Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z41150 > Z49 > A21822 > S8183 > Y4356 > Y4354 > Y4355 > FGC20800 > FGC20775

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
195364
FGC-BigY
H3G7C
BigY2
195364
FGC
KK2P9
22275665-C-A 20113779-C-A DYZ19 ***A*
28793478-A-G 26647331-A-G A*
56837428-A-G **
21409017-C-A 19247131-C-A *****
20084538-A-T 17972658-A-T P5_Dst *****
9340793-G-A 9503184-G-A **
7139159-C-T 7271118-C-T Z22015 ****
20206590-C-A 18044704-C-A FGC14744 P5_Dst **
28253491-C-CAAAAAAAAAAAAA 26107344-C-CAAAAAAAAAAAAA P1_b4 32×A**
20248110-C-A 18086224-C-A P5_Dst **
58893615-G-A 56697256-C-T **
19006136-C-CAAAAAAA 16894256-C-CAAAAAAA 21×A**
18365541-ATGTGTG-A 16253661-ATGTGTG-A P6_Prx 20×TG****
21200202-G-T 19038316-G-T *****
21347339-G-T 19185453-G-T *****
5147441-C-CAAAAA 5279400-C-CAAAAA 30×A**
2745740-T-A 2877699-T-A ****
21554276-C-A 19392390-C-A *****
21583823-C-A 19421937-C-A *****
21584348-C-A 19422462-C-A *****
21584491-C-A 19422605-C-A *****
21694858-C-G 19532972-C-G ****
21709078-A-T 19547192-A-T *****
21709115-T-G 19547229-T-G *****
21821577-C-A 19659691-C-A ****
21852594-C-A 19690708-C-A *****
22146391-G-A 19984505-G-A *****
22520555-A-G 20358669-A-G *****
22520557-G-C 20358671-G-C *****
28602309-C-A 26456162-C-A ****
3092956-C-A 3224915-C-A *****
22520564-A-G 20358678-A-G *****
19071345-C-G 16959465-C-G *****
18901126-C-G 16789246-C-G ****
18901174-T-A 16789294-T-A *****
18902863-C-A 16790983-C-A *****
18930549-C-A 16818669-C-A ****
18937547-T-C 16825667-T-C *****
18937548-G-A 16825668-G-A *****
18937557-T-C 16825677-T-C *****
18937558-G-A 16825678-G-A *****
18937570-G-T 16825690-G-T *****
18951540-C-A 16839660-C-A *****
18987248-C-A 16875368-C-A *****
19055513-C-T 16943633-C-T ****
19244754-T-C 17132874-T-C *****
3158906-C-A 3290865-C-A ****
24760000-TTATA-T 22613853-TTATA-T P3_b2 11×TA**
19325311-T-C 17213431-T-C *****
19423682-A-C 17311802-A-C *****
19547641-C-A 17435761-C-A *****
5904609-A-T 6036568-A-T *****
5626057-C-A 5758016-C-A ****
5572448-A-T 5704407-A-T *****
5393343-C-A 5525302-C-A *****
5117700-A-G 5249659-A-G *****
5065980-C-A 5197939-C-A *****
3965171-C-A 4097130-C-A *****
3632858-C-A 3764817-C-A *****
3286442-C-A 3418401-C-A *****
22520558-G-A 20358672-G-A *****
22602423-A-G 20440537-A-G *****
18789838-C-A 16677958-C-A ****
3633116-C-A 3765075-C-A **
22079408-C-A 19917522-C-A **
22079435-C-A 19917549-C-A **
2788439-T-C 2920398-T-C **
2981637-G-T 3113596-G-T **
2992457-C-G 3124416-C-G **
3061153-C-A 3193112-C-A **
3218186-C-A 3350145-C-A **
3275439-G-T 3407398-G-T **
3285075-T-C 3417034-T-C **
3400566-G-GA 3532525-G-GA 10×A**
3531183-T-A 3663142-T-A **
3620709-C-A 3752668-C-A **
3704450-T-C 3836409-T-C **
17153489-G-A 15041609-G-A **
3834910-C-A 3966869-C-A **
3943648-G-T 4075607-G-T **
3994695-T-C 4126654-T-C **
4136634-A-C 4268593-A-C **
4180686-A-G 4312645-A-G **
4235657-T-A 4367616-T-A **
4256951-C-T 4388910-C-T **
4266982-T-C 4398941-T-C **
18615962-G-A 16504082-G-A **
4266986-T-C 4398945-T-C **
4267114-T-C 4399073-T-C **
4353998-C-A 4485957-C-A **
10819209-C-T **
27756417-A-AT 25610270-A-AT P1_Y2 9×T**
22739614-G-A 20577728-G-A *****
11647900-C-A **
14776953-T-G 12665022-T-G **
21362958-A-G 19201072-A-G FGC20775A9522 *******
13365795-ATT-A 11210119-ATT-A 16×T**
10815033-T-C **
10815043-T-C **
10672491-T-C **
14985049-A-G 12873117-A-G **
14224199-C-A 12103493-C-A **
16015163-C-A 13903283-C-A **
21239020-C-A 19077134-C-A **
14985040-G-C 12873108-G-C **
13926888-C-A 11806182-C-A **
11646145-C-A **
14187945-C-A 12067239-C-A **
7332734-C-A 7464693-C-A **
8661784-C-A 8793743-C-A **
10984586-T-A **
3545723-C-CA 3677682-C-CA 11×A**
23098815-TCAAA-T 20936929-TCAAA-T **
6787070-C-A 6919029-C-A **
14224265-C-CT 12103559-C-CT 10×T**
10815036-C-G **
17874236-C-A 15762356-C-A **
5533340-C-A 5665299-C-A **
3681469-G-T 3813428-G-T **
6474632-C-A 6606591-C-A **
5205502-C-A 5337461-C-A **
18879921-G-A 16768041-G-A *****
18789820-C-A 16677940-C-A *****
4468052-C-A 4600011-C-A **
15365057-A-G 13253177-A-G *****
14550636-C-T 12438837-C-T *****
14606454-C-A 12494656-C-A *****
14632952-G-T 12521021-G-T *****
14681563-A-T 12569629-A-T ****
14700988-T-G 12589054-T-G *****
14992432-C-A 12880517-C-A *****
15115692-A-G 13003779-A-G *****
10040743-A-C 10203134-A-C *****
15168367-A-T 13056453-A-T *****
15221262-T-A 13109348-T-A *****
15299563-C-T 13187662-C-T *****
9983343-C-A 10145734-C-A *****
28487325-G-T 26341178-G-T **
14390751-A-G 12270047-A-G *****
9952089-A-G 10114480-A-G *****
9951835-C-A 10114226-C-A *****
28481074-T-G 26334927-T-G *****
28481058-T-G 26334911-T-G *****
15637870-G-T 13525990-G-T **
15644626-G-A 13532746-G-A ****
15763723-G-T 13651843-G-T *****
15770505-G-T 13658625-G-T ****
15775986-G-T 13664106-G-T Y68870 *****
15797259-C-G 13685379-C-G ****
15803582-C-A 13691702-C-A *****
15871635-C-A 13759755-C-A *****
14445631-C-A 12324904-C-A *****
14380937-C-T 12260233-C-T ****
9930165-A-C 10092556-A-C **
13223746-G-A 11068070-G-A *****
13637312-C-A 11481636-C-A ****
13628693-C-A 11473017-C-A *****
13601177-C-A 11445501-C-A ****
13596552-C-A 11440876-C-A *****
13596381-G-A 11440705-G-A ****
13558171-G-C 11402495-G-C *****
59031759-T-A 56885612-T-A *****
13504880-A-G 11349204-A-G *****
13501902-C-A 11346226-C-A *****
13421415-T-C 11265739-T-C *****
13365794-G-T 11210118-G-T *****
13291276-C-A 11135600-C-A ****
13214106-G-A 11058430-G-A *****
14295385-C-A 12174679-C-A ****
7359768-AATAT-A 7491727-AATAT-A 10×AT****
8634381-T-TAC 8766340-T-TAC 22×AC**
13862506-A-G 11741800-A-G ****
14065611-A-G 11944905-A-G *****
14175056-A-T 12054350-A-T *****
14183418-A-G 12062712-A-G *****
28728418-C-A 26582271-C-A *****
28725917-C-A 26579770-C-A *****
28610336-G-A 26464189-G-A *****
14187101-C-A 12066395-C-A ****
14191814-C-T 12071108-C-T *****
14212559-T-A 12091853-T-A *****
14224207-C-A 12103501-C-A *****
9930174-A-G 10092565-A-G **
9930050-A-G 10092441-A-G **
18630750-C-A 16518870-C-A *****
7197367-C-A 7329326-C-A *****
8276323-C-A 8408282-C-A *****
8214942-C-A 8346901-C-A *****
8159012-C-A 8290971-C-A *****
8076172-T-C 8208131-T-C *****
8075905-C-A 8207864-C-A ****
7969158-G-T 8101117-G-T ****
7939380-G-A 8071339-G-A *****
7754735-G-T 7886694-G-T ****
7320490-C-T 7452449-C-T *****
7242061-T-A 7374020-T-A *****
7242056-C-G 7374015-C-G *****
7217732-C-A 7349691-C-A ****
7142216-C-A 7274175-C-A ****
8786586-C-T 8918545-C-T ****
7086829-T-C 7218788-T-C *****
7086640-C-A 7218599-C-A *****
7048030-A-C 7179989-A-C *****
7048014-A-C 7179973-A-C *****
7047991-A-C 7179950-A-C *****
7012613-C-A 7144572-C-A ****
6911388-C-A 7043347-C-A *****
6833330-C-T 6965289-C-T *****
6830606-T-C 6962565-T-C *****
18121509-G-T 16009629-G-T ****
18153389-G-T 16041509-G-T ****
18156336-C-A 16044456-C-A *****
18186264-C-G 16074384-C-G *****
8291034-C-A 8422993-C-A *****
8786833-C-G 8918792-C-G *****
9930039-G-A 10092430-G-A **
16621789-G-A 14509909-G-A *****
16033631-T-C 13921751-T-C *****
