 26659363-A-G ***
13687695-TA-T,TC 11532019-TA-T,TC ***
10019301-CAAA-C,CAAC 10181692-CAAA-C,CAAC ***
13680800-A-C,G 11525124-A-C,G ***
13833005-T-A,G 11712299-T-A,G ***
20021496-TTA-A,T 17909616-TTA-A,T P5_Prx 15×TA***
23415274-CTATA-C 21253388-CTATA-C 12×TA***
21402376-C-A 19240490-C-A BY31384 Y76412 ***
13811164-G-A 11690458-G-A ***
13846477-A-G 11725771-A-G ***
58826779-CCTTTCCAGTCCATTTCACTCCAGTCCATTACTATCCATT-C 56764051-GGAATGGATAGTAATGGACTGGAGTGAAATGGACTGGAAA-G ***
28787309-G-A 26641162-G-A ***
13844370-T-G 11723664-T-G ***
22277053-CAAGA-C 20115167-CAAGA-C DYZ19 ***
13851420-A-G 11730714-A-G ***
13854329-AT-A 11733623-AT-A ***
13862265-G-C 11741559-G-C ***
13863311-G-C 11742605-G-C ***
16060957-A-AG 13949077-A-AG ***
17332717-C-G 15220837-C-G ***
18855385-T-G 16743505-T-G ***
20632687-ACAGAGGGTGCAACTCTCC-A 18470801-ACAGAGGGTGCAACTCTCC-A P4_Prx ***
22236219-C-A,G 20074333-C-A,G DYZ19 ***
22339748-C-A 20177862-C-A DYZ19 ***
28787286-G-A 26641139-G-A ***
22339752-T-A 20177866-T-A DYZ19 ***
22356439-CAAGA-C 20194553-CAAGA-C DYZ19 ***
22454497-G-A 20292611-G-A DYZ19 ***
23311265-T-G 21149379-T-G ***
24842848-GGA-G 22696701-GGA-G P3_b2 ***
25024486-GTGTGGCCTC-G 22878339-GTGTGGCCTC-G g1 ***
25410290-T-A 23264143-T-A P2_r2 ***
28785540-C-A 26639393-C-A ***
28787261-A-G 26641114-A-G ***
30926-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page