Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z41150 > Z49 > 10023952GTCTC-G > S8183 > Y4356 > Y4354 > Y4355 > FGC20800 > FGC20775

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POSITION-REF-ALT (hg19) Blocks Names Region McDonald BED combBED STRFTDNA
195364
FGC-BigY
H3G7C
FGC
KK2P9
6999485-A-GFGC31484Y+
5739310-T-CFGC31479+
17579706-G-TFGC20775FGC20794 Y14093YY*+
15773565-C-AFGC31487YY+
15429333-G-AFGC20775FGC20789 Y14091YY+++
14391678-C-GFGC31486YY+
9076129-G-AFGC31485+
7315755-T-GFGC20775FGC20779 Y14089YY+++
21552883-C-TFGC31489Y+
22173652-A-GFGC20775FGC20807 Y14100YY*+
6507549-G-AFGC31483+
6476811-T-CFGC31482+
6449473-T-CFGC31481+
5762800-A-GFGC31480+
28621381-G-AFGC31491 Y14103Y**+
4385730-C-TFGC31477+
5024010-G-CFGC31478*
13840799-G-AFGC20775FGC20785 Y14139***
3224887-A-GFGC31476*
20454018-T-CFGC31488P5_Dst*
18153389-G-T**
7139159-C-TZ22015**
14681563-A-T**
14295385-C-A**
28588296-A-G**
9930039-G-A**
3158906-C-A**
14380937-C-T**
13291276-C-A**
18121509-G-T**
20248136-GTC-GP5_Dst9×TC**
17998049-A-GP7_Gap**
13740768-A-AAATGG4×AATGG**
2745740-T-A**
19644575-C-TP5_Prx**
19006136-C-CAAAAAAA21×A**
16292546-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTT-A48×T*****
21821577-C-A**
24627729-C-AP3_t2**
9340793-G-A**
24760000-TTATA-TP3_b211×TA**
21694858-C-G**
5313691-C-AY19503 FGC45705**
5626057-C-A**
13862506-A-G**
17929655-G-T**
13856812-A-C**
9930174-A-G**
5147441-C-CAAAAA30×A**
9930165-A-C**
14187101-C-A**
17086602-CATAT-C22×AT**
7717737-C-CTTCT13×TTCT**
58893615-G-A**
28602309-C-A**
7120613-T-G**
9930050-A-G**
16681591-C-A**
13194286-TTTCCATTCCATTCCA-T9×TTCCA****
58893635-C-A**
18365541-ATGTGTG-AP6_Prx20×TG**
2773757-G-T**
28253491-C-CAAAAAAAAAAAAAP1_b432×A**
7012613-C-A**
21362958-A-GFGC20775A9522*****
19055513-C-T**
8850048-C-A**
7142216-C-A**
8786586-C-T**
8293744-C-A**
24627794-CGT-CP3_t2**
14429405-TTA-T15×TA**
15637870-G-T**
15644626-G-A**
15336018-TC-T**
20206590-C-AFGC14744P5_Dst**
8075905-C-A**
7969158-G-T**
15770505-G-T**
7754735-G-T**
13416471-T-C**
9930169-G-T**
28487325-G-T**
15797259-C-G**
17648009-CAAA-C17×A**
8634381-T-TAC22×AC**
13437029-G-C**
28577950-T-TAC17×AC**
7359768-AATAT-A10×AT**
18789838-C-A**
18930549-C-A**
13637312-C-A**
18901126-C-G**
7217732-C-A**
13596381-G-A**
4503310-GTATTAT-G16×TAT**
15168976-C-A**
13601177-C-A**
6419046-ATG-A18×TG**
20248110-C-AP5_Dst**
9930192-T-G**
26089868-G-AP1_Y1***
25766625-G-TP1_b3***
26089870-A-TP1_Y1***
26495657-A-CP1_Y1***
25757968-T-AP1_b3***
25766599-T-AP1_b3***
26089887-C-TP1_Y1***
26089873-C-TP1_Y1***
26495658-C-AP1_Y1***
26089885-A-TP1_Y1***
26089884-C-TP1_Y1***
26089876-C-TP1_Y1***
25757965-T-AP1_b3***
26089882-A-TP1_Y1***
25766632-G-TP1_b3***
25979361-C-AP1_Y1***
25804964-C-GP1_b3***
26141237-A-CP1_Y1***
25845064-C-AP1_b3***
26171280-T-CP1_Y1***
25845063-C-AP1_b3***
26008346-T-CP1_Y1***
25845062-T-AP1_b3***
25845058-T-AP1_b3***
25845055-C-AP1_b3***
25845054-T-AP1_b3***
25845042-C-AP1_b3***
26089881-G-TP1_Y1***
26068751-A-GP1_Y1***
26277742-A-GP1_Y1***
25835327-A-CP1_b3***
26010270-A-GP1_Y1***
26128902-G-AP1_Y1***
26277795-C-TP1_Y1***
26278279-C-AP1_Y1***
26344122-T-CP1_Y1***
26098042-G-AP1_Y1***
26440434-C-TP1_Y1***
25956461-A-GP1_Y1***
26089879-C-TP1_Y1***
22309919-A-CDYZ19***
25727454-C-AP1_b3***
25207893-G-AP2_r1***
25207757-A-GP2_r1***
25207758-G-AP2_r1***
25207759-C-AP2_r1***
25207762-G-AP2_r1***
25207763-C-AP2_r1***
25207889-C-AP2_r1***
25207901-G-AP2_r1***
25207755-G-AP2_r1***
25231987-A-GP2_r1***
25268463-T-AP2_r1***
25268497-G-AP2_r1***
25268501-T-AP2_r1***
25268507-G-AP2_r1***
25268516-G-AP2_r1***
25207756-G-AP2_r1***
25207754-C-AP2_r1***
25268546-C-AP2_r1***
25207738-G-AP2_r1***
25207726-G-AP2_r1***
25207727-G-AP2_r1***
25207731-G-AP2_r1***
25207733-G-AP2_r1***
25207736-T-GP2_r1***
25207737-G-AP2_r1***
25207740-G-AP2_r1***
25207752-G-AP2_r1***
25207741-T-AP2_r1***
25207742-G-AP2_r1***
25207745-C-AP2_r1***
25207746-C-AP2_r1***
25207747-C-AP2_r1***
25207748-G-AP2_r1***
25207750-G-AP2_r1***
25268543-T-GP2_r1***
25334360-C-AP2_r1***
25697968-G-TP1_b3***
25626781-T-AA3560P1_b3***
25456432-T-AP2_r2***
25466457-T-GP2_r2***
25470576-T-AP2_r2***
25524618-C-AP1_gr1***
25524846-A-TP1_gr1***
25603687-C-AP1_gr1***
25626845-G-AP1_b3***
25456428-G-AP2_r2***
25626846-T-AP1_b3***
25646993-A-TP1_b3***
25662049-C-AP1_b3***
25662996-G-TP1_b3***
25675732-G-TP1_b3***
25689013-G-TP1_b3***
25690052-A-CP1_b3***
25456430-G-AP2_r2***
25456426-C-AP2_r2***
25364631-C-TP2_r2***
25395106-G-CP2_r2***
25366439-T-GP2_r2***
25372136-A-CP2_r2***
25376536-C-TP2_r224×T***
25382068-A-TP2_r2***
25382119-G-TP2_r2***
25394968-T-AP2_r2***
25428344-A-CP2_r2***
25456422-T-AP2_r2***
25429115-C-AP2_r2***
25429594-A-CP2_r2***
25429649-T-GP2_r2***
25431760-G-TP2_r2***
25434924-C-AP2_r2***
25439728-T-GP2_r2***
25456391-G-TP2_r2***
26495660-C-AP1_Y1***
26991212-G-AP1_r4***
26495662-G-AP1_Y1***
27982298-G-AP1_Y2***
27896112-G-TP1_Y2***
27904409-C-AP1_Y2***
27916323-T-AP1_Y2***
27916411-G-AP1_Y2***
27958515-A-TP1_Y2***
27974271-G-TP1_Y2***
27981977-C-AP1_Y2***
27991609-A-GP1_Y2***
27873523-A-TP1_Y2***
27994637-C-AP1_Y2***
27994780-C-AP1_Y2***
27997704-T-AP1_Y2***
27997706-C-AP1_Y2***
27997709-G-AP1_Y2***
27997712-G-AP1_Y2***
28006432-T-AP1_Y2***
28076198-T-AP1_Y2***
27896110-C-AP1_Y2***
27873407-A-TP1_Y2***
28160806-A-TP1_b4***
27838157-A-TP1_Y2***
27733436-T-AP1_Y2***
27733733-A-GP1_Y2***
27772564-T-GP1_Y2***
27772636-A-CP1_Y2***
27793188-G-TP1_Y2***
27808432-G-TP1_Y2***
27821642-C-AP1_Y2***
27838064-A-TP1_Y2***
27838162-A-TP1_Y2***
27873295-C-TP1_Y2***
27844487-C-TP1_Y2***
27844503-A-TP1_Y2***
27844504-G-TP1_Y2***
27844508-C-TP1_Y2***
27844510-C-TP1_Y2***
27844528-G-TP1_Y2***
27859448-T-AP1_Y2***
27859452-G-AP1_Y2***
28102879-T-CP1_Y2***
28170325-A-CP1_b4***
27721218-G-AP1_Y2***
28253610-T-AP1_b4***
28253595-G-AP1_b4***
28253597-T-AP1_b4***
28253599-C-AP1_b4***
28253601-C-AP1_b4***
28253603-T-AP1_b4***
28253604-G-AP1_b4***
28253606-C-AP1_b4***
28253611-G-AP1_b4***
28253593-C-AP1_b4***
28360468-C-TP1_gr2***
28460874-C-A***
28481058-T-G***
28481074-T-G***
28491351-C-G***
28491353-A-G***
28491354-A-G***
28491360-T-A***
28253594-T-AP1_b4***
28253592-C-AP1_b4***
28170576-C-TP1_b4***
28253548-C-AP1_b4***
28170582-A-TP1_b4***
28170668-G-AP1_b4***
28170939-T-CP1_b4***
28253528-T-AP1_b4***
28253534-T-AP1_b4***
28253537-G-AP1_b4***
28253544-T-CP1_b4***
28253545-G-AP1_b4***
28253551-T-AP1_b4***
28253589-C-AP1_b4***
28253552-G-CP1_b4***
28253580-T-AP1_b4***
28253581-T-AP1_b4***
28253583-C-AP1_b4***
28253584-C-AP1_b4***
28253586-C-AP1_b4***
28253587-C-AP1_b4***
28253588-T-AP1_b4***
27732431-A-GP1_Y2***
27716888-C-AP1_Y2***
26495665-G-AP1_Y1***
27048225-A-CP1_r4***
26991383-G-AP1_r4***
26991388-G-AP1_r4***
26995027-G-TP1_r4***
27004219-G-TP1_r4***
27004256-A-CP1_r4***
27004305-T-GP1_r4***
27004312-G-CP1_r4***
27049748-C-TP1_r4***
26991377-G-AP1_r4***
27062076-G-TP1_r4***
27062081-A-TP1_r4***
27062085-C-TP1_r4***
27062108-A-TP1_r4***
27062118-C-TP1_r422×T***
27082115-C-GP1_r4***
27082130-T-GP1_r4***
27082179-T-CP1_r4***