16090297-C-A 13978417-C-A *****
9900236-A-G 10062627-A-G *****
9832407-G-T 9994798-G-T *****
9826113-A-G 9988504-A-G *****
14429405-TTA-T 12308680-T-. 15×TA**
15336018-TC-T 13224136-TC-T **
17723768-GA-G 15611888-GA-G *****
16277843-C-A 14165963-C-A *****
18928753-GA-G 16816873-GA-G 9×A*****
16336864-T-C 14224984-T-C *****
16522342-G-C 14410462-G-C *****
16681591-C-A 14569711-C-A ****
17929655-G-T 15817775-G-T ****
16689902-C-A 14578022-C-A *****
16719851-A-G 14607971-A-G *****
16720752-T-C 14608872-T-C *****
16843068-C-A 14731188-C-A *****
16988848-C-A 14876968-C-A *****
17084013-A-G 14972133-A-G *****
17098777-C-A 14986897-C-A *****
17227855-C-A 15115975-C-A *****
17246596-A-T 15134716-A-T *****
17370909-C-A 15259029-C-A *****
17374709-C-A 15262829-C-A *****
17716915-C-A 15605035-C-A *****
17770268-C-T 15658388-C-T *****
4358009-C-T 4489968-C-T **
58893635-C-A 56697236-G-T **
4477725-A-ATT 4609684-A-ATT 14×T**
21325913-C-A 19164027-C-A **
20622936-A-G 18461050-A-G P4_Prx **
20794448-T-TC 18632562-T-TC P4_Prx **
20943514-A-T 18781628-A-T P4_Dst **
20943520-G-T 18781634-G-T P4_Dst **
21077211-A-C 18915325-A-C **
21306582-T-A 19144696-T-A **
21328813-A-AAG 19166927-A-AAG **
20231685-C-T 18069799-C-T P5_Dst **
10815046-A-T **
21386338-C-A 19224452-C-A **
21456096-T-C 19294210-T-C **
21708980-T-A 19547094-T-A **
22079075-C-A 19917189-C-A **
22113534-G-A 19951648-G-A **
20379786-G-A 18217900-G-A P5_Dst **
19899590-G-GAAGA 17787710-G-GAAGA P5_Prx **
22211459-C-T 20049573-C-T **
19232969-C-A 17121089-C-A **
10945801-G-T **
10942492-C-T **
19071300-T-A 16959420-T-A **
10889392-C-A **
20248136-GTC-G 18086250-GTC-G P5_Dst 9×TC**
19125605-G-A 17013725-G-A **
10878056-A-T **
19818814-A-AT 17706934-A-AT P5_Prx **
19246785-G-C 17134905-G-C **
10868519-C-A **
19559513-A-T 17447633-A-T **
19559645-A-T 17447765-A-T **
19605044-G-T 17493164-G-T P5_Prx **
10819210-C-A **
10815041-C-T **
22237622-G-C 20075736-G-C DYZ19 **
10958865-C-A **
10760054-C-T **
26514898-C-T 24368751-C-T P1_Y1 **
26514915-T-G 24368768-T-G P1_Y1 **
27466746-A-G 25320599-A-G P1_Y2 **
27596056-T-C 25449909-T-C P1_Y2 **
10785217-C-A **
10772360-C-T **
10748273-A-T **
25892409-A-G 23746262-A-G P1_Y1 **
9930192-T-G 10092583-T-G **
10684545-C-A **
23779795-G-A 21617909-G-A *****
10672448-C-A **
10659383-T-C **
10654070-C-A **
25977795-AAAAAT-A 23831648-AAAAAT-A P1_Y1 **
23838970-C-G 21677084-C-G **
22237641-G-A 20075755-G-A DYZ19 **
22486219-G-T 20324333-G-T DYZ19 **
10815040-A-T **
24627729-C-A 22481582-C-A P3_t2 **
22237665-T-G 20075779-T-G DYZ19 **
22237670-C-A 20075784-C-A DYZ19 **
22237670-C-CA 20075784-C-CA DYZ19 **
22486214-A-T 20324328-A-T DYZ19 **
22520540-G-A 20358654-G-A **
10789204-C-A **
22767501-TAA-T 20605615-TAA-T 17×A**
22802976-G-A 20641090-G-A **
23015211-A-G 20853325-A-G **
23333561-A-T 21171675-A-T **
23464749-C-A 21302863-C-A **
10790258-C-G **
10956683-C-A **
10964735-T-A **
10618142-C-A **
18190758-C-A 16078878-C-A **
16929819-G-T 14817939-G-T **
17143931-C-G 15032051-C-G **
17346209-C-T 15234329-C-T **
17503813-G-T 15391933-G-T **
17685791-T-G 15573911-T-G **
17944985-T-C 15833105-T-C **
14475875-G-T 12355144-G-T **
16739480-C-A 14627600-C-A **
14452649-G-C 12331922-G-C **
14371930-C-G 12251226-C-G **
18190760-C-G 16078880-C-G **
14281040-C-A 12160334-C-A **
14241944-C-A 12121238-C-A **
14143041-AC-A 12022335-AC-A **
16789685-C-A 14677805-C-A **
16616705-A-C 14504825-A-C **
18401021-A-T 16289141-A-T P6_Gap **
16357284-C-A 14245404-C-A **
16015258-A-G 13903378-A-G **
15963866-C-A 13851986-C-A **
15961608-T-C 13849728-T-C **
15619435-C-A 13507555-C-A **
15290199-TA-T 13178298-TA-T **
16199654-G-A 14087774-G-A **
16405436-C-A 14293556-C-A **
16602795-A-G 14490915-A-G **
16429129-G-A 14317249-G-A **
14610739-T-G 12498941-T-G **
14529151-C-A 12417352-C-A **
16430533-A-G 14318653-A-G **
14506721-C-T 12394926-C-T **
16498146-A-G 14386266-A-G **
14108708-A-G 11988002-A-G **
14098846-C-A 11978140-C-A **
10981908-C-G **
18970535-A-T 16858655-A-T **
13462363-T-C 11306687-T-C **
13255205-C-A 11099529-C-A **
13233433-C-A 11077757-C-A **
11018636-G-T **
11017872-T-C **
11016980-T-C **
11013387-T-C **
13488717-G-A 11333041-G-A **
11007532-C-A **
10997346-C-A **
10996219-G-T **
10984599-A-C **
10984598-C-T **
10981991-G-T **
13482920-C-A 11327244-C-A **
13542219-T-A 11386543-T-A **
13999222-C-A 11878516-C-A **
4585388-A-G 4717347-A-G **
13984264-C-A 11863558-C-A **
18544850-A-G 16432970-A-G **
18566032-T-A 16454152-T-A **
13941751-G-A 11821045-G-A **
13928921-G-A 11808215-G-A **
13898492-G-T 11777786-G-T **
18566065-C-A 16454185-C-A **
13594292-C-A 11438616-C-A **
11666103-C-A **
11665817-A-G **
11665689-C-A **
11665514-C-A **
11665279-C-A **
11650504-A-C **
10618166-G-T **
22520543-C-T 20358657-C-T **
16071839-C-A 13959959-C-A **
6976203-G-T 7108162-G-T **
56830227-C-G **
7185638-C-T 7317597-C-T **
7185528-C-A 7317487-C-A **
28769237-C-A 26623090-C-A **
28768589-G-A 26622442-G-A **
7155972-T-G 7287931-T-G **
7155969-A-G 7287928-A-G **
7100969-T-G 7232928-T-G **
28624361-T-C 26478214-T-C **
7218270-A-G 7350229-A-G **
28614277-T-C 26468130-T-C **
6583138-T-C 6715097-T-C **
28612290-A-G 26466143-A-G **
4503310-GTATTAT-G 4635269-GTATTAT-G 16×TAT**
6580072-TC-T 6712031-TC-T **
6535035-T-C 6666994-T-C **
6526918-A-C 6658877-A-C **
6359681-A-G 6491640-A-G **
13416471-T-C 11260795-T-C **
22237231-T-G 20075345-T-G DYZ19 **
28612258-T-G 26466111-T-G **
7541094-C-A 7673053-C-A **
8076232-C-A 8208191-C-A **
8075832-C-A 8207791-C-A **
7958552-T-C 8090511-T-C **
9930169-G-T 10092560-G-T **
56836834-C-A **
8811232-C-A 8943191-C-A **
7646650-C-A 7778609-C-A **
7646619-C-A 7778578-C-A **
7500856-A-T 7632815-A-T IR1_L **
13437029-G-C 11281353-G-C **
7430655-A-G 7562614-A-G **
7427918-C-T 7559877-C-T **
8988645-G-C 9151036-G-C **
7363675-A-T 7495634-A-T **
9015978-G-T 9178369-G-T **
9544153-G-GTA 9706544-G-GTA IR3_Prx **
9951982-C-A 10114373-C-A **
10005980-C-T 10168371-C-T **
7264874-C-A 7396833-C-A **
6346140-G-T 6478099-G-T **
23742316-C-A 21580430-C-A *****
6268869-A-T 6400828-A-T IR3_Dst **
5294654-A-C 5426613-A-C **
5823985-C-A 5955944-C-A **
5722025-C-A 5853984-C-A **
5633587-C-A 5765546-C-A **
28582098-T-G 26435951-T-G **
5627450-A-G 5759409-A-G **
5612586-A-G 5744545-A-G **
5533727-G-T 5665686-G-T **
5461143-T-C 5593102-T-C **
5444018-TA-T 5575977-TA-T **
5127037-ACTATTGTTATAT-A 5258996-ACTATTGTTATAT-A **
5845169-C-A 5977128-C-A **
5116307-C-T 5248266-C-T **
5107999-G-A 5239958-G-A **
5053005-C-T 5184964-C-T **
27856392-A-G 25710245-A-G P1_Y2 **
4908903-G-A 5040862-G-A **
4901464-C-A 5033423-C-A **
4785604-T-A 4917563-T-A **
23779785-A-T 21617899-A-T *****
4759793-C-A 4891752-C-A **
4630718-T-G 4762677-T-G **
5845090-C-A 5977049-C-A **
5782463-A-T 5914422-A-T **
7717737-C-CTTCT 7849696-C-CTTCT 13×TTCT**
28612233-T-G 26466086-T-G **
5851971-C-A 5983930-C-A **
6092264-C-A 6224223-C-A **
58858789-G-T 56732082-C-A ***