26991381-C-AP1_r4***
26991375-G-AP1_r4***
27129854-G-AP1_g3***
26902338-C-AP1_r3***
26511855-T-AP1_Y1***
26810690-T-CP1_g2***
26810711-A-TP1_g2***
26810747-C-AP1_g2***
26874053-T-AP1_r3***
26874061-G-AP1_r3***
26880327-A-TP1_r3***
26880358-A-TP1_r3***
26907499-A-TP1_r3***
26991372-C-AP1_r4***
26907554-A-CP1_r3***
26914231-A-TP1_r3***
26914240-C-TP1_r3***
26953187-G-AP1_r3***
25207723-T-GP2_r1***
26991368-T-AP1_r4***
26991369-G-AP1_r4***
26991371-T-AP1_r4***
27095971-G-TP1_r4***
27129891-C-AP1_g3***
27713548-G-TP1_Y2***
27427768-G-TP1_g3***
27395392-G-TP1_g3***
27397157-G-CP1_g3***
27404358-A-CP1_g3***
27411628-A-GP1_g3***
27411646-A-GP1_g3***
27411648-A-GP1_g3***
27424074-G-TP1_g3***
27466735-C-AP1_Y2***
27354671-A-CP1_g3***
27579055-G-TP1_Y2***
27585891-A-TP1_Y2***
27585905-A-TP1_Y2***
27602801-A-GP1_Y2***
27602821-A-GP1_Y2***
27618293-C-GP1_Y2***
27694797-C-AP1_Y2***
27694831-C-AP1_Y2***
27369053-G-TP1_g3***
27313331-C-AP1_g3***
27129895-C-AP1_g3***
27151356-C-AP1_g3***
27130402-G-AP1_g3***
27134966-G-TP1_g3***
27150672-A-TP1_g3***
27151338-G-AP1_g3***
27151341-G-AP1_g3***
27151342-A-GP1_g3***
27151343-G-AP1_g3***
27151345-T-GP1_g3***
27151358-T-AP1_g3***
27306081-T-CP1_g3***
27151399-C-AP1_g3***
27151410-G-CP1_g3***
27165214-C-AP1_g3***
27172243-G-TP1_g3***
27190518-A-GP1_g3***
27199101-C-TP1_g3***
27210976-G-TP1_g3***
27306022-C-TP1_g3***
25207724-G-AP2_r1***
24796612-G-TP3_b2***
25177354-T-Gg1***
21709115-T-G***
21515816-T-C***
21554276-C-A***
21569956-T-A***
21583823-C-A***
21584348-C-A***
21584491-C-A***
21709078-A-T***
21852594-C-A***
21515812-G-A***
21922105-A-T***
21922106-A-T***
21922111-G-T***
21922112-G-T***
22100768-T-A***
22146391-G-A***
22164458-G-A***
21515814-G-A***
21515804-A-G***
22234761-A-CDYZ19***
20993675-A-TP4_Dst***
20942974-T-AP4_Dst***
20947529-T-CP4_Dst***
20949797-G-AP4_Dst***
20950473-C-AP4_Dst***
20973339-C-TP4_Dst***
20993669-T-AP4_Dst***
20993673-A-CP4_Dst***
20993691-T-AP4_Dst***
21409017-C-A***
20993692-A-TP4_Dst***
20998053-T-AP4_Dst***
20998062-T-AP4_Dst***
21149614-C-A***
21153473-C-T***
21200202-G-T***
21347339-G-T***
22234119-T-ADYZ19***
22250201-G-ADYZ19***
20927148-T-GP4_Dst***
22315988-T-GDYZ19***
22315978-G-CDYZ19***
22315981-T-CDYZ19***
22315982-C-ADYZ19***
22315983-T-ADYZ19***
22315984-T-GDYZ19***
22315985-C-ADYZ19***
22315986-C-ADYZ19***
22315989-C-ADYZ19***
22315975-A-TDYZ19***
22315990-T-ADYZ19***
22315992-G-CDYZ19***
22315993-C-TDYZ19***
22315994-A-GDYZ19***
22334654-G-ADYZ19***
22341557-G-TDYZ19***
22341567-C-ADYZ19***
22315976-G-CDYZ19***
22315973-C-GDYZ19***
22250202-T-CDYZ19***
22256897-G-ADYZ19***
22256889-T-GDYZ19***
22256890-A-TDYZ19***
22256891-C-TDYZ19***
22256892-G-CDYZ19***
22256893-G-CDYZ19***
22256895-G-TDYZ19***
22256896-A-CDYZ19***
22258589-C-ADYZ19***
22315971-G-TDYZ19***
22262322-A-TDYZ19***
22267670-T-CDYZ19***
22273581-T-GDYZ19***
22274733-G-TDYZ19***
22303520-A-TDYZ19***
22315968-T-GDYZ19***
22315969-G-TDYZ19***
22315970-T-CDYZ19***
20927151-T-GP4_Dst***
20917293-G-AP4_Dst***
22341586-G-CDYZ19***
20199991-T-CP5_Dst***
20199958-C-TP5_Dst***
20199968-G-AP5_Dst***
20199972-T-CP5_Dst***
20199974-C-AP5_Dst***
20199975-A-TP5_Dst***
20199976-T-AP5_Dst***
20199979-G-AP5_Dst***
20199992-C-TP5_Dst***
20199946-T-AP5_Dst***
20199993-T-CP5_Dst***
20199994-C-AP5_Dst***
20199996-T-AP5_Dst***
20201331-G-TP5_Dst***
20213623-T-AP5_Dst***
20214435-C-TP5_Dst***
20217481-A-CP5_Dst***
20199950-A-TP5_Dst***
20198587-T-GP5_Dst***
20230838-T-CP5_Dst***
20062576-G-TP5_Prx***
20025464-T-CP5_Prx***
20025475-C-TP5_Prx***
20045200-C-AP5_Prx***
20057778-A-GP5_Prx***
20057782-T-CP5_Prx***
20062536-C-TP5_Prx***
20062538-G-TP5_Prx***
20084538-A-TP5_Dst***
20197222-T-CP5_Dst***
20104118-A-GP5_Dst***
20110583-G-AP5_Dst***
20110584-C-AP5_Dst***
20110585-G-AP5_Dst***
20110586-T-AP5_Dst***
20110587-T-AP5_Dst***
20110588-T-AP5_Dst***
20134418-C-TP5_Dst***
20230788-T-CP5_Dst***
20230845-A-GP5_Dst***
20913317-C-AP4_Dst***
20653986-T-GP4_Prx***
20497224-G-CP5_Dst***
20500986-A-GP5_Dst***
20500993-T-CP5_Dst***
20508973-C-AP5_Dst***
20510932-A-TP5_Dst***
20587756-C-AP5_Dst***
20598415-C-TP5_Dst***
20654063-G-CP4_Prx***
20447811-T-AP5_Dst***
20703678-C-TP4_Prx***
20800140-C-AP4_Prx***
20845289-A-TP4_Dst***
20845295-A-TP4_Dst***
20868988-C-AP4_Dst10×T***
20886833-G-AP4_Dst***
20888641-T-AP4_Dst***
20452414-T-GP5_Dst***
20447749-C-TP5_Dst***
20230851-T-GP5_Dst***
20255008-T-GP5_Dst***
20242939-C-TP5_Dst***
20243005-A-CP5_Dst***
20252821-G-AP5_Dst***
20252822-C-AP5_Dst***
20252825-G-AP5_Dst***
20252827-T-AP5_Dst***
20252829-G-AP5_Dst***
20311687-T-AP5_Dst***
20447748-A-CP5_Dst***
20332069-T-AP5_Dst***
20340135-C-TP5_Dst26×T***
20340704-G-TP5_Dst***
20347965-C-AP5_Dst***
20404559-T-GP5_Dst***
20432812-G-TP5_Dst***
20440369-A-GP5_Dst***
20447741-A-CP5_Dst***
22341578-G-ADYZ19***
22341711-G-ADYZ19***
25165722-G-Ag1***
24674335-G-TP3_b2***
24662335-C-TP3_b2***
24662375-T-AP3_b2***
24665119-G-TP3_b2***
24666956-T-GP3_b2***
24671239-G-CP3_b2***
24671242-A-GP3_b2***
24673110-G-TP3_b2***
24681606-A-TP3_b2***
24636366-T-AP3_t2***
24694518-T-GP3_b2***
24712715-C-AP3_b2***
24714119-C-AP3_b2***
24715716-C-TP3_b2***
24728585-A-CP3_b2***
24728594-T-CP3_b2***
24728615-A-TP3_b2***
24662330-A-TP3_b2***
24636365-T-AP3_t2***
24749003-T-AP3_b2***
24548198-T-CP3_t2***
24420946-C-T***
24420952-C-T***
24420953-G-T***
24420962-A-T***
24420963-C-T***
24472448-A-T***
24472464-T-C***
24548204-A-TP3_t2***
24629582-G-AP3_t2***
24562469-T-CP3_t2***
24575810-A-TP3_t2***
24575836-A-GP3_t2***
24575839-C-TP3_t2***
24577803-T-AP3_t2***
24582563-G-AP3_t2***
24614167-A-CP3_t2***
24623430-G-AP3_t2***
24728632-T-CP3_b2***
24749023-T-CP3_b2***
24420941-G-T***
24878367-C-Ag1***
24878356-G-Ag1***
24878357-G-Cg1***
24878360-A-Gg1***
24878361-C-Gg1***
24878362-A-Gg1***
24878363-G-Cg1***
24878366-A-Cg1***
24878368-A-Tg1***
24878354-C-Gg1***
24883551-A-Gg1***
24919558-A-Tg1***
25127486-C-Tg1***
25127490-A-Cg1***
25127495-G-Tg1***
25165697-G-Cg1***
25165717-G-Ag1***
24878355-T-Ag1***
24878353-T-Ag1***
24754972-T-AP3_b2***
24778874-G-AP3_b2***
24762202-T-CP3_b2***
24762341-A-CP3_b2***
24775578-T-CP3_b2***
24778462-T-CP3_b2***
24778804-A-GP3_b2***
24778841-A-CP3_b2***
24778872-G-AP3_b2***
24778890-C-AP3_b2***
24878352-A-Cg1***
24783607-G-TP3_b2***
24794427-T-GP3_b2***
24794442-A-GP3_b2***
24878340-C-Gg1***
24878341-T-Gg1***
24878344-A-Tg1***
24878350-A-Gg1***
24878351-T-Ag1***
24420945-C-T***
24420937-C-T***
22345689-G-TDYZ19***
22802917-C-T***
22739614-G-A***
22802908-G-T***
22802909-G-T***
22802911-C-T***
22802913-C-T***
22802914-C-T***
22802916-G-T***
22802918-C-T***
22520585-G-C***
22802919-A-T***
22802921-A-T***
22802922-A-T***
22802923-G-T***
22802924-G-T***
22802926-G-T***
22802927-G-T***
22602423-A-G***
22520564-A-G***
22816340-C-G***
22435209-T-GDYZ19***
22358798-T-GDYZ19***
22359508-T-CDYZ19***
22431994-C-TDYZ19***
22431996-C-ADYZ19***
22435171-A-GDYZ19***
22435177-T-GDYZ19***
22435197-G-ADYZ19***
22456848-C-ADYZ19***
22520558-G-A***
22481310-G-TDYZ19***
22485798-T-CDYZ19***
22498472-T-ADYZ19***
22502778-T-CA4404DYZ19***
22508107-T-CDYZ19***
22520548-G-C***
22520555-A-G***
22520557-G-C***
22802930-C-T***
22816341-T-G***
24420933-C-T***
24084251-A-CP3_b1***
24060333-C-AP3_b1***
24084193-A-CP3_b1***
24084198-T-CP3_b1***
24084207-A-CP3_b1***
24084229-A-CP3_b1***
24084237-A-CP3_b1***
24084247-T-CP3_b1***
24116397-T-GP3_b1***
24044842-G-T***
24192261-T-AP3_b1***
24216307-G-TP3_b1***
24341755-T-GP3_t1***
24353314-A-CP3_t1***
24353317-A-CP3_t1***
24353319-T-CP3_t1***
24353321-T-CP3_t1***
24046192-T-G***
24044366-A-C***
23181428-T-A***
23816070-C-A***
23223282-T-A***
23488834-T-A30×A***
23693647-G-A***
23742316-C-A***
23779785-A-T***
23779795-G-A***
23807520-G-C***
23831286-A-G***
24042923-A-G***
24022644-A-C***
24023811-T-A***
24025025-T-G***
24034018-A-G***
24039543-A-C***
24039589-A-C***
24041089-T-G***
24041125-T-G***
28491362-A-G***
28808696-A-G***
28491372-T-A***
24665186-AT-AP3_b2***
24582504-ACCT-CCCCP3_t2***
24582515-CAAAA-CP3_t231×A***
24582837-CA-CP3_t217×A***
24600670-C-CAP3_t216×A***
24604697-AT-AP3_t211×T***
24607321-C-CTP3_t212×T***
24637476-TTGTG-TP3_t211×TG***
24668845-AT-AP3_b211×T***
24573423-CTT-CP3_t221×T***
24675448-C-CTP3_b212×T***
24684828-TAC-TP3_b215×AC***
24736119-CA-CP3_b211×A***
24771309-TC-TP3_b2***
24773126-T-TAP3_b210×A***
24783187-AGAGT-AP3_b2***
24785778-C-CTP3_b214×T***
24582352-C-CTP3_t217×T***
24542299-CA-CP3_t2***
24860046-G-AAP3_b2***
22490746-GT-TCDYZ19***
22338124-GGGCT-TGGCADYZ19***
22341511-TTTCG-GTTCTDYZ19***
22421369-ATG-TTCDYZ19***
22421423-GT-GDYZ19***
22431987-GTC-TTADYZ19***
22481328-TTTAG-GTTATDYZ19***
22481343-TG-TDYZ19***
22504216-TT-GDYZ19***
24525866-TA-TP3_t29×A***
22505199-TG-GTDYZ19***
22505253-GG-TCDYZ19***
22703626-G-AA***
24014304-AACAGTGATTAATATAAAG-A***
24025840-GAA-G9×A***
24044865-AT-A***
24278325-AGGGAGGGAAGGAAGGAAGG-GGAAGGAAGGGAAGGAAGGAP3_b1***
24859445-CTTGAATAAAATACTATT-CP3_b2***
24866990-A-ATP3_b211×T***
22337983-TA-GTDYZ19***
25990634-GTTTTT-GP1_Y123×T***
25675939-T-TAP1_b310×A***
25684273-G-GAP1_b310×A***
25689061-C-CAP1_b39×A***
25706148-CA-CP1_b316×A***
25718213-G-GTTP1_b313×T***
25845045-TTC-AAAP1_b3***
25940445-C-CTP1_Y117×T***
25995492-GTATA-GP1_Y124×TA***
25663035-CT-CP1_b3***
26004895-G-GTP1_Y110×T***
26120152-T-TCCTAP1_Y1***
26120162-C-CTTCTP1_Y1***
26228677-CTTTCTTTCTTTC-TTTTTTTTTTP1_Y1***
26267693-TAC-AAP1_Y1***
26277717-G-TTP1_Y1***
26283209-C-CAP1_Y121×A***
25675782-T-TAP1_b312×A***
25617175-TTG-TP1_gr119×TG***
25177324-TAC-AAAg1***
25424574-C-CTP2_r217×T***
25300414-CA-CP2_r18×A***
25301996-CT-CP2_r1***
25306677-CA-CP2_r1***
25310157-AAG-AP2_r1***
25378984-GTCC-TTP2_r2***
25388480-CT-CP2_r2***
25395700-TCC-TP2_r2***
25431153-C-CTP2_r211×T***
25567552-AT-AP1_gr117×T***
25434990-TA-TP2_r2***
25437894-T-TAP2_r212×A***
25447269-GGTAGTA-GP2_r29×GTA***
25479931-TA-TP2_r2***
25493225-CT-CP2_r2***
25514627-CT-CP1_gr113×T***
25537117-G-GTP1_gr110×T***
25545770-C-CTP1_gr113×T***
22338103-ATG-GTCDYZ19***
22337965-ACTTT-CCTTCDYZ19***
26320658-TA-TP1_Y114×A***
20295499-C-CTP5_Dst11×T***
20230813-CAGACAGC-TAGATAGTP5_Dst***
20230825-TCCC-ACCTP5_Dst***
20231615-GG-AP5_Dst***
20242175-TA-TP5_Dst8×A***
20243015-GTTTGTTTT-TTTTTTTTAP5_Dst***
20274242-CT-CP5_Dst***
20291027-T-TAP5_Dst11×A***
20300694-C-CAP5_Dst***
20229254-G-GTP5_Dst15×T***
20333189-C-CAP5_Dst17×A***
20340720-T-TAAP5_Dst15×A***
20348763-GT-GP5_Dst9×T***
20364225-CT-CP5_Dst11×T***
20391948-G-GAP5_Dst11×A***
20404445-CAAAA-CP5_Dst29×A***
20413787-TA-TP5_Dst12×A***
20230152-TAA-TP5_Dst16×A***
20221481-G-GAP5_Dst10×A***
20497215-ACCCA-CCCCCP5_Dst***
19839643-G-AAP5_Prx***
19693687-A-ATP5_Prx10×T***
19713183-CT-CP5_Prx17×T***
19726191-TA-TP5_Prx12×A***
19727387-TG-CCP5_Prx***
19727393-TA-CCP5_Prx***
19739351-A-ACAACAGP5_Prx***
19829290-GTTTACTTTC-TTTTTTTTTTP5_Prx***
19930469-GC-TTP5_Prx***
20217548-CT-CP5_Dst***
19948161-CCCTCCCTCCCTCCCTCCCTC-TP5_Prx***
20084142-TAGAG-TP5_Dst13×AG***
20087764-GAA-GP5_Dst13×A***
20110156-AT-AP5_Dst***
20110561-G-GAP5_Dst20×A***
20130786-C-CAP5_Dst16×A***
20194619-AT-AP5_Dst8×T***
20217433-GCCT-CCCCP5_Dst***
20440392-T-TTTGTTGP5_Dst13×TTG***
20500941-GGA-GP5_Dst***
22337788-ACCTC-TCCTTDYZ19***
22244982-GTTATATCCAGAGTTTCTTC-CTGCAGCATCATTCTTGAAGDYZ19***
21030546-T-TAP4_Dst13×A***
21132667-GTCTACATTTCTGTG-TTTTTTTTTTTTTTT***
21170319-G-GTT14×T***
21569953-GTC-G***
21714802-T-AA***
21894633-CAAAAA-C15×A***
22234333-TAT-ACDYZ19***
22245569-AGCTA-TGTTGDYZ19***
21013084-A-ATP4_Dst14×T***
22245578-CATTTA-GCTTTGDYZ19***
22247019-AGTC-TCTADYZ19***
22269595-TTCG-ATTADYZ19***
22273537-GACTTCA-CACCTTDYZ19***
22273575-TTACA-GTTACDYZ19***
22300778-GGC-AGTDYZ19***
22300832-AGG-GGTDYZ19***
21022787-GA-GP4_Dst11×A***
21008949-TTTTG-TP4_Dst4×TTTG***
20587808-AAT-AP5_Dst10×AT***
20914498-C-CAAAP4_Dst12×A***
20598479-TA-TP5_Dst***
20613609-CT-CP4_Prx13×T***
20655016-ATATATA-GP4_Prx***
20717039-C-AAP4_Prx35×A***
20848244-A-ATP4_Dst19×T***
20859789-G-GAP4_Dst13×A***
20868938-CAACATGTG-AAAAATATTP4_Dst***
20917254-CA-CP4_Dst14×A***
20989908-C-CTP4_Dst11×T***
20949797-GGAAAG-AGGCACP4_Dst***
20949887-AAGC-CAGTP4_Dst***
20949903-TCC-CCTP4_Dst***
20951141-GAAAG-AAAAAP4_Dst***
20951557-TTCA-TP4_Dst***
20963889-T-TAP4_Dst***
20970352-C-CAP4_Dst12×A***
20989154-CATATAT-CP4_Dst19×AT***
26284858-CA-CP1_Y119×A***
26379434-G-AAP1_Y1***
19187441-ATACAC-TTTTT***
58823679-TCCATTTGATGCCATC-T***
58820173-GAGTCCTTTCCAGTA-CTTTCCATTCGAGTG***
58820199-AATCCCATCCAATCCCATCTACTCC-GTTCCATTTCTTTCCGTTCTGTACG***
58820228-AATTCCTTTCCATTC-CTACCGTTCGATTT***
58820505-CGTTCT-TATTCC***
58820551-ATTCGTGTTGAT-GGTCCATTACAG***
58820956-GAGTCC-CATTTG***
58822019-GTCCATTAGTTTCGACTCCATTGCATTCGAGTGCATTCCATTCCGTGGCTGTC-ATTCAATTCCGTTCTATCCGATTCCATTCCATTCTATTCCTTTCCTTTCAATT***
58823840-TG-AT***
58819399-CTTG-ATTC***
58831196-TT-CC***
58831878-A-ATTGCC***
58831921-AA-TC***
58843055-CTTTGG-C***
58858827-CA-C***
58858972-GATTTTATTGCATTAGATTCTATTC-TGTGACACAAGCTGGAGTGCAGTAG***
58866021-C-CCCATTCCATTCCATT12×CCATT***
58819805-GTCGA-TTCGG***
28819013-TAAG-GAAA***
58912765-ATG-TTC***
28226238-C-CTP1_b413×T***
28052861-CT-CP1_Y2***
28065155-CT-CP1_Y215×T***
28102968-C-CTP1_Y28×T***
28142037-AT-AP1_b49×T***
28170992-GA-GP1_b4***
28180701-CA-CP1_b416×A***
28185939-G-GTP1_b412×T***
28245714-AT-AP1_b415×T***
28802816-ATGGGT-GAGTAA***
28253555-TGAAGCT-AAAAAAAP1_b4***
28260208-CT-CP1_b413×T***
28360492-T-TAP1_gr213×A***
28384225-T-TAP1_gr213×A***
28406839-CAA-CP1_gr216×A***
28588050-CATC-T***
28588302-TGA-CGG***
28802650-GGTGAAT-CGTGGAG***
58890988-TC-AT***
58912818-GATG-CATT***
27996899-GTTAT-GP1_Y2***
19775300-GTCTT-GP5_Prx***
59030571-TT-AA***
59031759-TCT-ACC***
13141938-T-TTCCAC4×TCCAC***
13545349-AAAGAAAG-A***
14324892-TTC-T***
14937846-T-TTCTTTTCTGA***
14937853-C-CTTTTCTTTTA***
19868141-GCTT-GP5_Prx***
58987988-AAACC-TAACG***
21477779-AAG-A***
24296169-GC-GP3_t1***
25176848-TTC-Tg1***
25323010-ACT-AP2_r1***
25333855-AC-AP2_r1***
26463094-TTTC-TP1_Y1***
26810593-TTC-TP1_g2***
59008112-GTTC-TTTT***
58987979-TAC-AAG***
58912831-TTGATG-T***