24420953-G-T 22274806-G-T ***
27991609-A-G 25845462-A-G P1_Y2 ***
27808432-G-T 25662285-G-T P1_Y2 ***
58834702-C-T 56756169-G-A ***
27721218-G-A 25575071-G-A P1_Y2 ***
58858932-C-T 56731939-G-A S3129 ***
27772564-T-G 25626417-T-G P1_Y2 ***
27994637-C-A 25848490-C-A P1_Y2 ***
27994780-C-A 25848633-C-A P1_Y2 ***
27997704-T-A 25851557-T-A P1_Y2 ***
24420952-C-T 22274805-C-T ***
27997706-C-A 25851559-C-A P1_Y2 ***
58858918-A-T 56731953-T-A ***
27997709-G-A 25851562-G-A P1_Y2 ***
58858922-C-A 56731949-G-T ***
58831972-T-C 56758899-A-G ***
27997712-G-A 25851565-G-A P1_Y2 ***
27772636-A-C 25626489-A-C P1_Y2 ***
28006432-T-A 25860285-T-A P1_Y2 ***
27793188-G-T 25647041-G-T P1_Y2 ***
28076198-T-A 25930051-T-A P1_Y2 ***
28102879-T-C 25956732-T-C P1_Y2 ***
58831908-A-G 56758963-T-C ***
28160806-A-T 26014659-A-T P1_b4 ***
28170325-A-C 26024178-A-C P1_b4 ***
58858931-G-T 56731940-C-A ***
58834721-C-A 56756150-G-T ***
27821642-C-A 25675495-C-A P1_Y2 ***
58844584-T-C 56746287-A-G ***
27981977-C-A 25835830-C-A P1_Y2 ***
27859448-T-A 25713301-T-A P1_Y2 ***
27859452-G-A 25713305-G-A P1_Y2 ***
27873295-C-T 25727148-C-T P1_Y2 ***
27844528-G-T 25698381-G-T P1_Y2 ***
27873407-A-T 25727260-A-T P1_Y2 ***
27733733-A-G 25587586-A-G P1_Y2 ***
27873523-A-T 25727376-A-T P1_Y2 ***
27896110-C-A 25749963-C-A P1_Y2 ***
27896112-G-T 25749965-G-T P1_Y2 ***
27904409-C-A 25758262-C-A P1_Y2 ***
27916323-T-A 25770176-T-A P1_Y2 ***
27958515-A-T 25812368-A-T P1_Y2 ***
27974271-G-T 25828124-G-T P1_Y2 ***
58831893-A-G 56758978-T-C ***
27838064-A-T 25691917-A-T P1_Y2 ***
27982298-G-A 25836151-G-A P1_Y2 ***
24420962-A-T 22274815-A-T ***
58858929-T-C 56731942-A-G ***
27733436-T-A 25587289-T-A P1_Y2 ***
27844508-C-T 25698361-C-T P1_Y2 ***
27844503-A-T 25698356-A-T P1_Y2 ***
27844487-C-T 25698340-C-T P1_Y2 ***
27838162-A-T 25692015-A-T P1_Y2 ***
58858948-A-C 56731923-T-G ***
27732431-A-G 25586284-A-G P1_Y2 ***
24420963-C-T 22274816-C-T ***
58858999-T-C 56731872-A-G ***
27838157-A-T 25692010-A-T P1_Y2 ***
27844510-C-T 25698363-C-T P1_Y2 ***
28808695-A-T 26662548-A-T ***
28170576-C-T 26024429-C-T P1_b4 ***
28808717-T-C 26662570-T-C ***
28808714-G-C 26662567-G-C ***
28588314-A-G 26442167-A-G ***
28808716-A-T 26662569-A-T ***
28587961-C-A 26441814-C-A ***
28491385-C-A 26345238-C-A ***
28491381-A-G 26345234-A-G ***
28491380-G-A 26345233-G-A ***
28491374-T-A 26345227-T-A ***
28491372-T-A 26345225-T-A ***
28491362-A-G 26345215-A-G ***
28491360-T-A 26345213-T-A ***
28808721-A-T 26662574-A-T ***
28808712-T-A 26662565-T-A ***
28808722-T-G 26662575-T-G ***
28491354-A-G 26345207-A-G ***
28808724-G-A 26662577-G-A ***
24420941-G-T 22274794-G-T ***
27716888-C-A 25570741-C-A P1_Y2 ***
28808725-A-C 26662578-A-C ***
28808726-A-T 26662579-A-T ***
28808727-T-C 26662580-T-C ***
28808728-C-A 26662581-C-A ***
28491353-A-G 26345206-A-G ***
28808731-A-T 26662584-A-T ***
28808732-T-G 26662585-T-G ***
28808713-G-T 26662566-G-T ***
28797860-G-T 26651713-G-T ***
28808734-G-A 26662587-G-A ***
28808702-A-G 26662555-A-G ***
28808696-A-G 26662549-A-G ***
28808697-A-G 26662550-A-G ***
28808698-T-A 26662551-T-A ***
28808699-T-A 26662552-T-A ***
28808700-G-T 26662553-G-T ***
28808701-A-G 26662554-A-G ***
28802562-T-A 26656415-T-A ***
28802561-A-G 26656414-A-G ***
28802543-G-T 26656396-G-T ***
28802541-T-A 26656394-T-A ***
28802536-G-A 26656389-G-A ***
28808703-T-A 26662556-T-A ***
28797862-G-T 26651715-G-T ***
28808704-G-A 26662557-G-A ***
28808705-G-T 26662558-G-T ***
28802532-T-A 26656385-T-A ***
28802529-A-G 26656382-A-G ***
28797875-T-A 26651728-T-A ***
28808706-A-G 26662559-A-G ***
28797872-G-T 26651725-G-T ***
28808710-A-T 26662563-A-T ***
28808711-A-C 26662564-A-C ***
28797870-G-A 26651723-G-A ***
28797869-A-C 26651722-A-C ***
28797865-G-A 26651718-G-A ***
28808733-C-G 26662586-C-G ***
28808736-A-T 26662589-A-T ***
28170582-A-T 26024435-A-T P1_b4 ***
24353319-T-C 22207172-T-C P3_t1 ***
28253599-C-A 26107452-C-A P1_b4 ***
28253597-T-A 26107450-T-A P1_b4 ***
28253595-G-A 26107448-G-A P1_b4 ***
28253594-T-A 26107447-T-A P1_b4 ***
28253593-C-A 26107446-C-A P1_b4 ***
28253592-C-A 26107445-C-A P1_b4 ***
28253589-C-A 26107442-C-A P1_b4 ***
28253588-T-A 26107441-T-A P1_b4 ***
28253587-C-A 26107440-C-A P1_b4 ***
28253586-C-A 26107439-C-A P1_b4 ***
28253584-C-A 26107437-C-A P1_b4 ***
58825403-T-A 56765468-A-T ***
28253603-T-A 26107456-T-A P1_b4 ***
28253583-C-A 26107436-C-A P1_b4 ***
28253581-T-A 26107434-T-A P1_b4 ***
28253580-T-A 26107433-T-A P1_b4 ***
28808694-G-A 26662547-G-A ***
28253551-T-A 26107404-T-A P1_b4 ***
28253548-C-A 26107401-C-A P1_b4 ***
28253545-G-A 26107398-G-A P1_b4 ***
28253544-T-C 26107397-T-C P1_b4 ***
58831858-A-C 56759013-T-G ***
58831870-G-T 56759001-C-A ***
28170939-T-C 26024792-T-C P1_b4 ***
28170668-G-A 26024521-G-A P1_b4 ***
28253601-C-A 26107454-C-A P1_b4 ***
24420946-C-T 22274799-C-T ***
28808737-T-A 26662590-T-A ***
58821706-G-C 56769165-C-G ***
28808739-G-T 26662592-G-T ***
28808740-A-C 26662593-A-C ***
58820192-T-C 56770679-A-G ***
28491351-C-G 26345204-C-G ***
58820492-G-T 56770379-C-A ***
58820496-A-T 56770375-T-A ***
58820499-C-A 56770372-G-T ***
58820535-T-G 56770336-A-C ***
24420945-C-T 22274798-C-T ***
58821675-C-T 56769196-G-A ***
58821687-A-T 56769184-T-A ***
28360468-C-T 26214321-C-T P1_gr2 ***
58821720-T-A 56769151-A-T ***
24353321-T-C 22207174-T-C P3_t1 ***
58821721-C-T 56769150-G-A ***
58823347-C-A 56767524-G-T ***
58823348-A-T 56767523-T-A ***
58824853-C-G 56766018-G-C ***
58824854-C-T 56766017-G-A ***
28253611-G-A 26107464-G-A P1_b4 ***
28253610-T-A 26107463-T-A P1_b4 ***
58824863-C-A 56766008-G-T ***
24420937-C-T 22274790-C-T ***
24420933-C-T 22274786-C-T ***
28253606-C-A 26107459-C-A P1_b4 ***
28253604-G-A 26107457-G-A P1_b4 ***
28253552-G-C 26107405-G-C P1_b4 ***
27082130-T-G 24935983-T-G P1_r4 ***
27694831-C-A 25548684-C-A P1_Y2 ***
25207752-G-A 23061605-G-A P2_r1 ***
25268463-T-A 23122316-T-A P2_r1 ***
25231987-A-G 23085840-A-G P2_r1 ***
25207893-G-A 23061746-G-A P2_r1 ***
25207889-C-A 23061742-C-A P2_r1 ***
25207763-C-A 23061616-C-A P2_r1 ***
25207762-G-A 23061615-G-A P2_r1 ***
25207759-C-A 23061612-C-A P2_r1 ***
25207758-G-A 23061611-G-A P2_r1 ***
25207757-A-G 23061610-A-G P2_r1 ***
24629582-G-A 22483435-G-A P3_t2 ***
25207756-G-A 23061609-G-A P2_r1 ***
25207755-G-A 23061608-G-A P2_r1 ***
25207754-C-A 23061607-C-A P2_r1 ***
25207750-G-A 23061603-G-A P2_r1 ***
25268501-T-A 23122354-T-A P2_r1 ***
25207748-G-A 23061601-G-A P2_r1 ***
25207747-C-A 23061600-C-A P2_r1 ***
25207746-C-A 23061599-C-A P2_r1 ***
25207745-C-A 23061598-C-A P2_r1 ***
25207742-G-A 23061595-G-A P2_r1 ***
25207741-T-A 23061594-T-A P2_r1 ***
25207740-G-A 23061593-G-A P2_r1 ***
25207738-G-A 23061591-G-A P2_r1 ***
25207737-G-A 23061590-G-A P2_r1 ***
25207736-T-G 23061589-T-G P2_r1 ***
25207733-G-A 23061586-G-A P2_r1 ***
25207731-G-A 23061584-G-A P2_r1 ***
25207727-G-A 23061580-G-A P2_r1 ***
25268497-G-A 23122350-G-A P2_r1 ***
25268507-G-A 23122360-G-A P2_r1 ***