58977578-TTGCAT-CTCCAC***
58912846-GA-TC***
58974223-TTCG-ATCC***
58974241-AAATCAAT-CCCTCCAC***
58976137-CTCCAG-ATCCGT***
58976348-CACAT-TCCAC***
58977556-TG-CA***
58977571-AT-CA***
58977589-CCCAC-TCCAT***
58987918-TG-CA***
58977738-CATTG-AATTA***
58977817-CC-GA***
58979078-TTCCA-CTCCT***
58980486-ACCA-GCCG***
58981256-GG-CA***
58982110-GCAC-CCAT***
58985427-GGG-AGA***
58985437-TCTGC-CCTGT***
28030763-T-TCTTGP1_Y2***
27996127-G-GAP1_Y214×A***
26383340-CTT-CP1_Y116×T***
27186323-G-GAP1_g319×A***
27129771-CAA-CP1_g325×A***
27134689-TA-TP1_g310×A***
27147072-AT-AP1_g3***
27147441-A-ATP1_g312×T***
27155035-CGT-CP1_g317×GT***
27165197-A-ATP1_g311×T***
27166686-G-GAP1_g311×A***
27229875-GACTAA-GP1_g3***
27062945-GGTAGTA-GP1_r411×GTA***
27232108-GTTTTTTCTTTCT-GP1_g3***
27235637-C-CTP1_g38×T***
27248568-GTTT-GP1_g318×T***
27295701-TA-TP1_g3***
27299410-AT-AP1_g39×T***
27301679-AT-AP1_g39×T***
27311771-TA-TP1_g39×A***
27125405-CAAAGCAGAG-CP1_g3***
27049850-AT-AP1_r417×T***
27346296-T-TTGCP1_g3***
26902325-TAG-AAAP1_r3***
26400705-AT-AP1_Y115×T***
26495702-CTTTG-TTTTTP1_Y1***
26593442-CT-CP1_g211×T***
26626273-AT-AP1_g29×T***
26880198-CT-CP1_r325×T***
26900719-GA-GP1_r317×A***
26902316-AAAAAG-AP1_r3***
26907510-A-ATP1_r322×T***
27046828-CT-CP1_r410×T***
26914241-ACTA-TCTTP1_r3***
26931754-C-CAP1_r38×A***
26953164-AAG-AP1_r3***
26991220-GAAAG-AAAAAP1_r4***
26991363-AAAAG-AP1_r4***
27001771-CTTT-CP1_r424×T***
27004222-CTT-CP1_r425×T***
27037868-C-CTP1_r413×T***
27320941-A-ATTP1_g311×T***
27398533-AG-AP1_g3***
27991626-GGA-GP1_Y213×GA***
27873284-CTCTTTC-TTTTTTTP1_Y2***
27838074-ACTACAAA-TCTTCAATP1_Y2***
27838277-AGCA-TGCTP1_Y2***
27844492-ATA-TTTP1_Y2***
27844515-ATTTATTTC-TTTTTTTTTP1_Y2***
27844536-GTTA-TTTP1_Y2***
27866070-C-CTP1_Y210×T***
27868124-CA-CP1_Y213×A***
27880454-CA-CP1_Y2***
27819786-AT-AP1_Y213×T***
27896007-CA-CP1_Y212×A***
27909479-TA-TP1_Y2***
27949379-C-CAP1_Y213×A***
27971749-AAAAAC-AP1_Y2***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAAP1_Y2***
27978560-A-ATP1_Y214×T***
27988706-AT-AP1_Y2***
27832305-A-ATP1_Y217×T***
27796697-TA-TP1_Y28×A***
27398536-GCAAAC-AAAAAAP1_g3***
27694706-ATT-AP1_Y228×T***
27398546-GAAG-AAAAP1_g3***
27412214-CA-CP1_g38×A***
27583214-G-GTP1_Y211×T***
27585915-GTC-TP1_Y2***
27602764-CATTA-TATTTP1_Y2***
27602804-AGC-GGGP1_Y2***
27643245-CT-CP1_Y2***
27721225-AT-AP1_Y2***
27795119-CTA-CP1_Y2***
27728064-CACCTTATATGACTTTTTCAAATAAA-CP1_Y2***
27728377-CA-CP1_Y2***
27762778-TACAC-TP1_Y217×AC***
27777759-GA-GP1_Y219×A***
27785823-G-GAAP1_Y28×A***
27789487-T-TGP1_Y28×G***
27794110-CT-CP1_Y2***
27794677-C-CATP1_Y212×AT***
19513143-CTTTTTT-C20×T***
19126462-T-AAAAAAAAA***
28491374-T-A***
58987979-T-A***
58987918-T-C***
58987919-G-A***
58987924-T-C***
58987931-C-T***
58987939-G-C***
58987950-C-A***
58987966-T-C***
58987988-A-T***
58980812-A-C***
58987992-C-G***
58996146-G-T***
58996999-A-C***
59022405-A-C***
59022406-T-C***
59031692-C-T***
59031759-T-A***
58987902-C-G***
58980811-C-A***
13488715-CA-GG***
58858931-G-T***
58834721-C-A***
58844584-T-C***
58848222-T-A***
58858789-G-T***
58858918-A-T***
58858922-C-A***
58858929-T-C***
58858932-C-TS3129***
58980806-T-A***
58858948-A-C***
58858999-T-C***
58905230-T-G***
58905347-A-T***
58912803-G-T***
58976464-C-G***
58977576-C-A***
58977673-G-T***
24115164-CCACA-CP3_b123×CA***
28588259-ATG-TTA***
58831972-T-C***
20428140-AT-AP5_Dst17×T***
9577017-C-CAAIR3_Prx15×A***
24754928-TA-TP3_b215×A***
13405369-TG-T***
9753975-CT-C20×T***
27760220-G-GTP1_Y214×T***
24618868-C-CTP3_t212×T***
4388469-C-CA14×A***
2806195-ATTTTT-A36×T***
28033129-CA-CP1_Y217×A***
2861533-TCA-T***
4031513-CAA-C16×A***
4973668-C-CAA19×A***
5937242-C-CTA18×TA***
5945467-CTTTTTT-C25×T***
6134454-CTTGGGCAGGGAAGGC-GGGGGGGGGGGGGGGG***
6149994-TATGTGGGTGTG-CACACACATATAIR3_Dst***
13859887-ATCGAA-CTGGAG***
9559580-C-CTIR3_Prx11×T***
16165136-GGA-GP8_Dst13×GA***
16150948-TA-TP8_Dst22×A***
15832207-TC-T***
24458760-C-CA18×A***
25542210-GCT-GP1_gr111×CT***
7456724-CA-CIR1_L15×A***
13488681-AGG-GGC***
13488987-CAGGGT-TGGGGC***
21182397-C-CT20×T***
7032333-ATTTTTTT-A22×T***
5066020-T-TA10×A***
20428495-AT-AP5_Dst15×T***
24562514-AGT-AP3_t2***
10014645-C-CTAAT4×TAAT***
24290749-G-GCAP3_t120×CA***
27561716-C-CAP1_Y216×A***
19517906-TTTTG-T6×TTTG***
27173659-G-GAP1_g313×A***
28017356-C-CAP1_Y216×A***
58834702-C-T***
58831908-A-G***
6323750-C-CAIR3_Dst12×A***
28808697-A-G***
28802541-T-A***
28802543-G-T***
28802561-A-G***
28802562-T-A***
28808694-G-A***
28808695-A-T***
20025459-C-TP5_Prx***
28808698-T-A***
28802532-T-A***
28808699-T-A***
28808700-G-T***
28808701-A-G***
28808702-A-G***
28808703-T-A***
28808704-G-A***
28808705-G-T***
28802536-G-A***
28802529-A-G***
28808710-A-T***
28610336-G-A***
28491380-G-A***
28491381-A-G***
28491385-C-A***
28587961-C-A***
28588302-T-C***
28588304-A-G***
28588314-A-G***
28725917-C-A***
28797875-T-A***
28728418-C-A***
28797860-G-T***
28797862-G-T***
28797865-G-A***
28797868-A-G***
28797869-A-C***
28797870-G-A***
28797872-G-T***
28808706-A-G***
28808711-A-C***
58831893-A-G***
58821721-C-T***
58820496-A-T***
58820499-C-A***
58820535-T-G***
58821675-C-T***
58821687-A-T***
58821706-G-C***
58821720-T-A***
58823347-C-A***
58820192-T-C***
58823348-A-T***
58824853-C-G***
58824854-C-T***
58824863-C-A***
58825403-T-A***
58831858-A-C***
58831870-G-T***
58820492-G-T***
28808740-A-C***
28808712-T-A***
28808725-A-C***
28808713-G-T***
28808714-G-C***
28808716-A-T***
28808717-T-C***
28808721-A-T***
28808722-T-G***
28808724-G-A***
28808726-A-T***
28808739-G-T***
28808727-T-C***
28808728-C-A***
28808731-A-T***
28808732-T-G***
28808733-C-G***
28808734-G-A***
28808736-A-T***
28808737-T-A***
6150007-GT-ACIR3_Dst***
7100969-TT-G***
18928753-GA-G9×A***
13856777-AAAT-GAATGGAGG***
13855157-AA-TT***
13856266-GGGAA-TGGAT***
13856296-TC-CG***
13856382-CT-GG***
13856428-AAATC-GAATG***
13856621-TG-CA***
13856627-TA-GG***
13858287-TT-CA***
13847028-TCGAAAAGAACGGGATA-CTGAATTGAATGGAACG***
13858399-GGATTCG-AGAAACA***
13858425-GAATGGCATCAAATAT-CAAAGGAATAGAAAGG***
13860431-CATCGAAA-AATGGAAT***
13860446-CATC-AATG***
13860553-TC-GG***
13860567-ATGGT-CTGGA***
13866202-ATAT-CTAC***
13847060-AACTC-GAATG***
13843713-A-AGGAATGGAATGGAAT10×GGAAT***
13869501-CCCGGAG-ACTGGAA***
13801228-AT-GG***
13735026-GAACTC-CGAACG***
13735044-CTGG-ATGA***
13740632-GAACTC-CGAACG***
13740761-GGA-CGG***
13745775-TGTCA-CCTCG***
13748577-TCNNN-GGAAC***
13801012-TGCAATG-AGGAATA***
13801234-AAG-GAA***
13839837-GG-AA***
13801267-CCAAATA-TCATATT***
13804029-TG-CA***
13804146-CAATAGAA-GAATGGAC***
13809598-GCAATTGG-CCAATTGA***
13809611-ATGGAATGA-GTTGTATGG***
13809728-ATAAA-GGAAT***
13809826-CTT-ATG***
13833115-CGGATTCG-TGGAATCC***
13866899-TTAC-GGAA***
13869517-CTCGAGT-TTGAAC***
13731874-AC-GT***
18439255-G-GTP6_Dst25×T***
18008640-CAGATC-TTTTTTP7_Dst***
18011005-C-CTP7_Dst20×T***
18325701-AT-AP6_Prx27×T***
18369645-TAC-AAAP6_Prx***
18371082-TTGCGG-CTGCAAP6_Prx***
18398153-GTGTGTGTGTGT-ATATATACACAAP6_Gap***
18429196-C-CAP6_Dst17×A***
18447620-AG-TTTP6_Dst***
17723768-GA-G***
18454903-T-TTCTCP6_Dst***
18490252-C-CTP6_Dst11×T***
18501374-A-ATP6_Dst10×T***
18533107-CT-AAP6_Dst***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGTP6_Dst***
18534201-TAC-TP6_Dst8×AC***
18615932-C-CT27×T***
17994874-C-AAP7_Prx39×A***
17713845-ATCTTC-TTTTT***
13869556-TATGGACTG-AAAGGAAAC***
15832213-CTTC-TTTT***
14286784-CTTTTTT-C22×T***
14698482-CAACAACAAC-AAAAAAAAAA***
14867088-CTTTC-TTTTT***
15157860-CAAAAAAA-C21×A***
15358788-G-AA***
15410629-ATC-A***
15477291-CAAAAAA-C18×A***
15928370-GC-T***
17143891-AT-A35×T***
16099087-CTG-CP8_Prx23×TG***
16150095-CTT-CP8_Dst22×T***
16157692-CTTCAAAATAAAT-AAAAGAAAAGAAAP8_Dst***
16157793-ACTTTCCAATGACGTTCTTAGAGCAACTGACTAAGTCTTCTCATT-GGGTGTTGGACTTTGTTCTTGGGATCAGCTTGAACCTTTCAAGACP8_Dst***
16162095-CA-CP8_Dst19×A***
16250653-A-TT***
16301002-GAAAA-G18×A***
16913422-CAAAAAAAAA-C21×A***
13734989-GTGTAATTGAATGATATCGAAAGGAAGGGAA-ATGGAATGGATCAAAATGGATTTGAACAGAT***
13729845-CCATT-GTATA***
7165286-GTTGTTGTTG-TTTTTTTTTT***
9629451-CA-CIR3_Prx12×A***
9571868-TTG-TIR3_Prx10×TG***
9589965-GAC-GIR3_Prx***
9591034-GA-GIR3_Prx12×A***
9602735-TTG-TIR3_Prx8×TG***
9605871-T-TAIR3_Prx16×A***
9620171-C-CAIR3_Prx11×A***
9622506-CTTTA-TTTTTIR3_Prx***
9631674-TGTGTCTGTGACATG-TIR3_Prx***
9539555-CT-CIR3_Prx***
9634219-CT-CIR3_Prx9×T***
9666957-GA-GIR3_Prx10×A***
9745894-T-TC***
9745897-AG-CC***
9930165-AGCGG-CGCGT***
9931363-GTT-G9×T***
9935902-CAAAGAG-ATAGGAC***
9556485-CT-CIR3_Prx9×T***
9535155-A-ATIR3_Prx17×T***
10023660-GCCTATTTC-CCATCTCTG***
8216406-CTTTTT-C16×T***
7235824-CTTTCTTG-TTTTTTTT***
7270276-CTTTTTTTT-C25×T***
7414304-AG-A***
7470726-G-AAIR1_L***
7984040-TAAAA-T21×A***
7988099-CTTTT-C14×T***
8182205-CAAAA-C18×A***
8314146-CT-C24×T***
9345055-CT-GG***
8422869-CAAAAA-C17×A***
8481967-TAA-T15×A***
8555560-T-TTTGTTC***
8568465-GTTTTTTTT-G22×T***
8631383-CTT-C26×T***
9304429-CTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGG***
9307402-GTGTGTG-TTGAGTT***
9336652-AC-CT***
10004786-TATATACACAG-CATAAAGCAT***
10032525-GC-AA***
13723314-ATGGAATGGAAAGGAGGC-CTCACATAGAACAGCCTT***
13485676-GTCAC-ATCAA***
13467778-GGCAGAA-CGAATAT***
13467946-GG-AT***
13469049-ATGTG-CTGTC***
13472093-ACAG-GCAT***
13472117-GCGCA-CCGCC***
13480701-GCC-TCT***
13484457-AT-CC***
13488959-GCC-TCA***
13466299-TGGTTGATCA-CTGATCCCTC***
13544968-TTTGA-ATTGG***
13681005-GA-CG***
13681013-GTGGA-ACAAT***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA***
13699416-GAAACGAATTC-TACACAAATGG***
13700766-GGCGAAA-ATGGAAT***
13702191-GTG-CTC***
13466377-CT-GG***
13461724-TTA-ATG***
13120632-TA-T8×A***
13143628-CATTGCAC-TATTCCAT***
13140111-AATCCATTAAACTCGC-CATTCAACTCCATTGA***
13140532-TC-GT***
13140566-CCCT-TCCA***
13140585-TTAA-CACC***
13140589-ACTCCAC-TTTGCAT***
13143428-CATTTT-C***
13143617-CC-AT***
13143655-AACATCTCACTA-TGGATCAAACTT***
13461146-AAAGA-CAACT***
13194777-ATTGATA-CTCCATT***
13203910-CGGCGATGATGACGGCATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-ATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT***
13275922-C-CA***
13393449-A-ATT12×T***
13422404-AAGTT-TATAA***
13446403-CA-TG***
13447257-AATTT-CATTC***
13461135-TAG-CAA***
20025462-T-CP5_Prx***
18902863-C-A***
20025454-T-CP5_Prx***
7277048-G-GA12×A***
3873186-C-CA15×A***
10033141-AG-A***
27585917-C-CTP1_Y219×T***
2888870-CAAAAAAAAAAAAAAAAAA-C32×A***
2957323-CT-C15×T***
4118470-TG-CA***
5512875-CA-C22×A***
7636010-TAAAA-T15×A***
58911339-A-G***
8439220-G-GTTT14×T***
8462064-C-CA26×A***
8740675-G-TTTTTTTTT17×T***
8740664-G-GTTTTTTTT10×T***
9345037-AGGC-GGGG***
9403521-G-GTTTTTTTTTTTTTTTTTTTT21×T***
9700780-C-CAAATAAIR3_Prx23×A***
19272142-C-CA18×A***
58909842-A-G***
13122131-CT-TG***
58882798-G-C***
58859265-G-T***
58863533-G-A***
58863537-G-C***
58863541-C-A***
58863553-A-T***
58866940-G-C***
58870123-T-C***
58892080-G-A***
58908592-C-T***
58903580-A-T***
58903597-T-C***
58904226-C-A***
58904246-A-C***
58905732-A-G***
58907225-C-G***
58907403-T-A***
10013122-GTTT-TTGG***
13140112-ATCCATTAAAC-A***
58856201-T-A***
25819576-ATTC-CTCTP1_b3***
22360129-AGTT-GGADYZ19***
22502012-GGTG-AGTCDYZ19***
22568321-C-CTG***
23801733-C-CAAAAAA31×A***
24314080-TCTC-CCTCAP3_t1***
24420879-A-ATT43×T***
25590627-TG-CAP1_gr1***
25998253-GC-TTP1_Y1***
22236465-CCACC-ACAGTDYZ19***
27422266-TG-AGCAP1_g3***
27483928-A-ATP1_Y210×T***
27484015-ATC-GCTP1_Y2***
27581657-TGT-GAAP1_Y2***
27751236-CATTG-TATCAP1_Y2***
27751261-CA-GTP1_Y2***
27751270-GTC-ATTP1_Y2***
22245707-ACTC-CATTDYZ19***
21402181-C-CTTTTTTT34×T***
13255410-G-GT11×T***
15015255-C-CT24×T***
13484392-TGCCCTCTG-CGCACTCCT***
13488959-GCCCAG-TCGCCT***
13488988-AGGGTAGCTCCACCTCG-GGGGCATCTGCACATCA***
13556425-GTAG-CTAT***
13716447-CGC-GGA***
13923535-AA-TT***
14698458-C-CAAAAAAAAAAA19×A***
16147493-AGAGAGAG-GGAGGGAGGGAP8_Dst***
20252796-C-CAAAAAAAAP5_Dst24×A***
16292546-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A48×T***
16301002-G-GAAAAAAA18×A***
17006505-C-CT13×T***
17030992-CAAAAA-C19×A***
17474936-TTTTTTTTTCTT-CTTTCTTTCCTTC***
19777758-TGT-AGAP5_Prx***
20226089-AAT-TGTTCP5_Dst***
58859261-T-C***
58847960-T-C***
27752131-CTCTG-TTCCAP1_Y2***
25590618-T-CP1_gr1***
22364698-A-CDYZ19***
22364710-C-GDYZ19***
22366818-C-TDYZ19***
22498507-T-ADYZ19***
23838845-G-T***
24047841-A-C***
25588251-C-TP1_gr1***
25819593-T-GP1_b3***
22354854-T-GDYZ19***
26208101-A-TP1_Y1***
26208103-A-TP1_Y1***
26214887-G-AP1_Y1***
26362237-G-AP1_Y1***
26362246-C-TP1_Y1***
26374299-G-AP1_Y1***
26374302-G-AP1_Y1***
22359469-G-TDYZ19***
22354838-G-TDYZ19***
26427500-C-TP1_Y1***
21013243-C-TP4_Dst***
20950309-C-TP4_Dst***
20956073-G-AP4_Dst***
20956082-T-CP4_Dst***
20956086-G-TP4_Dst***
20956088-A-TP4_Dst***
20958441-T-GP4_Dst***
21013240-T-CP4_Dst***
21028666-A-GP4_Dst***
22354830-T-GDYZ19***
21477779-A-G***
22226576-A-CDYZ19***
22248600-T-CDYZ19***
22263783-T-CDYZ19***
22336093-C-ADYZ19***
22336099-T-ADYZ19***
22343307-A-TDYZ19***
26374306-T-GP1_Y1***
26637224-G-AP1_g2***
58842256-G-T***
28491189-C-T***
27866313-A-GP1_Y2***
27866323-A-TP1_Y2***
27971753-A-CP1_Y2***
28013865-T-CP1_Y2***
28162257-A-GP1_b4***
28162263-T-CP1_b4***
28395793-G-AP1_gr2***
58827249-A-T***
27752295-G-AP1_Y2***
58828009-A-T***
58830797-G-A***
58832643-C-T***
58832653-G-C***
58842234-T-C***
58842238-G-C***
58842241-G-T***
27752347-A-GP1_Y2***
27752272-G-TP1_Y2***
27406364-C-TP1_g3***
27751254-G-CP1_Y2***
27419693-T-AP1_g3***
27422259-C-TP1_g3***
27422275-A-GP1_g3***
27484022-G-TP1_Y2***
27508725-G-AP1_Y2***
27581652-T-GP1_Y2***
27751230-T-CP1_Y2***
27751277-T-AP1_Y2***
27752176-G-TP1_Y2***
27752143-C-TP1_Y2***
27752157-G-AP1_Y2***
27752162-G-AP1_Y2***
27752165-C-TP1_Y2***
27752168-T-CP1_Y2***
27752169-T-AP1_Y2***
27752172-T-GP1_Y2***
27751290-AG-CAP1_Y2***
27752148-ATCCC-TTCCTP1_Y2***
20464352-A-GP5_Dst***
6145072-T-CIR3_Dst***
6145062-A-TIR3_Dst***
6145063-T-CIR3_Dst***
6145064-G-AIR3_Dst***
6145066-G-CIR3_Dst***
6145069-A-CIR3_Dst***
6145070-G-AIR3_Dst***
6145071-G-AIR3_Dst***
6145073-G-AIR3_Dst***
6145059-C-AIR3_Dst***
6145075-A-CIR3_Dst***
6145076-T-AIR3_Dst***
6145078-G-CIR3_Dst***