25207724-G-A 23061577-G-A P2_r1 ***
25431760-G-T 23285613-G-T P2_r2 ***
25603687-C-A 23457540-C-A P1_gr1 ***
25524846-A-T 23378699-A-T P1_gr1 ***
25524618-C-A 23378471-C-A P1_gr1 ***
25470576-T-A 23324429-T-A P2_r2 ***
25466457-T-G 23320310-T-G P2_r2 ***
25456432-T-A 23310285-T-A P2_r2 ***
25456430-G-A 23310283-G-A P2_r2 ***
25456428-G-A 23310281-G-A P2_r2 ***
25456426-C-A 23310279-C-A P2_r2 ***
25456422-T-A 23310275-T-A P2_r2 ***
25456391-G-T 23310244-G-T P2_r2 ***
25439728-T-G 23293581-T-G P2_r2 ***
25434924-C-A 23288777-C-A P2_r2 ***
25429649-T-G 23283502-T-G P2_r2 ***
25268516-G-A 23122369-G-A P2_r1 ***
25429594-A-C 23283447-A-C P2_r2 ***
25429115-C-A 23282968-C-A P2_r2 ***
25428344-A-C 23282197-A-C P2_r2 ***
25395106-G-C 23248959-G-C P2_r2 ***
25394968-T-A 23248821-T-A P2_r2 ***
25382119-G-T 23235972-G-T P2_r2 ***
25382068-A-T 23235921-A-T P2_r2 ***
25376536-C-T 23230389-C-T P2_r2 24×T***
25372136-A-C 23225989-A-C P2_r2 ***
25366439-T-G 23220292-T-G P2_r2 ***
25364631-C-T 23218484-C-T P2_r2 ***
25334360-C-A 23188213-C-A P2_r1 ***
25268546-C-A 23122399-C-A P2_r1 ***
25268543-T-G 23122396-T-G P2_r1 ***
25207726-G-A 23061579-G-A P2_r1 ***
25207723-T-G 23061576-T-G P2_r1 ***
25626846-T-A 23480699-T-A P1_b3 ***
24715716-C-T 22569569-C-T P3_b2 ***
24778841-A-C 22632694-A-C P3_b2 ***
24778804-A-G 22632657-A-G P3_b2 ***
24778462-T-C 22632315-T-C P3_b2 ***
24775578-T-C 22629431-T-C P3_b2 ***
24762341-A-C 22616194-A-C P3_b2 ***
24762202-T-C 22616055-T-C P3_b2 ***
24754972-T-A 22608825-T-A P3_b2 ***
24749023-T-C 22602876-T-C P3_b2 ***
24749003-T-A 22602856-T-A P3_b2 ***
24728632-T-C 22582485-T-C P3_b2 ***
24728615-A-T 22582468-A-T P3_b2 ***
24728594-T-C 22582447-T-C P3_b2 ***
24728585-A-C 22582438-A-C P3_b2 ***
24714119-C-A 22567972-C-A P3_b2 ***
24778874-G-A 22632727-G-A P3_b2 ***
24712715-C-A 22566568-C-A P3_b2 ***
24694518-T-G 22548371-T-G P3_b2 ***
24681606-A-T 22535459-A-T P3_b2 ***
24674335-G-T 22528188-G-T P3_b2 ***
24673110-G-T 22526963-G-T P3_b2 ***
24636365-T-A 22490218-T-A P3_t2 ***
24636366-T-A 22490219-T-A P3_t2 ***
24671242-A-G 22525095-A-G P3_b2 ***
24671239-G-C 22525092-G-C P3_b2 ***
24662330-A-T 22516183-A-T P3_b2 ***
24666956-T-G 22520809-T-G P3_b2 ***
24665119-G-T 22518972-G-T P3_b2 ***
24662375-T-A 22516228-T-A P3_b2 ***
24662335-C-T 22516188-C-T P3_b2 ***
24778872-G-A 22632725-G-A P3_b2 ***
24778890-C-A 22632743-C-A P3_b2 ***
25177354-T-G 23031207-T-G g1 ***
24878361-C-G 22732214-C-G g1 ***
25165722-G-A 23019575-G-A g1 ***
25165717-G-A 23019570-G-A g1 ***
25165697-G-C 23019550-G-C g1 ***
25127495-G-T 22981348-G-T g1 ***
25127490-A-C 22981343-A-C g1 ***
25127486-C-T 22981339-C-T g1 ***
24919558-A-T 22773411-A-T g1 ***
24883551-A-G 22737404-A-G g1 ***
24878368-A-T 22732221-A-T g1 ***
24878367-C-A 22732220-C-A g1 ***
24878366-A-C 22732219-A-C g1 ***
24878363-G-C 22732216-G-C g1 ***
24878362-A-G 22732215-A-G g1 ***
24878360-A-G 22732213-A-G g1 ***
24783607-G-T 22637460-G-T P3_b2 ***
24878357-G-C 22732210-G-C g1 ***
24878356-G-A 22732209-G-A g1 ***
24878355-T-A 22732208-T-A g1 ***
24878354-C-G 22732207-C-G g1 ***
24878353-T-A 22732206-T-A g1 ***
24878352-A-C 22732205-A-C g1 ***
24878351-T-A 22732204-T-A g1 ***
24878350-A-G 22732203-A-G g1 ***
24878344-A-T 22732197-A-T g1 ***
24878341-T-G 22732194-T-G g1 ***
24878340-C-G 22732193-C-G g1 ***
24796612-G-T 22650465-G-T P3_b2 ***
24794442-A-G 22648295-A-G P3_b2 ***
24794427-T-G 22648280-T-G P3_b2 ***
25626781-T-A 23480634-T-A A3560 P1_b3 ***
25646993-A-T 23500846-A-T P1_b3 ***
24548198-T-C 22402051-T-C P3_t2 ***
27062108-A-T 24915961-A-T P1_r4 ***
27151341-G-A 25005194-G-A P1_g3 ***
27151338-G-A 25005191-G-A P1_g3 ***
27150672-A-T 25004525-A-T P1_g3 ***
27134966-G-T 24988819-G-T P1_g3 ***
27130402-G-A 24984255-G-A P1_g3 ***
27129895-C-A 24983748-C-A P1_g3 ***
27129891-C-A 24983744-C-A P1_g3 ***
27129854-G-A 24983707-G-A P1_g3 ***
24575810-A-T 22429663-A-T P3_t2 ***
27095971-G-T 24949824-G-T P1_r4 ***
27082179-T-C 24936032-T-C P1_r4 ***
27082115-C-G 24935968-C-G P1_r4 ***
27062118-C-T 24915971-C-T P1_r4 22×T***
27062085-C-T 24915938-C-T P1_r4 ***
27151343-G-A 25005196-G-A P1_g3 ***
27062081-A-T 24915934-A-T P1_r4 ***
27062076-G-T 24915929-G-T P1_r4 ***
27049748-C-T 24903601-C-T P1_r4 ***
27048225-A-C 24902078-A-C P1_r4 ***
27004312-G-C 24858165-G-C P1_r4 ***
27004305-T-G 24858158-T-G P1_r4 ***
27004256-A-C 24858109-A-C P1_r4 ***
24575836-A-G 22429689-A-G P3_t2 ***
27004219-G-T 24858072-G-T P1_r4 ***
26995027-G-T 24848880-G-T P1_r4 ***
26991388-G-A 24845241-G-A P1_r4 ***
26991371-T-A 24845224-T-A P1_r4 ***
26991369-G-A 24845222-G-A P1_r4 ***
27151342-A-G 25005195-A-G P1_g3 ***
27151345-T-G 25005198-T-G P1_g3 ***
26953187-G-A 24807040-G-A P1_r3 ***
27397157-G-C 25251010-G-C P1_g3 ***
27694797-C-A 25548650-C-A P1_Y2 ***
27618293-C-G 25472146-C-G P1_Y2 ***
27602801-A-G 25456654-A-G P1_Y2 ***
27585905-A-T 25439758-A-T P1_Y2 ***
24548204-A-T 22402057-A-T P3_t2 ***
27585891-A-T 25439744-A-T P1_Y2 ***
27579055-G-T 25432908-G-T P1_Y2 ***
27427768-G-T 25281621-G-T P1_g3 ***
27424074-G-T 25277927-G-T P1_g3 ***
27411648-A-G 25265501-A-G P1_g3 ***
27411646-A-G 25265499-A-G P1_g3 ***
27411628-A-G 25265481-A-G P1_g3 ***
27404358-A-C 25258211-A-C P1_g3 ***
27395392-G-T 25249245-G-T P1_g3 ***
27151356-C-A 25005209-C-A P1_g3 ***
27369053-G-T 25222906-G-T P1_g3 ***
27354671-A-C 25208524-A-C P1_g3 ***
27313331-C-A 25167184-C-A P1_g3 ***
27306081-T-C 25159934-T-C P1_g3 ***
27306022-C-T 25159875-C-T P1_g3 ***
27210976-G-T 25064829-G-T P1_g3 ***
27199101-C-T 25052954-C-T P1_g3 ***
27190518-A-G 25044371-A-G P1_g3 ***
27172243-G-T 25026096-G-T P1_g3 ***
27165214-C-A 25019067-C-A P1_g3 ***
27151410-G-C 25005263-G-C P1_g3 ***
27151399-C-A 25005252-C-A P1_g3 ***
24562469-T-C 22416322-T-C P3_t2 ***
27151358-T-A 25005211-T-A P1_g3 ***
26991212-G-A 24845065-G-A P1_r4 ***
24575839-C-T 22429692-C-T P3_t2 ***
25662049-C-A 23515902-C-A P1_b3 ***
25845055-C-A 23698908-C-A P1_b3 ***
26089881-G-T 23943734-G-T P1_Y1 ***
26089879-C-T 23943732-C-T P1_Y1 ***
26089876-C-T 23943729-C-T P1_Y1 ***
26089873-C-T 23943726-C-T P1_Y1 ***
26089870-A-T 23943723-A-T P1_Y1 ***
26068751-A-G 23922604-A-G P1_Y1 ***
26008346-T-C 23862199-T-C P1_Y1 ***
25979361-C-A 23833214-C-A P1_Y1 ***
25956461-A-G 23810314-A-G P1_Y1 ***
25845064-C-A 23698917-C-A P1_b3 ***
25845063-C-A 23698916-C-A P1_b3 ***
25845062-T-A 23698915-T-A P1_b3 ***
25845058-T-A 23698911-T-A P1_b3 ***
25845054-T-A 23698907-T-A P1_b3 ***
26089885-A-T 23943738-A-T P1_Y1 ***
25845042-C-A 23698895-C-A P1_b3 ***
25835327-A-C 23689180-A-C P1_b3 ***
25804964-C-G 23658817-C-G P1_b3 ***
25766632-G-T 23620485-G-T P1_b3 ***
25766625-G-T 23620478-G-T P1_b3 ***
25766599-T-A 23620452-T-A P1_b3 ***
25757968-T-A 23611821-T-A P1_b3 ***
25757965-T-A 23611818-T-A P1_b3 ***
25727454-C-A 23581307-C-A P1_b3 ***
25697968-G-T 23551821-G-T P1_b3 ***
25690052-A-C 23543905-A-C P1_b3 ***
25689013-G-T 23542866-G-T P1_b3 ***