6145084-A-CIR3_Dst***
6145087-A-CIR3_Dst***
6145088-C-AIR3_Dst***
6145090-A-CIR3_Dst***
6145060-C-TIR3_Dst***
6145057-A-CIR3_Dst***
6145092-T-AIR3_Dst***
6135375-C-G***
6134451-A-G***
6135363-G-A***
6135366-T-C***
6135367-A-G***
6135368-C-T***
6135369-G-A***
6135373-T-C***
6135376-T-G***
6145055-G-CIR3_Dst***
6145041-G-CIR3_Dst***
6145042-C-GIR3_Dst***
6145043-T-GIR3_Dst***
6145045-C-GIR3_Dst***
6145046-A-GIR3_Dst***
6145053-G-TIR3_Dst***
6145054-A-GIR3_Dst***
6145091-T-AIR3_Dst***
6145093-A-CIR3_Dst***
5785845-T-A***
6948125-G-T***
6305880-C-TIR3_Dst***
6830606-T-C***
6833330-C-T***
6911388-C-A***
6918506-G-C***
6918513-C-A***
6918535-C-A31×A***
6948541-A-G***
6250586-T-CIR3_Dst***
7043561-G-T***
7047991-A-C***
7048014-A-C***
7048030-A-C***
7086640-C-A***
7086829-T-C***
7139141-T-A***
6285676-C-AIR3_Dst***
6179592-A-TIR3_Dst22×T***
6145094-G-AIR3_Dst***
6149996-T-CIR3_Dst***
6145096-A-CIR3_Dst***
6145099-A-CIR3_Dst***
6145100-T-AIR3_Dst***
6145103-T-GIR3_Dst***
6145105-C-GIR3_Dst***
6145106-C-AIR3_Dst***
6149994-T-CIR3_Dst***
6149997-G-AIR3_Dst***
6150008-T-CIR3_Dst***
6149998-T-CIR3_Dst***
6149999-G-AIR3_Dst***
6150000-G-CIR3_Dst***
6150001-G-AIR3_Dst***
6150003-G-AIR3_Dst***
6150005-G-AIR3_Dst***
6150007-G-AIR3_Dst***
5904609-A-T***
5669623-C-A***
27752314-TG-CAP1_Y2***
58980531-A-T***
13857929-T-C***
13857956-G-A***
13861574-G-A***
13866892-A-G***
13868849-T-A***
22275665-C-ADYZ19***
58978014-CCTTTCCATTG-C***
10032441-A-G***
13194849-C-G***
10023478-C-T***
28802553-T-G***
7164509-T-G***
7201552-T-C***
28802556-A-G***
59031721-A-G***
58997004-A-T***
13745573-T-A***
13138577-T-C***
13691816-C-G***
58831380-AT-CC***
27752331-ATTG-TTCAP1_Y2***
28030783-CCTTC-TCTTTP1_Y2***
28253524-C-CAAAAAP1_b4***
28491336-A-AAAACCCCCC***
28491337-A-AAAAAACACCCCC***
28500822-TTTG-GGAC***
58819347-N-NC***
58832622-GCAGTCTT-CCATTCAA***
13138574-C-T***
58842266-ATCCC-TTCCT***
58847167-GTCTCTT-TTC***
58848549-TGATGT-CCATTC***
58911349-GAC-CAT***
7461754-G-GTTIR1_L23×T***
13138484-G-T***
13138571-A-C***
58974236-C-T***
13691814-G-A***
5572448-A-T***
4951415-G-T***
3622308-C-A***
3632858-C-A***
3965171-C-A***
3994857-T-A***
4138851-G-T***
4144009-C-A***
4179086-T-A***
5065980-C-A***
3092956-C-A***
5117700-A-G***
5204381-G-A***
5261746-A-C***
5261749-C-A***
5261761-A-G***
5261767-C-G***
5393343-C-A***
3286442-C-A***
2980680-C-A***
13472071-A-T***
9925222-T-A***
13866912-G-A***
58987895-T-C***
59031761-T-C***
59031714-G-T***
22352474-G-ADYZ19***
28808718-C-G***
13691815-G-T***
58996150-A-T***
2649798-G-C***
14550735-G-AZS814***
58996149-T-C***
13833409-T-A***
13691820-A-T***
13472096-G-T***
13833434-A-T***
58987981-C-G***
2649782-G-A***
20746996-T-CP4_Prx***
20462541-G-TP5_Dst***
7197367-C-A***
13203959-A-G***
13472104-A-G******
7483663-T-GIR1_L***
9215993-A-G***
9304875-A-G***
9325208-C-G***
13140109-C-T***
13203958-C-T***
13203960-T-A***
13203974-C-G***
13203963-T-A***
13275918-C-T***
16148183-C-TP8_Dst27×T***
20230681-A-GP5_Dst***
20886818-T-AP4_Dst***
25312613-T-AP2_r1***
26902340-G-AP1_r3***
13445937-C-T***
13203973-C-T***
27971785-G-AP1_Y2***
13801118-G-A***
58820540-T-C***
25657077-A-ATP1_b312×T***
13866925-A-G***
24060374-GT-GP3_b1***
13748541-A-T***
18443454-G-GAP6_Dst11×A***
25458706-G-GAP2_r29×A***
25207887-G-AP2_r1***
13203975-C-A***
22232192-G-TDYZ19***
22232196-T-ADYZ19***
22265856-G-TDYZ19***
58914180-T-G***
22232055-ACAC-GCATDYZ19***
58971887-CATATATATAT-C12×AT***
13203979-C-T***
27971780-G-AP1_Y2***
28253570-T-AP1_b4***
13868431-G-A***
22358173-TTTCG-GTTCADYZ19***
20230740-AAT-GACP5_Dst***
20255094-TA-TP5_Dst20×A***
20347544-ATTAT-AP5_Dst5×TTAT***
20432863-TAC-TP5_Dst13×AC***
20478953-C-CAP5_Dst15×A***
20993598-CA-CP4_Dst17×A***
22256872-ATGAAGC-TGTTATGDYZ19***
24035198-T-TA14×A***
20230667-TTT-CTGP5_Dst***
24096349-CA-CP3_b116×A***
24295863-CT-CP3_t117×T***
24336793-C-TTP3_t120×T***
24739651-CT-CP3_b213×T***
24771003-CT-CP3_b217×T***
24796652-GT-GP3_b28×T***
24826348-CT-CP3_b214×T***
20230695-GTATG-CTATAP5_Dst***
20213749-ATT-AP5_Dst14×T***
28253572-G-AP1_b4***
6308050-GCACA-GIR3_Dst9×CA***
28253574-G-AP1_b4***
21021632-CT-CP4_Dst17×T***
27861040-GT-GP1_Y217×T***
15132065-AT-A14×T***
27644230-C-CAP1_Y212×A***
20078758-C-CAP5_Dst16×A***
25273788-AT-AP2_r121×T***
25662111-TA-TP1_b314×A***
20197205-G-GAP5_Dst14×A***
9529142-CT-CIR3_Prx15×T***
13801031-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA***
13801053-TGGATAGAACGG-GGAATGGAGATT***
16040802-CTTTTT-C16×T***
16146467-T-TAP8_Dst10×A***
18984946-CTTTC-TTTTT***
20129006-CA-CP5_Dst11×A***
13868435-G-A***
13868428-A-C***
25288412-T-TAP2_r117×A***
13447668-G-GCATTCCATTC4×CATTC***
13735162-A-G4×AATGG***
13140580-C-T***
13803178-G-A***
13817643-A-C***
20196323-C-CAP5_Dst10×A***
7269610-CTT-C22×T***
6948124-G-T***
13447687-T-A***
13847069-T-G***
13804706-T-G***
16108594-T-CP8_Prx***
24033715-GTTTA-G4×TTTA***
20230710-T-GP5_Dst***
13723348-T-A***
13723350-A-T***
13469059-G-T***
13850311-G-A***
58858969-G-C***
27815070-CT-CP1_Y210×T***
13465331-A-G***
13833416-C-G***
22256898-T-GDYZ19***
20045274-AAAAG-AP5_Prx14×AAAG***
28132475-C-CTP1_b415×T***
13866859-C-G,T***
13869985-A-G***
13870003-C-A***
58819393-C-T***
28142885-A-ATP1_b411×T***
58985570-A-G***
22498241-A-TDYZ19***
58912924-G-A***
28253529-G-AP1_b4***
13839918-A-G***
20214463-C-CAP5_Dst10×A***
24669478-CT-CP3_b210×T***
13139533-T-C***
26953179-G-AP1_r3***
22293405-T-CDYZ19***
58819717-A-C4×CATTC***
58983162-C-A***
16108635-A-CP8_Prx***
20902303-GA-GP4_Dst14×A***
28802531-G-A***
20995546-TCTTTC-TP4_Dst11×CTTTC***
27808453-C-CTP1_Y215×T***
28027982-A-ATP1_Y217×T***
22802904-G-T***
20416397-AT-AP5_Dst15×T***
22802929-G-T***
20872237-A-ATP4_Dst11×T***
27792527-AT-AP1_Y210×T***
13140106-T-C***
19686221-C-CTP5_Prx16×T***
22250200-A-TDYZ19***
22490753-G-TDYZ19******
24629530-C-CTP3_t211×T***
27778164-C-CTP1_Y212×T***
13479211-G-C***
28214049-C-CTP1_b414×T***
24038488-T-TAC24×AC***
26098023-AG-AP1_Y1***
25207883-G-AP2_r1***
27936764-CA-CP1_Y215×A***
13203980-T-A***
20442453-G-GAP5_Dst11×A***
25356955-TA-TP2_r210×A***
25207886-T-AP2_r1***
13804711-A-C***
25364735-A-ATP2_r29×T***
27967336-G-AP1_Y210×TA***
9745927-A-C***
9745928-G-C***
9745931-T-C***
13812792-A-G***
13866923-A-T***
22498176-G-TDYZ19***
24830466-CAACAAC-AAAAAAAP3_b2***
25289249-GA-GP2_r1***
20248998-T-GP5_Dst***
3321010-A-G***
13431018-A-G***
13431028-A-T***
13556416-C-A***
58982371-G-T***
13110053-A-G***
13416424-G-C***
24023731-A-G***
27752341-T-CP1_Y2***
13241659-T-C***
22354781-G-TDYZ19***
3312978-T-G***
4118471-G-A***
4976819-G-A***
5275891-C-A***
5477704-G-C***
6247429-C-AIR3_Dst***
13399807-G-A***
13740650-CTGG-ATGA***
7122596-G-A***
58851821-C-T***
22421427-G-CDYZ19***
22802905-G-T***
58889841-T-C***
13485341-ACAAG-TCAATC***
13488192-A-G***
13398262-G-T***
13398283-C-A***
58863586-T-C***
58983541-C-A***
13437785-A-T***
13856470-C-A***
58866931-T-A***
58866939-C-T***
58907234-A-C***
6247511-A-GIR3_Dst***
22354749-G-TDYZ19***
7026510-G-C***
9571096-C-AIR3_Prx***
9936852-A-C***
19777746-T-CP5_Prx***
18331568-C-TP6_Prx***
18331581-C-TP6_Prx***
18459161-G-AP6_Dst***
18459166-T-CP6_Dst***
19746899-G-AP5_Prx***
19754989-A-CP5_Prx***
19759589-T-CP5_Prx***
19777749-T-CP5_Prx***
17543794-T-A***
19777758-T-AP5_Prx***
19777760-T-AP5_Prx***
19810012-T-AP5_Prx***
20226094-G-CP5_Dst***
20228022-C-AP5_Dst***
20248995-C-TP5_Dst***
20248997-A-GP5_Dst***
17633682-C-A***
17474961-G-A***
9983966-G-A***
13487475-G-T***
13109790-G-A***
13109962-A-T***
13110043-G-T***
13115391-G-C***
13115403-A-T***
13115446-G-C***
13122125-A-G***
13487858-T-A***
16351738-G-A***
13530684-A-T***
13636066-T-C***
13697677-G-C***
13697692-C-G***
13748472-G-C***
13923545-A-C***
16129437-T-CP8_Prx***
22367180-A-TDYZ19***
58859215-AG-TC***
25289839-G-GTP2_r18×T***
22481786-A-TDYZ19***
58983182-CTAC-GCAT***
58985514-GATCACC-TATCTCG***
22309415-A-CDYZ19***
19646223-ACTATG-TCCATCP5_Prx***
22367219-C-GDYZ19***
22127975-C-CTTTTTT20×T***
13122138-C-G***
24314070-G-AP3_t1***
28008591-C-CAP1_Y211×A***
58820437-A-C***
18447621-G-GTTTTTTTTTTTTP6_Dst18×T***
22355082-G-CDYZ19***
22355122-T-GDYZ19***
58848420-A-C***
22337817-AG-GTDYZ19***
18378958-AC-AP6_Prx***
28802831-ATTGAG-GTGGAC***
27889296-AAT-AP1_Y2***
22498283-C-GDYZ19***
25689959-T-TAP1_b313×A***
25301411-GA-GP2_r1***
25412653-CT-CP2_r216×T***
25415037-C-CTP2_r217×T***
25417422-CT-CP2_r216×T***
25422190-CT-CP2_r216×T***
25429198-CT-CP2_r213×T***
25662890-CA-CP1_b315×A***
25717471-CA-CP1_b317×A***
27780449-C-CAP1_Y218×A***
25766541-C-CAP1_b316×A***
26117889-TAAC-AAAAP1_Y1***
26990934-CT-CP1_r417×T***
27033095-C-CTP1_r417×T***
27035480-CT-CP1_r416×T***
27149714-TA-TP1_g316×A***
27427815-GA-GP1_g314×A***
20645841-TTC-TP4_Prx***
58980802-T-C***
58842299-CAATAG-C***
13556376-G-C***
27751301-C-GP1_Y2***
22223298-CTTC-ATTTDYZ19***
9700780-C-CAIR3_Prx23×A***
13838038-C-A***
58867486-TATTTTATTCCATGCC-T***
13876403-T-C***
58894609-C-G***
22355162-T-GDYZ19***
15179010-C-CA25×A***
13725096-GT-TA***
22342821-TT-GGDYZ19***
16108634-A-TP8_Prx***
13734088-C-A***
58909939-G-A***
58819351-N-NTT***
58842288-ACAG-CCAT***
28808738-G-A***
22260679-G-CDYZ19***
2795555-ATTTG-TTTT***
58908515-A-C***
25207874-G-AAAP2_r1***
13485114-T-G***
13474808-T-A***
13474811-A-T***
27585912-G-TP1_Y2***
22422828-TT-CADYZ19***
13140069-CACTCGAGTGCGTGTG-C***
58913090-T-G***
15912055-C-TM1201421×T***
22248578-CT-CDYZ19***
13876452-G-A***
17569252-C-A***
20501022-T-GP5_Dst***
22232063-AAGTGCTGT-CATTTCTGADYZ19***
13488819-C-A***
3205858-C-CAAAAAAA15×A***
9962207-A-T***
7197239-C-A***
7201542-T-C***
20025443-C-TP5_Prx***
15495274-G-A***
14992432-C-A***
15115692-A-G***
15168367-A-T***
15221262-T-A***
15299563-C-T***
15336018-T-A***
15365057-A-G***
15497952-A-T***
14700988-T-G***
15497953-A-T***
15497954-T-A***
15566817-G-A22×A***
15570172-C-A***
15763723-G-T***
15775986-G-T***
15803582-C-A***
14990146-T-C***
14632952-G-T***
15871635-C-A***
14212559-T-A***
14184518-T-G***
14184519-G-A***
14184520-G-T***
14184523-A-T***
14184525-A-G***
14184526-G-T***
14191814-C-T***
14224207-C-A***
14606454-C-A***
14227622-C-A***
14258539-C-T***
14390751-A-G***
14422643-C-A***
14445631-C-A***
14518401-C-A***
14550636-C-T***
15815250-T-A***
15881981-T-A***
14184516-T-G***
16108625-A-CP8_Prx***
16108609-A-TP8_Prx***
16108610-A-GP8_Prx***
16108612-A-CP8_Prx***
16108614-A-CP8_Prx***
16108616-A-CP8_Prx***
16108617-T-AP8_Prx***
16108624-G-TP8_Prx***
16108627-C-GP8_Prx***
16108607-A-TP8_Prx***
16108628-T-CP8_Prx***
16108629-T-AP8_Prx***
16108630-G-CP8_Prx***
16108631-G-AP8_Prx***
16108632-A-GP8_Prx***
16108636-A-TP8_Prx***
16108637-A-TP8_Prx***
16108608-C-TP8_Prx***
16108606-T-AP8_Prx***
15881984-C-G***
16108590-A-GP8_Prx***
15881999-C-G***
16033631-T-C***
16090297-C-A***
16090323-C-A***
16096684-G-T***
16108587-A-GP8_Prx***
16108588-A-GP8_Prx***
16108591-C-TP8_Prx***
16108605-C-GP8_Prx***
16108595-T-GP8_Prx***
16108596-G-AP8_Prx***
16108597-T-GP8_Prx***
16108598-G-TP8_Prx***
16108599-C-AP8_Prx***
16108602-G-CP8_Prx***
16108604-T-AP8_Prx***
14184517-C-T***
14184515-G-T***
16108641-C-AP8_Prx***
13748558-T-G***
13734824-A-T***
13734986-C-G***
13740309-T-G***
13740633-A-G***
13740636-T-C***
13748510-A-C***
13748524-T-A***
13748577-T-G***
13734814-T-C***
13748578-C-G***
13801373-A-G***
13801378-A-C***
13809588-G-A***
13833408-A-T***
13833410-T-G***
13833412-G-A***
13734815-G-T***
13734813-A-C***
13833415-T-C***
13718537-A-T***
13718520-G-T***
13718524-C-T***
13718528-A-C***
13718530-G-C***
13718531-G-A***
13718534-C-T***
13718536-G-T***
13718540-C-G***
13734796-G-T***
13721746-A-G***
13721861-A-T***
13723345-T-G***
13723346-G-A***
13723347-T-C***
13731459-T-A***
13731470-C-T***
13833414-A-T***
13833417-G-T***
14184514-G-T***
14183418-A-G***
13858402-T-A***
13860545-C-G***
13860620-G-C***
14051714-C-A***
14051930-C-A***
14065611-A-G***
14175056-A-T***
14184505-G-T***
13856662-G-T***
14184506-G-C***
14184507-C-T***
14184508-T-C***
14184509-C-A***
14184510-A-G***
14184511-C-T***
14184513-A-T***
13858351-G-A***
13856579-T-A***
13833419-A-C***
13856462-G-C***
13833427-G-A***
13833431-G-A***
13833435-T-G***
13833437-G-A***
13833449-C-T***
13833457-C-A***
13833459-G-T***
13856468-G-A***
13856577-A-G***
13856471-C-T***
13856472-C-G***
13856474-A-C***
13856478-T-G***
13856495-G-T***
13856569-A-T***
13856573-C-G***
16108640-C-AP8_Prx***
16108645-G-TP8_Prx***
13718509-T-A***
18520375-G-TP6_Dst***
18369668-T-GP6_Prx***
18369716-T-AP6_Prx***
18369734-C-GP6_Prx***
18430054-T-AP6_Dst***
18443528-C-TP6_Dst***
18466985-C-AP6_Dst***
18492523-C-TP6_Dst***
18527814-G-TP6_Dst***
18316557-G-AP6_Prx***
18533120-C-AP6_Dst***
18533123-A-TP6_Dst***
18630750-C-A***
18688528-C-T***
18789597-G-A***
18789820-C-A***
18879921-G-A***
18369620-G-AP6_Prx***
18186264-C-G***
10023676-C-T***
18008789-C-TP7_Dst***
18008777-C-TP7_Dst***
18008780-G-TP7_Dst***
18008781-G-TP7_Dst***
18008782-G-TP7_Dst***
18008786-A-TP7_Dst***
18008787-C-TP7_Dst***
18008788-G-TP7_Dst***
18008791-A-TP7_Dst***
18156336-C-A***
18008794-C-TP7_Dst***
18008796-C-TP7_Dst***
18008797-C-TP7_Dst***
18008799-G-TP7_Dst***
18008803-C-TP7_Dst***
18008809-C-TP7_Dst***
18015934-A-TP7_Dst***
18901174-T-A***
18937531-T-G***
18008773-C-TP7_Dst***
19731007-A-CP5_Prx***
19682090-T-AP5_Prx***
19693569-C-AP5_Prx***
19709815-G-TP5_Prx***
19727375-T-CP5_Prx***
19727376-A-CP5_Prx***
19727382-A-CP5_Prx***
19730970-T-CP5_Prx***
19758694-C-AP5_Prx***
19423682-A-C***
19930451-G-TP5_Prx***
19930452-C-TP5_Prx***
19930462-C-TP5_Prx***
19930466-C-TP5_Prx***
19938933-G-AP5_Prx***
19943085-T-GP5_Prx***
20025441-C-TP5_Prx***
19547641-C-A***
19325311-T-C***
18937547-T-C***
19071345-C-G***
18937548-G-A***
18937557-T-C***
18937558-G-A***
18937570-G-T***
18951540-C-A***
18959213-T-C***
18987248-C-A***
19100499-T-C***
19244754-T-C***
19187525-C-T***
19187534-C-T***
19187577-C-T***
19187583-C-T***
19189484-G-T***
19189522-A-C***
19189524-T-C***
18008774-C-TP7_Dst***
18008767-G-TP7_Dst***
16108651-A-TP8_Prx***
16583335-A-T***
16113327-A-TP8_Prx***
16148097-C-AP8_Dst***
16165106-G-AP8_Dst***
16277843-C-A***
16305850-G-A***