25675732-G-T 23529585-G-T P1_b3 ***
25662996-G-T 23516849-G-T P1_b3 ***
26089884-C-T 23943737-C-T P1_Y1 ***
26089887-C-T 23943740-C-T P1_Y1 ***
24577803-T-A 22431656-T-A P3_t2 ***
24582563-G-A 22436416-G-A P3_t2 ***
26914240-C-T 24768093-C-T P1_r3 ***
26914231-A-T 24768084-A-T P1_r3 ***
26907554-A-C 24761407-A-C P1_r3 ***
26907499-A-T 24761352-A-T P1_r3 ***
26902338-C-A 24756191-C-A P1_r3 ***
26880358-A-T 24734211-A-T P1_r3 ***
26880327-A-T 24734180-A-T P1_r3 ***
26874061-G-A 24727914-G-A P1_r3 ***
26874053-T-A 24727906-T-A P1_r3 ***
26810747-C-A 24664600-C-A P1_g2 ***
26810711-A-T 24664564-A-T P1_g2 ***
26810690-T-C 24664543-T-C P1_g2 ***
26511855-T-A 24365708-T-A P1_Y1 ***
24614167-A-C 22468020-A-C P3_t2 ***
26098042-G-A 23951895-G-A P1_Y1 ***
26495665-G-A 24349518-G-A P1_Y1 ***
26495662-G-A 24349515-G-A P1_Y1 ***
26495660-C-A 24349513-C-A P1_Y1 ***
26495658-C-A 24349511-C-A P1_Y1 ***
26495657-A-C 24349510-A-C P1_Y1 ***
26440434-C-T 24294287-C-T P1_Y1 ***
26344122-T-C 24197975-T-C P1_Y1 ***
26278279-C-A 24132132-C-A P1_Y1 ***
26277795-C-T 24131648-C-T P1_Y1 ***
26277742-A-G 24131595-A-G P1_Y1 ***
26171280-T-C 24025133-T-C P1_Y1 ***
24623430-G-A 22477283-G-A P3_t2 ***
26141237-A-C 23995090-A-C P1_Y1 ***
26128902-G-A 23982755-G-A P1_Y1 ***
25626845-G-A 23480698-G-A P1_b3 ***
13855157-AA-TT 11734451-AA-TT ***
58905230-T-G 56685641-A-C ***
26902325-TAG-AAA 24756178-TAG-AAA P1_r3 ***
27129771-CAA-C 24983624-CAA-C P1_g3 25×A***
27125405-CAAAGCAGAG-C 24979258-CAAAGCAGAG-C P1_g3 ***
27062945-GGTAGTA-G 24916798-GGTAGTA-G P1_r4 11×GTA***
27049850-AT-A 24903703-AT-A P1_r4 17×T***
27046828-CT-C 24900681-CT-C P1_r4 10×T***
27037868-C-CT 24891721-C-CT P1_r4 13×T***
27004222-CTT-C 24858075-CTT-C P1_r4 25×T***
27001771-CTTT-C 24855624-CTTT-C P1_r4 24×T***
26991363-AAAAG-A 24845216-AAAAG-A P1_r4 ***
26991220-GAAAG-AAAAA 24845073-GAAAG-AAAAA P1_r4 ***
26953164-AAG-A 24807017-AAG-A P1_r3 ***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
26914241-ACTA-TCTT 24768094-ACTA-TCTT P1_r3 ***
26907510-A-AT 24761363-A-AT P1_r3 22×T***
26902316-AAAAAG-A 24756169-AAAAAG-A P1_r3 ***
27147072-AT-A 25000925-AT-A P1_g3 ***
26900719-GA-G 24754572-GA-G P1_r3 17×A***
26880198-CT-C 24734051-CT-C P1_r3 25×T***
26626273-AT-A 24480126-AT-A P1_g2 9×T***
26593442-CT-C 24447295-CT-C P1_g2 11×T***
26495702-CTTTG-TTTTT 24349555-CTTTG-TTTTT P1_Y1 ***
26400705-AT-A 24254558-AT-A P1_Y1 15×T***
26379434-G-AA 24233287-G-AA P1_Y1 ***
26320658-TA-T 24174511-TA-T P1_Y1 14×A***
26284858-CA-C 24138711-CA-C P1_Y1 19×A***
26283209-C-CA 24137062-C-CA P1_Y1 21×A***
26277717-G-TT 24131570-G-TT P1_Y1 ***
26267693-TAC-AA 24121546-TAC-AA P1_Y1 ***
26228677-CTTTCTTTCTTTC-TTTTTTTTTT 24082530-CTTTCTTTCTTTC-TTTTTTTTTT P1_Y1 ***
26120162-C-CTTCT 23974015-C-CTTCT P1_Y1 ***
27134689-TA-T 24988542-TA-T P1_g3 10×A***
27147441-A-AT 25001294-A-AT P1_g3 12×T***
26004895-G-GT 23858748-G-GT P1_Y1 10×T***
27398546-GAAG-AAAA 25252399-GAAG-AAAA P1_g3 ***
27794677-C-CAT 25648530-C-CAT P1_Y2 12×AT***
27794110-CT-C 25647963-CT-C P1_Y2 ***
27789487-T-TG 25643340-T-TG P1_Y2 8×G***
27785823-G-GAA 25639676-G-GAA P1_Y2 8×A***
27777759-GA-G 25631612-GA-G P1_Y2 19×A***
27728377-CA-C 25582230-CA-C P1_Y2 ***
27728064-CACCTTATATGACTTTTTCAAATAAA-C 25581917-CACCTTATATGACTTTTTCAAATAAA-C P1_Y2 ***
27721225-AT-A 25575078-AT-A P1_Y2 ***
27694706-ATT-A 25548559-ATT-A P1_Y2 28×T***
27643245-CT-C 25497098-CT-C P1_Y2 ***
27602804-AGC-GGG 25456657-AGC-GGG P1_Y2 ***
27602764-CATTA-TATTT 25456617-CATTA-TATTT P1_Y2 ***
27585915-GTC-T 25439768-GTC-T P1_Y2 ***
27412214-CA-C 25266067-CA-C P1_g3 8×A***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
27155035-CGT-C 25008888-CGT-C P1_g3 17×GT***
27398533-AG-A 25252386-AG-A P1_g3 ***
27346296-T-TTGC 25200149-T-TTGC P1_g3 ***
27320941-A-ATT 25174794-A-ATT P1_g3 11×T***
27311771-TA-T 25165624-TA-T P1_g3 9×A***
27301679-AT-A 25155532-AT-A P1_g3 9×T***
27299410-AT-A 25153263-AT-A P1_g3 9×T***
27295701-TA-T 25149554-TA-T P1_g3 ***
27248568-GTTT-G 25102421-GTTT-G P1_g3 18×T***
27235637-C-CT 25089490-C-CT P1_g3 8×T***
27232108-GTTTTTTCTTTCT-G 25085961-GTTTTTTCTTTCT-G P1_g3 ***
27229875-GACTAA-G 25083728-GACTAA-G P1_g3 ***
27186323-G-GA 25040176-G-GA P1_g3 19×A***
27166686-G-GA 25020539-G-GA P1_g3 11×A***
27165197-A-AT 25019050-A-AT P1_g3 11×T***
26120152-T-TCCTA 23974005-T-TCCTA P1_Y1 ***
25995492-GTATA-G 23849345-GTATA-G P1_Y1 24×TA***
27832305-A-AT 25686158-A-AT P1_Y2 17×T***
24525866-TA-T 22379719-TA-T P3_t2 9×A***
24736119-CA-C 22589972-CA-C P3_b2 11×A***
24684828-TAC-T 22538681-TAC-T P3_b2 15×AC***
24675448-C-CT 22529301-C-CT P3_b2 12×T***
24668845-AT-A 22522698-AT-A P3_b2 11×T***
24665186-AT-A 22519039-AT-A P3_b2 ***
24637476-TTGTG-T 22491329-TTGTG-T P3_t2 11×TG***
24607321-C-CT 22461174-C-CT P3_t2 12×T***
24600670-C-CA 22454523-C-CA P3_t2 16×A***
24582837-CA-C 22436690-CA-C P3_t2 17×A***
24582515-CAAAA-C 22436368-CAAAA-C P3_t2 31×A***
24582504-ACCT-CCCC 22436357-ACCT-CCCC P3_t2 ***
24582352-C-CT 22436205-C-CT P3_t2 17×T***
24573423-CTT-C 22427276-CTT-C P3_t2 21×T***
24542299-CA-C 22396152-CA-C P3_t2 ***
24278325-AGGGAGGGAAGGAAGGAAGG-GGAAGGAAGGGAAGGAAGGA 22132178-AGGGAGGGAAGGAAGGAAGG-GGAAGGAAGGGAAGGAAGGA P3_b1 ***
24773126-T-TA 22626979-T-TA P3_b2 10×A***
24044865-AT-A 21898718-AT-A ***
24025840-GAA-G 21879693-GAA-G 9×A***
24014304-AACAGTGATTAATATAAAG-A 21868157-AACAGTGATTAATATAAAG-A ***
22703626-G-AA 20541740-G-AA ***
22505253-GG-TC 20343367-GG-TC DYZ19 ***
22505199-TG-GT 20343313-TG-GT DYZ19 ***
22504216-TT-G 20342330-TT-G DYZ19 ***
22490746-GT-TC 20328860-GT-TC DYZ19 ***
22481343-TG-T 20319457-TG-T DYZ19 ***
22481328-TTTAG-GTTAT 20319442-TTTAG-GTTAT DYZ19 ***
22431987-GTC-TTA 20270101-GTC-TTA DYZ19 ***
22421423-GT-G 20259537-GT-G DYZ19 ***
22421369-ATG-TTC 20259483-ATG-TTC DYZ19 ***
22341511-TTTCG-GTTCT 20179625-TTTCG-GTTCT DYZ19 ***
24771309-TC-T 22625162-TC-T P3_b2 ***
24783187-AGAGT-A 22637040-AGAGT-A P3_b2 ***
25940445-C-CT 23794298-C-CT P1_Y1 17×T***
25479931-TA-T 23333784-TA-T P2_r2 ***
25845045-TTC-AAA 23698898-TTC-AAA P1_b3 ***
25718213-G-GTT 23572066-G-GTT P1_b3 13×T***
25706148-CA-C 23560001-CA-C P1_b3 16×A***
25689061-C-CA 23542914-C-CA P1_b3 9×A***
25684273-G-GA 23538126-G-GA P1_b3 10×A***
25675939-T-TA 23529792-T-TA P1_b3 10×A***
25675782-T-TA 23529635-T-TA P1_b3 12×A***
25663035-CT-C 23516888-CT-C P1_b3 ***
25617175-TTG-T 23471028-TTG-T P1_gr1 19×TG***
25567552-AT-A 23421405-AT-A P1_gr1 17×T***
25545770-C-CT 23399623-C-CT P1_gr1 13×T***
25537117-G-GT 23390970-G-GT P1_gr1 10×T***
25514627-CT-C 23368480-CT-C P1_gr1 13×T***
25493225-CT-C 23347078-CT-C P2_r2 ***
25447269-GGTAGTA-G 23301122-GGTAGTA-G P2_r2 9×GTA***
24785778-C-CT 22639631-C-CT P3_b2 14×T***
25306677-CA-C 23160530-CA-C P2_r1 ***
24859445-CTTGAATAAAATACTATT-C 22713298-CTTGAATAAAATACTATT-C P3_b2 ***
24860046-G-AA 22713899-G-AA P3_b2 ***
24866990-A-AT 22720843-A-AT P3_b2 11×T***
25177324-TAC-AAA 23031177-TAC-AAA g1 ***
25300414-CA-C 23154267-CA-C P2_r1 8×A***