16336864-T-C***
16522342-G-C***
16583339-C-T***
16113321-A-CP8_Prx***
16583342-G-A***
16583344-C-G***
16599010-G-A***
16621789-G-A***
16689902-C-A***
16719851-A-G***
16720752-T-C***
16113324-C-AP8_Prx***
16113320-C-GP8_Prx***
16843068-C-A***
16108670-A-CP8_Prx***
16108654-A-TP8_Prx***
16108655-T-CP8_Prx***
16108656-G-CP8_Prx***
16108657-A-CP8_Prx***
16108658-G-AP8_Prx***
16108660-A-GP8_Prx***
16108661-G-AP8_Prx***
16108671-G-AP8_Prx***
16113318-T-CP8_Prx***
16108672-T-AP8_Prx***
16108673-T-CP8_Prx***
16108674-G-AP8_Prx***
16108797-A-TP8_Prx***
16108798-G-CP8_Prx***
16113310-C-GP8_Prx***
16113312-C-GP8_Prx***
16834746-C-A45×A***
16988848-C-A***
18008766-G-TP7_Dst***
18008748-C-TP7_Dst***
17994919-G-AP7_Prx***
18008632-C-TP7_Dst***
18008739-G-TP7_Dst***
18008740-C-TP7_Dst***
18008744-G-TP7_Dst***
18008745-G-TP7_Dst***
18008746-C-TP7_Dst***
18008752-C-TP7_Dst***
17994793-G-AP7_Prx***
18008754-C-TP7_Dst***
18008755-G-TP7_Dst***
18008756-G-TP7_Dst***
18008757-C-TP7_Dst***
18008759-C-TP7_Dst***
18008764-C-TP7_Dst***
18008765-A-TP7_Dst***
17994794-C-AP7_Prx***
17994753-T-AP7_Prx***
17042813-C-A***
17374709-C-A***
17084013-A-G***
17090871-T-G***
17098777-C-A***
17127350-C-A***
17227855-C-A***
17246596-A-T***
17370909-C-A***
17548554-C-A***
17994752-C-AP7_Prx***
17580090-C-A***
17622770-C-A***
17716915-C-A***
17770268-C-T***
17994731-T-AP7_Prx***
17994744-T-AP7_Prx***
17994748-G-AP7_Prx***
17994750-G-AP7_Prx***
13718511-A-G***
13718504-T-A***
7201547-T-C***
9539473-G-TIR3_Prx***
9325211-A-C***
9343762-G-T***
9344040-T-C***
9354929-G-A***
9365385-C-G***
9372450-T-G***
9533756-G-TIR3_Prx***
9540304-G-TIR3_Prx***
9311531-T-G***
9540305-C-TIR3_Prx***
9589884-G-TIR3_Prx***
9605852-G-TIR3_Prx***
9622530-T-CIR3_Prx***
9622549-T-GIR3_Prx***
9626093-A-CIR3_Prx***
9634139-T-CIR3_Prx***
9325205-A-G***
9311515-A-G***
9666931-G-TIR3_Prx***
9234288-T-G***
9234278-C-G***
9234280-C-A***
9234281-C-G***
9234283-T-C***
9234284-C-T***
9234285-A-C***
9234286-G-T***
9234291-T-G***
9304878-C-G***
9234293-G-C***
9234294-G-C***
9234295-C-G***
9234296-A-C***
9238563-T-G***
9304113-A-C***
9304678-T-G***
9637383-G-TIR3_Prx***
9740070-G-TIR3_Prx***
9234274-T-A***
9951835-C-A***
9940741-G-A***
9940753-T-C***
9940799-C-G***
9940850-A-G***
9941270-T-C***
9941271-G-A***
9941272-T-G***
9952089-A-G***
9934778-A-G***
9952621-T-A***
9952636-G-A***
9952652-T-C***
9983343-C-A***
10023484-C-T***
10032496-C-G***
10032547-C-T***
9937535-A-G***
9930211-C-G***
9745934-T-C***
9826113-A-G***
9745937-G-C***
9745938-A-C***
9745939-G-C***
9745942-G-C***
9745946-T-C***
9745947-T-C***
9756772-G-T***
9832407-G-T***
9930207-A-G***
9900236-A-G***
9929952-G-A***
9929958-G-A***
9929998-G-T***
9930013-C-G***
9930200-G-A***
9930204-A-G***
9234275-G-C***
9234273-G-C***
10041614-G-T***
7535885-T-A***
7242041-C-T***
7242056-C-G***
7242061-T-A***
7320490-C-T***
7424424-C-A***
7489285-G-TIR1_L***
7501232-T-GIR1_L***
7535894-T-A***
7217342-T-C***
7939380-G-A***
8076172-T-C***
8159012-C-A***
8172711-A-T***
8181341-A-T***
8214942-C-A***
8276323-C-A***
7217343-A-C***
7217341-G-T***
8291034-C-A***
7217329-A-G***
7217316-T-C***
7217318-A-G***
7217322-A-T***
7217323-T-G***
7217324-T-G***
7217326-T-G***
7217327-T-G***
7217330-A-T***
7217340-T-A***
7217331-A-G***
7217332-A-T***
7217333-A-G***
7217334-T-C***
7217335-T-C***
7217337-T-G***
7217339-T-C***
8288839-G-A***
8786833-C-G***
9234271-T-C***
9234258-G-C***
9234249-G-A***
9234250-A-G***
9234251-T-A***
9234252-G-C***
9234253-A-C***
9234255-T-G***
9234256-G-C***
9234259-C-A***
9234247-T-C***
9234260-A-G***
9234261-T-C***
9234263-T-C***
9234264-G-A***
9234266-G-T***
9234268-A-C***
9234269-G-C***
9234248-G-C***
9234246-T-C***
9127449-G-T***
9223864-G-C***
9156688-T-C***
9215996-A-G***
9215999-C-G***
9216002-A-C***
9216008-C-G***
9216009-A-C***
9216018-T-G***
9234230-A-C***
9234241-T-C***
9234231-G-C***
9234232-T-C***
9234233-G-T***
9234234-C-G***
9234235-A-G***
9234238-G-C***
9234239-C-T***
9234240-C-G***
10040743-A-C***
10041627-A-G***
13718502-C-A***
13488733-G-T***
13480568-C-T***
13480675-T-A***
13482066-A-G***
13482080-C-T***
13482122-G-C***
13484436-T-G***
13486740-C-T***
13488886-C-G***
13472196-G-T***
13488995-C-A***
13489003-C-T***
13501902-C-A***
13504880-A-G***
13505435-C-T***
13554245-C-A***
13558171-G-C***
13474810-G-T***
13472187-C-G***
13610952-C-A***
13465350-T-C***
13433172-T-C***
13433173-A-C***
13433174-T-A***
13433175-G-A***
13437877-T-G***
13447255-T-C***
13460967-G-A***
13467914-A-T***
13472121-A-C***
13468133-T-C***
13472038-G-T***
13472055-T-C***
13472081-G-C***
13472103-C-T***
13472113-G-A***
13472117-G-C***
13596552-C-A***
13628693-C-A***
13433170-C-T***
13705631-G-C***
13703400-G-C***
13703405-C-G***
13703407-A-C***
13703410-G-C***
13705626-T-G***
13705629-G-T***
13705630-C-G***
13705635-G-A***
13703393-G-T***
13705639-T-A***
13705643-C-T***
13705645-G-C***
13705656-G-A***
13705659-T-A***
13705660-G-A***
13705661-A-G***
13703396-T-G***
13703391-G-T***
13691825-A-T***
13697979-A-G***
13691826-A-G***
13691834-T-A***
13692799-G-T***
13697975-A-G***
13697976-T-A***
13697977-G-T***
13697978-A-C***
13697980-C-A***
13698012-C-T***
13697981-T-G***
13697982-C-T***
13697983-G-C***
13697984-A-C***
13697987-G-T***
13697988-G-C***
13697989-A-C***
13433171-T-G***
13421415-T-C***
10041636-G-A***
13203914-G-T***
13140623-C-A***
13143050-A-T***
13143055-A-C***
13143060-A-T***
13143610-T-C***
13193972-C-A***
13203913-C-G***
13203915-A-G***
13140618-C-A***
13203916-T-A***
13203917-G-T***
13203919-T-A***
13203920-G-T***
13203921-A-G***
13203922-C-A***
13203923-G-T***
13140619-A-T***
13140617-C-T***
13203926-A-T***
13140104-C-T***
10041649-A-C***
10041691-T-G***
10041698-T-A***
10041741-G-T***
13140101-A-C***
13140102-T-A***
13140103-T-C***
13140107-T-A***
13140615-C-A***
13140600-C-T***
13140601-A-T***
13140604-A-T***
13140605-C-T***
13140608-C-T***
13140612-T-G***
13140613-C-A***
13203925-C-G***
13203927-T-A***
13417505-A-T***
13239439-C-T***
13203955-C-T***
13203956-A-G***
13203957-T-A***
13214106-G-A***
13218953-C-A***
13218966-C-A21×A***
13223746-G-A***
13239448-C-T***
13203952-G-T***
13253224-T-C***
13275934-A-G***
13304213-A-G***
13325983-A-T***
13365794-G-T***
13372168-A-G***
13393360-T-A***
13203954-T-G***
13203951-T-A***
13203929-G-T***
13203937-G-T***
13203930-T-A***
13203931-G-T***
13203932-A-G***
13203933-T-A***
13203934-A-T***
13203935-G-A***
13203936-A-G***
13203938-A-G***
13203950-A-G***
13203939-T-A***
13203940-G-T***
13203941-A-G***
13203942-T-A***
13203945-A-G***
13203946-G-T***
13203948-T-G***
13203949-G-T***
13861586-G-A,C***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
Soucek1324151111-14121211131329189-1011112415173215-15-17-18101119-231515201836-39121211915-1781010810101223-23161012121481222201312111311111212341591611262619111113121091213101111311213241381022151913241712152412241810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1953641076241265948127880331
Used in age calculations1076241265948127880331
Counts of SNPs87



Big Tree Main Page