25301996-CT-C 23155849-CT-C P2_r1 ***
25310157-AAG-A 23164010-AAG-A P2_r1 ***
25437894-T-TA 23291747-T-TA P2_r2 12×A***
25378984-GTCC-TT 23232837-GTCC-TT P2_r2 ***
25388480-CT-C 23242333-CT-C P2_r2 ***
25395700-TCC-T 23249553-TCC-T P2_r2 ***
25424574-C-CT 23278427-C-CT P2_r2 17×T***
25431153-C-CT 23285006-C-CT P2_r2 11×T***
25434990-TA-T 23288843-TA-T P2_r2 ***
27796697-TA-T 25650550-TA-T P1_Y2 8×A***
27838074-ACTACAAA-TCTTCAAT 25691927-ACTACAAA-TCTTCAAT P1_Y2 ***
22338103-ATG-GTC 20176217-ATG-GTC DYZ19 ***
14937846-T-TTCTTTTCTGA 12825921-T-TTCTTTTCTGA ***
10776024-G-A,C ***
10873157-C-G ***
2774663-CTT-C,CT 2906622-CTT-C,CT 18×T***
13861586-G-A,C 11740880-G-A,C ***
26810593-TTC-T 24664446-TTC-T P1_g2 ***
26463094-TTTC-T 24316947-TTTC-T P1_Y1 ***
25333855-AC-A 23187708-AC-A P2_r1 ***
25323010-ACT-A 23176863-ACT-A P2_r1 ***
25176848-TTC-T 23030701-TTC-T g1 ***
24296169-GC-G 22150022-GC-G P3_t1 ***
21477779-AAG-A 19315893-AAG-A ***
19868141-GCTT-G 17756261-GCTT-G P5_Prx ***
19775300-GTCTT-G 17663420-GTCTT-G P5_Prx ***
14937853-C-CTTTTCTTTTA 12825928-C-CTTTTCTTTTA ***
14324892-TTC-T 12204186-TTC-T ***
13487557-C-A 11331881-C-A ***
13545349-AAAGAAAG-A 11389673-AAAGAAAG-A ***
13141938-T-TTCCAC 10631424-T-TTCCAC 4×TCCAC***
59031759-TCT-ACC 56885612-TCT-ACC ***
59030571-TT-AA 56884424-TT-AA ***
59008112-GTTC-TTTT 56861965-GTTC-TTTT ***
58987988-AAACC-TAACG 56841841-AAACC-TAACG ***
58987979-TAC-AAG 56841832-TAC-AAG ***
58987918-TG-CA 56841771-TG-CA ***
58985437-TCTGC-CCTGT 56839290-TCTGC-CCTGT ***
58985427-GGG-AGA 56839280-GGG-AGA ***
58982110-GCAC-CCAT 56835963-GCAC-CCAT ***
58981256-GG-CA 56835109-GG-CA ***
58980486-ACCA-GCCG 56834339-ACCA-GCCG ***
58979078-TTCCA-CTCCT 56832931-TTCCA-CTCCT ***
10949982-C-A ***
14384418-G-T 12263714-G-T ***
58977738-CATTG-AATTA 56831591-CATTG-AATTA ***
13850186-C-T 11729480-C-T ***
56836814-C-G ***
56836795-A-T ***
56836794-C-G ***
56836263-C-T ***
22568329-T-G 20406443-T-G ***
21307157-G-A 19145271-G-A ***
19040627-C-A 16928747-C-A ***
18947853-C-A 16835973-C-A ***
18100689-C-A 15988809-C-A MF1644 ***
17284532-CTTT-C,CTTTT 15172652-CTTT-C,CTTTT 21×T***
16539757-T-C 14427877-T-C ***
16028717-A-G 13916837-A-G ***
15260684-CTTTTT-C 13148768-CTTTTT-C 25×T***
14340648-C-A 12219943-C-A ***
13463445-C-A 11307769-C-A ***
2812777-ATTT-A,AT 2944736-ATTT-A,AT 30×T***
10033780-A-G 10196171-A-G ***
3591867-C-A 3723826-C-A ***
5609623-C-A 5741582-C-A ***
6133809-C-A 6265768-C-A ***
6732481-G-T 6864440-G-T ***
7078203-G-T 7210162-G-T ***
8649789-CAA-C,CAAA 8781748-CAA-C,CAAA 13×A***
10673840-C-T ***
11014463-A-T ***
10689771-A-G ***
10814417-C-A ***
10895923-C-A ***
10964689-C-T ***
10964705-T-A ***
11000522-C-G ***
58977817-CC-GA 56831670-CC-GA ***
58977589-CCCAC-TCCAT 56831442-CCCAC-TCCAT ***
27838277-AGCA-TGCT 25692130-AGCA-TGCT P1_Y2 ***
27996899-GTTAT-G 25850752-GTTAT-G P1_Y2 ***
28384225-T-TA 26238078-T-TA P1_gr2 13×A***
28360492-T-TA 26214345-T-TA P1_gr2 13×A***
28260208-CT-C 26114061-CT-C P1_b4 13×T***
28253555-TGAAGCT-AAAAAAA 26107408-TGAAGCT-AAAAAAA P1_b4 ***
28245714-AT-A 26099567-AT-A P1_b4 15×T***
28226238-C-CT 26080091-C-CT P1_b4 13×T***
28185939-G-GT 26039792-G-GT P1_b4 12×T***
28180701-CA-C 26034554-CA-C P1_b4 16×A***
28170992-GA-G 26024845-GA-G P1_b4 ***
28142037-AT-A 25995890-AT-A P1_b4 9×T***
28102968-C-CT 25956821-C-CT P1_Y2 8×T***
28065155-CT-C 25919008-CT-C P1_Y2 15×T***
28052861-CT-C 25906714-CT-C P1_Y2 ***
28030763-T-TCTTG 25884616-T-TCTTG P1_Y2 ***
27996127-G-GA 25849980-G-GA P1_Y2 14×A***
28588050-CATC-T 26441903-CATC-T ***
27991626-GGA-G 25845479-GGA-G P1_Y2 13×GA***
27988706-AT-A 25842559-AT-A P1_Y2 ***
27978560-A-AT 25832413-A-AT P1_Y2 14×T***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAA 25825609-CACACACACACAAAG-AAAAAAAAAAAAAAA P1_Y2 ***
27971749-AAAAAC-A 25825602-AAAAAC-A P1_Y2 ***
27949379-C-CA 25803232-C-CA P1_Y2 13×A***
27909479-TA-T 25763332-TA-T P1_Y2 ***
27880454-CA-C 25734307-CA-C P1_Y2 ***
27873284-CTCTTTC-TTTTTTT 25727137-CTCTTTC-TTTTTTT P1_Y2 ***
27868124-CA-C 25721977-CA-C P1_Y2 13×A***
27866070-C-CT 25719923-C-CT P1_Y2 10×T***
27844536-GTTA-TTT 25698389-GTTA-TTT P1_Y2 ***
27844515-ATTTATTTC-TTTTTTTTT 25698368-ATTTATTTC-TTTTTTTTT P1_Y2 ***
27844492-ATA-TTT 25698345-ATA-TTT P1_Y2 ***
28406839-CAA-C 26260692-CAA-C P1_gr2 16×A***
28588302-TGA-CGG 26442155-TGA-CGG ***
58977578-TTGCAT-CTCCAC 56831431-TTGCAT-CTCCAC ***
58843055-CTTTGG-C 56747810-TCCAAA-T ***
58977571-AT-CA 56831424-AT-CA ***
58977556-TG-CA 56831409-TG-CA ***
58976348-CACAT-TCCAC 56830201-CACAT-TCCAC ***
58976137-CTCCAG-ATCCGT 56829990-CTCCAG-ATCCGT ***
58974241-AAATCAAT-CCCTCCAC 56828094-AAATCAAT-CCCTCCAC ***
58974223-TTCG-ATCC 56828076-TTCG-ATCC ***
58912846-GA-TC 56678024-TC-GA ***
58912831-TTGATG-T 56678034-GCATCA-G ***
58912818-GATG-CATT 56678050-CATC-AATG ***
58912765-ATG-TTC 56678104-CAT-GAA ***
58890988-TC-AT 56699882-GA-AT ***
58866021-C-CCCATTCCATTCCATT 56724789-C-CAATGGAATGGAATGG 12×CCATT***
58858972-GATTTTATTGCATTAGATTCTATTC-TGTGACACAAGCTGGAGTGCAGTAG 56731875-GAATAGAATCTAATGCAATAAAATC-CTACTGCACTCCAGCTTGTGTCACA ***
58858827-CA-C 56732042-GT-G ***
58831921-AA-TC 56758949-TT-GA ***
28802650-GGTGAAT-CGTGGAG 26656503-GGTGAAT-CGTGGAG ***
58820228-AATTCCTTTCCATTC-CTACCGTTCGATTT 56770629-GAATGGAAAGGAATT-AAATCGAACGGTAG ***
28802816-ATGGGT-GAGTAA 26656669-ATGGGT-GAGTAA ***
28819013-TAAG-GAAA 26672866-TAAG-GAAA ***
58819399-CTTG-ATTC 56771469-CAAG-GAAT ***
58819805-GTCGA-TTCGG 56771062-TCGAC-CCGAA ***
58820173-GAGTCCTTTCCAGTA-CTTTCCATTCGAGTG 56770684-TACTGGAAAGGACTC-CACTCGAATGGAAAG ***
58820199-AATCCCATCCAATCCCATCTACTCC-GTTCCATTTCTTTCCGTTCTGTACG 56770648-GGAGTAGATGGGATTGGATGGGATT-CGTACAGAACGGAAAGAAATGGAAC ***
58820505-CGTTCT-TATTCC 56770361-AGAACG-GGAATA ***
58831878-A-ATTGCC 56758988-T-TGCAAG ***
58820551-ATTCGTGTTGAT-GGTCCATTACAG 56770309-ATCAACACGAAT-CTGTAATGGACC ***
58820956-GAGTCC-CATTTG 56769910-GGACTC-CAAATG ***
58822019-GTCCATTAGTTTCGACTCCATTGCATTCGAGTGCATTCCATTCCGTGGCTGTC-ATTCAATTCCGTTCTATCCGATTCCATTCCATTCTATTCCTTTCCTTTCAATT 56768800-GACAGCCACGGAATGGAATGCACTCGAATGCAATGGAGTCGAAACTAATGGAC-AATTGAAAGGAAAGGAATAGAATGGAATGGAATCGGATAGAACGGAATTGAAT ***
58823679-TCCATTTGATGCCATC-T 56767172-CATGGGATGGCATCAA-C ***
58823840-TG-AT 56767030-CA-AT ***
58831196-TT-CC 56759674-AA-GG ***
22338124-GGGCT-TGGCA 20176238-GGGCT-TGGCA DYZ19 ***
22337983-TA-GT 20176097-TA-GT DYZ19 ***
58912803-G-T 56678068-C-A ***
13140111-AATCCATTAAACTCGC-CATTCAACTCCATTGA 10629597-AATCCATTAAACTCGC-CATTCAACTCCATTGA ***
13446403-CA-TG 11290727-CA-TG ***
13422404-AAGTT-TATAA 11266728-AAGTT-TATAA ***
13393449-A-ATT 11237773-A-ATT 12×T***
13275922-C-CA 11120246-C-CA ***
13203910-CGGCGATGATGACGGCATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-ATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT 11048234-CGGCGATGATGACGGCATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-ATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT ***
13194777-ATTGATA-CTCCATT 11039101-ATTGATA-CTCCATT ***
13143655-AACATCTCACTA-TGGATCAAACTT 10633141-AACATCTCACTA-TGGATCAAACTT ***
13143628-CATTGCAC-TATTCCAT 10633114-CATTGCAC-TATTCCAT ***
13143617-CC-AT 10633103-CC-AT ***
13143428-CATTTT-C 10632914-CATTTT-C ***
13140589-ACTCCAC-TTTGCAT 10630075-ACTCCAC-TTTGCAT ***
13140585-TTAA-CACC 10630071-TTAA-CACC ***
13140566-CCCT-TCCA 10630052-CCCT-TCCA ***
13140532-TC-GT 10630018-TC-GT ***
13120632-TA-T 10610118-TA-T 8×A***
13461135-TAG-CAA 11305459-TAG-CAA ***
10032525-GC-AA 10194916-GC-AA ***
10023660-GCCTATTTC-CCATCTCTG 10186051-GCCTATTTC-CCATCTCTG ***
10004786-TATATACACAG-CATAAAGCAT 10167177-TATATACACAG-CATAAAGCAT ***
9935902-CAAAGAG-ATAGGAC 10098293-CAAAGAG-ATAGGAC ***
9931363-GTT-G 10093754-GTT-G 9×T***
9930165-AGCGG-CGCGT 10092556-AGCGG-CGCGT ***
9745897-AG-CC 9908288-AG-CC ***
9745894-T-TC 9908285-T-TC ***
9666957-GA-G 9829348-GA-G IR3_Prx 10×A***
9634219-CT-C 9796610-CT-C IR3_Prx 9×T***
9631674-TGTGTCTGTGACATG-T 9794065-TGTGTCTGTGACATG-T IR3_Prx ***
9629451-CA-C 9791842-CA-C IR3_Prx 12×A***
9622506-CTTTA-TTTTT 9784897-CTTTA-TTTTT IR3_Prx ***
9620171-C-CA 9782562-C-CA IR3_Prx 11×A***
13447257-AATTT-CATTC 11291581-AATTT-CATTC ***
13461146-AAAGA-CAACT 11305470-AAAGA-CAACT ***
9602735-TTG-T 9765126-TTG-T IR3_Prx 8×TG***
13699416-GAAACGAATTC-TACACAAATGG 11543740-GAAACGAATTC-TACACAAATGG ***
13801228-AT-GG 11680522-AT-GG ***
13801012-TGCAATG-AGGAATA 11680306-TGCAATG-AGGAATA ***
13748577-TCNNN-GGAAC ***
13745775-TGTCA-CCTCG 11590099-TGTCA-CCTCG ***
13740761-GGA-CGG 11585085-GGA-CGG ***
13740632-GAACTC-CGAACG 11584956-GAACTC-CGAACG ***
13735044-CTGG-ATGA 11579368-CTGG-ATGA ***
13735026-GAACTC-CGAACG 11579350-GAACTC-CGAACG ***
13734989-GTGTAATTGAATGATATCGAAAGGAAGGGAA-ATGGAATGGATCAAAATGGATTTGAACAGAT 11579313-GTGTAATTGAATGATATCGAAAGGAAGGGAA-ATGGAATGGATCAAAATGGATTTGAACAGAT ***
13731874-AC-GT 11576198-AC-GT ***
13729845-CCATT-GTATA 11574169-CCATT-GTATA ***
13723314-ATGGAATGGAAAGGAGGC-CTCACATAGAACAGCCTT 11567638-ATGGAATGGAAAGGAGGC-CTCACATAGAACAGCCTT ***
13702191-GTG-CTC 11546515-GTG-CTC ***
13700766-GGCGAAA-ATGGAAT 11545090-GGCGAAA-ATGGAAT ***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA 11543717-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA ***
13461724-TTA-ATG 11306048-TTA-ATG ***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13681005-GA-CG 11525329-GA-CG ***
13544968-TTTGA-ATTGG 11389292-TTTGA-ATTGG ***
13488959-GCC-TCA 11333283-GCC-TCA ***
13485676-GTCAC-ATCAA 11330000-GTCAC-ATCAA ***
13484457-AT-CC 11328781-AT-CC ***
13480701-GCC-TCT 11325025-GCC-TCT ***
13472117-GCGCA-CCGCC 11316441-GCGCA-CCGCC ***
13472093-ACAG-GCAT 11316417-ACAG-GCAT ***
13469049-ATGTG-CTGTC 11313373-ATGTG-CTGTC ***
13467946-GG-AT 11312270-GG-AT ***
13467778-GGCAGAA-CGAATAT 11312102-GGCAGAA-CGAATAT ***
13466377-CT-GG 11310701-CT-GG ***
13466299-TGGTTGATCA-CTGATCCCTC 11310623-TGGTTGATCA-CTGATCCCTC ***
9605871-T-TA 9768262-T-TA IR3_Prx 16×A***
9591034-GA-G 9753425-GA-G IR3_Prx 12×A***
22315971-G-T 20154085-G-T DYZ19 ***
13488715-CA-GG 11333039-CA-GG ***
28017356-C-CA 25871209-C-CA P1_Y2 16×A***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
24290749-G-GCA 22144602-G-GCA P3_t1 20×CA***
10014645-C-CTAAT 10177036-C-CTAAT 4×TAAT***
24562514-AGT-A 22416367-AGT-A P3_t2 ***
20428495-AT-A 18266609-AT-A P5_Dst 15×T***
7032333-ATTTTTTT-A 7164292-ATTTTTTT-A 22×T***
16150948-TA-T 14039068-TA-T P8_Dst 22×A***
13488987-CAGGGT-TGGGGC 11333311-CAGGGT-TGGGGC ***
13488681-AGG-GGC 11333005-AGG-GGC ***
25542210-GCT-G 23396063-GCT-G P1_gr1 11×CT***
15832207-TC-T 13720327-TC-T ***
16165136-GGA-G 14053256-GGA-G P8_Dst 13×GA***
28588259-ATG-TTA 26442112-ATG-TTA ***
59022406-T-C 56876259-T-C ***
28033129-CA-C 25886982-CA-C P1_Y2 17×A***
59022405-A-C 56876258-A-C ***
58996999-A-C 56850852-A-C ***
58996146-G-T 56849999-G-T ***
58987992-C-G 56841845-C-G ***
58987988-A-T 56841841-A-T ***
58987979-T-A 56841832-T-A ***
58987966-T-C 56841819-T-C ***
58987939-G-C 56841792-G-C ***
58987919-G-A 56841772-G-A ***
58987918-T-C 56841771-T-C ***
58987902-C-G 56841755-C-G ***
58980812-A-C 56834665-A-C ***
58980811-C-A 56834664-C-A ***
58980806-T-A 56834659-T-A ***
9559580-C-CT 9721971-C-CT IR3_Prx 11×T***
13859887-ATCGAA-CTGGAG 11739181-ATCGAA-CTGGAG ***
9589965-GAC-G 9752356-GAC-G IR3_Prx ***
7235824-CTTTCTTG-TTTTTTTT 7367783-CTTTCTTG-TTTTTTTT ***
9556485-CT-C 9718876-CT-C IR3_Prx 9×T***
9539555-CT-C 9701946-CT-C IR3_Prx ***
9535155-A-AT 9697546-A-AT IR3_Prx 17×T***
9345055-CT-GG 9507446-CT-GG ***
9336652-AC-CT 9499043-AC-CT ***
9307402-GTGTGTG-TTGAGTT 9469793-GTGTGTG-TTGAGTT ***
9304429-CTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGG 9466820-CTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGG ***
8568465-GTTTTTTTT-G 8700424-GTTTTTTTT-G 22×T***
8555560-T-TTTGTTC 8687519-T-TTTGTTC ***
8422869-CAAAAA-C 8554828-CAAAAA-C 17×A******
7988099-CTTTT-C 8120058-CTTTT-C 14×T***
7470726-G-AA 7602685-G-AA IR1_L ***
7414304-AG-A 7546263-AG-A ***
7270276-CTTTTTTTT-C 7402235-CTTTTTTTT-C 25×T***
7165286-GTTGTTGTTG-TTTTTTTTTT 7297245-GTTGTTGTTG-TTTTTTTTTT ***
9577017-C-CAA 9739408-C-CAA IR3_Prx 15×A***
2861533-TCA-T 2993492-TCA-T ***
24754928-TA-T 22608781-TA-T P3_b2 15×A***
13405369-TG-T 11249693-TG-T ***
9753975-CT-C 9916366-CT-C 20×T***
27760220-G-GT 25614073-G-GT P1_Y2 14×T***
24618868-C-CT 22472721-C-CT P3_t2 12×T***
2806195-ATTTTT-A 2938154-ATTTTT-A 36×T***
4031513-CAA-C 4163472-CAA-C 16×A***
7100969-TT-G 7232928-TT-G ***
4973668-C-CAA 5105627-C-CAA 19×A***
5945467-CTTTTTT-C 6077426-CTTTTTT-C 25×T***
6134454-CTTGGGCAGGGAAGGC-GGGGGGGGGGGGGGGG 6266413-CTTGGGCAGGGAAGGC-GGGGGGGGGGGGGGGG ***
6149994-TATGTGGGTGTG-CACACACATATA 6281953-TATGTGGGTGTG-CACACACATATA IR3_Dst ***
6150007-GT-AC 6281966-GT-AC IR3_Dst ***
6323750-C-CA 6455709-C-CA IR3_Dst 12×A***
13801234-AAG-GAA 11680528-AAG-GAA ***
13804029-TG-CA 11683323-TG-CA ***
22337965-ACTTT-CCTTC 20176079-ACTTT-CCTTC DYZ19 ***
20231615-GG-A 18069729-GG-A P5_Dst ***
20587808-AAT-A 18425922-AAT-A P5_Dst 10×AT***
20500941-GGA-G 18339055-GGA-G P5_Dst ***
20497215-ACCCA-CCCCC 18335329-ACCCA-CCCCC P5_Dst ***
20440392-T-TTTGTTG 18278506-T-TTTGTTG P5_Dst 13×TTG***
20413787-TA-T 18251901-TA-T P5_Dst 12×A***
20391948-G-GA 18230062-G-GA P5_Dst 11×A***
20364225-CT-C 18202339-CT-C P5_Dst 11×T***
20348763-GT-G 18186877-GT-G P5_Dst 9×T***
20300694-C-CA 18138808-C-CA P5_Dst ***
20295499-C-CT 18133613-C-CT P5_Dst 11×T***
20291027-T-TA 18129141-T-TA P5_Dst 11×A***
20274242-CT-C 18112356-CT-C P5_Dst ***
20243015-GTTTGTTTT-TTTTTTTTA 18081129-GTTTGTTTT-TTTTTTTTA P5_Dst ***
20242175-TA-T 18080289-TA-T P5_Dst 8×A***
20230825-TCCC-ACCT 18068939-TCCC-ACCT P5_Dst ***
20655016-ATATATA-G 18493130-ATATATA-G P4_Prx ***
20230813-CAGACAGC-TAGATAGT 18068927-CAGACAGC-TAGATAGT P5_Dst ***
20230152-TAA-T 18068266-TAA-T P5_Dst 16×A***
20229254-G-GT 18067368-G-GT P5_Dst 15×T***
20221481-G-GA 18059595-G-GA P5_Dst 10×A***
20217548-CT-C 18055662-CT-C P5_Dst ***
20217433-GCCT-CCCC 18055547-GCCT-CCCC P5_Dst ***
20194619-AT-A 18032733-AT-A P5_Dst 8×T***
20130786-C-CA 18018906-C-CA P5_Dst 16×A***
20110561-G-GA 17998681-G-GA P5_Dst 20×A***
20110156-AT-A 17998276-AT-A P5_Dst ***
20087764-GAA-G 17975884-GAA-G P5_Dst 13×A***
20084142-TAGAG-T 17972262-TAGAG-T P5_Dst 13×AG***
19948161-CCCTCCCTCCCTCCCTCCCTC-T 17836281-CCCTCCCTCCCTCCCTCCCTC-T P5_Prx ***
19930469-GC-TT 17818589-GC-TT P5_Prx ***
20598479-TA-T 18436593-TA-T P5_Dst ***
20717039-C-AA 18555153-C-AA P4_Prx 35×A***
19829290-GTTTACTTTC-TTTTTTTTTT 17717410-GTTTACTTTC-TTTTTTTTTT P5_Prx ***
21170319-G-GTT 19008433-G-GTT 14×T***
22337788-ACCTC-TCCTT 20175902-ACCTC-TCCTT DYZ19 ***
22300832-AGG-GGT 20138946-AGG-GGT DYZ19 ***
22300778-GGC-AGT 20138892-GGC-AGT DYZ19 ***
22273575-TTACA-GTTAC 20111689-TTACA-GTTAC DYZ19 ***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
22269595-TTCG-ATTA 20107709-TTCG-ATTA DYZ19 ***
22247019-AGTC-TCTA 20085133-AGTC-TCTA DYZ19 ***
22245578-CATTTA-GCTTTG 20083692-CATTTA-GCTTTG DYZ19 ***
22245569-AGCTA-TGTTG 20083683-AGCTA-TGTTG DYZ19 ***
22244982-GTTATATCCAGAGTTTCTTC-CTGCAGCATCATTCTTGAAG 20083096-GTTATATCCAGAGTTTCTTC-CTGCAGCATCATTCTTGAAG DYZ19 ***
22234333-TAT-AC 20072447-TAT-AC DYZ19 ***
21894633-CAAAAA-C 19732747-CAAAAA-C 15×A***
21714802-T-AA 19552916-T-AA ***
21569953-GTC-G 19408067-GTC-G ***
21132667-GTCTACATTTCTGTG-TTTTTTTTTTTTTTT 18970781-GTCTACATTTCTGTG-TTTTTTTTTTTTTTT ***
20848244-A-AT 18686358-A-AT P4_Dst 19×T***
20951141-GAAAG-AAAAA 18789255-GAAAG-AAAAA P4_Dst ***
20868938-CAACATGTG-AAAAATATT 18707052-CAACATGTG-AAAAATATT P4_Dst ***
20914498-C-CAAA 18752612-C-CAAA P4_Dst 12×A***
20917254-CA-C 18755368-CA-C P4_Dst 14×A***
20949797-GGAAAG-AGGCAC 18787911-GGAAAG-AGGCAC P4_Dst ***
20949887-AAGC-CAGT 18788001-AAGC-CAGT P4_Dst ***
20949903-TCC-CCT 18788017-TCC-CCT P4_Dst ***
20951557-TTCA-T 18789671-TTCA-T P4_Dst ***
21030546-T-TA 18868660-T-TA P4_Dst 13×A***
20963889-T-TA 18802003-T-TA P4_Dst ***
20970352-C-CA 18808466-C-CA P4_Dst 12×A***
20989908-C-CT 18828022-C-CT P4_Dst 11×T***
21008949-TTTTG-T 18847063-TTTTG-T P4_Dst 4×TTTG***
21013084-A-AT 18851198-A-AT P4_Dst 14×T***
21022787-GA-G 18860901-GA-G P4_Dst 11×A***
19839643-G-AA 17727763-G-AA P5_Prx ***
19739351-A-ACAACAG 17627471-A-ACAACAG P5_Prx ***
13804146-CAATAGAA-GAATGGAC 11683440-CAATAGAA-GAATGGAC ***
13856627-TA-GG 11735921-TA-GG ***
14698482-CAACAACAAC-AAAAAAAAAA 12586548-CAACAACAAC-AAAAAAAAAA ***
13869556-TATGGACTG-AAAGGAAAC 11748850-TATGGACTG-AAAGGAAAC ***
13869517-CTCGAGT-TTGAAC 11748811-CTCGAGT-TTGAAC ***
13869501-CCCGGAG-ACTGGAA 11748795-CCCGGAG-ACTGGAA ***
13866899-TTAC-GGAA 11746193-TTAC-GGAA ***
13866202-ATAT-CTAC 11745496-ATAT-CTAC ***
13860567-ATGGT-CTGGA 11739861-ATGGT-CTGGA ***
13860553-TC-GG 11739847-TC-GG ***
13860446-CATC-AATG 11739740-CATC-AATG ***
13860431-CATCGAAA-AATGGAAT 11739725-CATCGAAA-AATGGAAT ***
13858425-GAATGGCATCAAATAT-CAAAGGAATAGAAAGG 11737719-GAATGGCATCAAATAT-CAAAGGAATAGAAAGG ***
13858399-GGATTCG-AGAAACA 11737693-GGATTCG-AGAAACA ***
13858287-TT-CA 11737581-TT-CA ***
13856777-AAAT-GAATGGAGG 11736071-AAAT-GAATGGAGG ***
13856621-TG-CA 11735915-TG-CA ***
15358788-G-AA 13246908-G-AA ***
13856428-AAATC-GAATG 11735722-AAATC-GAATG ***
13856382-CT-GG 11735676-CT-GG ***
13856296-TC-CG 11735590-TC-CG ***
13856266-GGGAA-TGGAT 11735560-GGGAA-TGGAT ***
24353314-A-C 22207167-A-C P3_t1 ***
13847060-AACTC-GAATG 11726354-AACTC-GAATG ***
13847028-TCGAAAAGAACGGGATA-CTGAATTGAATGGAACG 11726322-TCGAAAAGAACGGGATA-CTGAATTGAATGGAACG ***
13843713-A-AGGAATGGAATGGAAT 11723007-A-AGGAATGGAATGGAAT 10×GGAAT***
13839837-GG-AA 11719131-GG-AA ***
13833115-CGGATTCG-TGGAATCC 11712409-CGGATTCG-TGGAATCC ***
13809826-CTT-ATG 11689120-CTT-ATG ***
13809728-ATAAA-GGAAT 11689022-ATAAA-GGAAT ***
13809611-ATGGAATGA-GTTGTATGG 11688905-ATGGAATGA-GTTGTATGG ***
13809598-GCAATTGG-CCAATTGA 11688892-GCAATTGG-CCAATTGA ***
14867088-CTTTC-TTTTT 12755158-CTTTC-TTTTT ***
15410629-ATC-A 13298749-ATC-A ***
19727393-TA-CC 17615513-TA-CC P5_Prx ***
18398153-GTGTGTGTGTGT-ATATATACACAA 16286273-GTGTGTGTGTGT-ATATATACACAA P6_Gap ***
19727387-TG-CC 17615507-TG-CC P5_Prx ***
19726191-TA-T 17614311-TA-T P5_Prx 12×A***
19713183-CT-C 17601303-CT-C P5_Prx 17×T***
19693687-A-AT 17581807-A-AT P5_Prx 10×T***
19513143-CTTTTTT-C 17401263-CTTTTTT-C 20×T***
19187441-ATACAC-TTTTT 17075561-ATACAC-TTTTT ***
19126462-T-AAAAAAAAA 17014582-T-AAAAAAAAA ***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGT 16421255-CTTTGTTTCTTGC-TTTTTTTTTTTGT P6_Dst ***
18533107-CT-AA 16421227-CT-AA P6_Dst ***
18501374-A-AT 16389494-A-AT P6_Dst 10×T***
18490252-C-CT 16378372-C-CT P6_Dst 11×T***
18454903-T-TTCTC 16343023-T-TTCTC P6_Dst ***
18447620-AG-TTT 16335740-AG-TTT P6_Dst ***
18429196-C-CA 16317316-C-CA P6_Dst 17×A***
18371082-TTGCGG-CTGCAA 16259202-TTGCGG-CTGCAA P6_Prx ***
15832213-CTTC-TTTT 13720333-CTTC-TTTT ***
16250653-A-TT 14138773-A-TT ***
15928370-GC-T 13816490-GC-T ***
16099087-CTG-C 13987207-CTG-C P8_Prx 23×TG***
16150095-CTT-C 14038215-CTT-C P8_Dst 22×T***
16157692-CTTCAAAATAAAT-AAAAGAAAAGAAA 14045812-CTTCAAAATAAAT-AAAAGAAAAGAAA P8_Dst ***
16157793-ACTTTCCAATGACGTTCTTAGAGCAACTGACTAAGTCTTCTCATT-GGGTGTTGGACTTTGTTCTTGGGATCAGCTTGAACCTTTCAAGAC 14045913-ACTTTCCAATGACGTTCTTAGAGCAACTGACTAAGTCTTCTCATT-GGGTGTTGGACTTTGTTCTTGGGATCAGCTTGAACCTTTCAAGAC P8_Dst ***
16162095-CA-C 14050215-CA-C P8_Dst 19×A***
16301002-GAAAA-G 14189122-GAAAA-G 18×A***
18369645-TAC-AAA 16257765-TAC-AAA P6_Prx ***
16913422-CAAAAAAAAA-C 14801542-CAAAAAAAAA-C 21×A***
17713845-ATCTTC-TTTTT 15601965-ATCTTC-TTTTT ***
17994874-C-AA 15882994-C-AA P7_Prx 39×A***
18008640-CAGATC-TTTTTT 15896760-CAGATC-TTTTTT P7_Dst ***
18011005-C-CT 15899125-C-CT P7_Dst 20×T***
18325701-AT-A 16213821-AT-A P6_Prx 27×T***
24353317-A-C 22207170-A-C P3_t1 ***
9234261-T-C 9396652-T-C ***
24341755-T-G 22195608-T-G P3_t1 ***
24420879-A-ATT 22274732-A-ATT 43×T***
22245707-ACTC-CATT 20083821-ACTC-CATT DYZ19 ***
22360129-AGTT-GGA 20198243-AGTT-GGA DYZ19 ***
22502012-GGTG-AGTC 20340126-GGTG-AGTC DYZ19 ***
22568321-C-CTG 20406435-C-CTG ***
23801733-C-CAAAAAA 21639847-C-CAAAAAA 31×A***
24314080-TCTC-CCTCA 22167933-TCTC-CCTCA P3_t1 ***
25590627-TG-CA 23444480-TG-CA P1_gr1 ***
21402181-C-CTTTTTTT 19240295-C-CTTTTTTT 34×T***
25819576-ATTC-CTCT 23673429-ATTC-CTCT P1_b3 ***
25998253-GC-TT 23852106-GC-TT P1_Y1 ***
27422266-TG-AGCA 25276119-TG-AGCA P1_g3 ***
27483928-A-AT 25337781-A-AT P1_Y2 10×T***
27484015-ATC-GCT 25337868-ATC-GCT P1_Y2 ***
27581657-TGT-GAA 25435510-TGT-GAA P1_Y2 ***
27751236-CATTG-TATCA 25605089-CATTG-TATCA P1_Y2 ***
22236465-CCACC-ACAGT 20074579-CCACC-ACAGT DYZ19 ***
20252796-C-CAAAAAAAA 18090910-C-CAAAAAAAA P5_Dst 24×A***
27751270-GTC-ATT 25605123-GTC-ATT P1_Y2 ***
13556425-GTAG-CTAT 11400749-GTAG-CTAT ***
9700780-C-CAAATAA 9863171-C-CAAATAA IR3_Prx 23×A***
10013122-GTTT-TTGG 10175513-GTTT-TTGG ***
13122131-CT-TG 10611617-CT-TG ***
13140112-ATCCATTAAAC-A 10629598-ATCCATTAAAC-A ***
13484392-TGCCCTCTG-CGCACTCCT 11328716-TGCCCTCTG-CGCACTCCT ***
13488959-GCCCAG-TCGCCT 11333283-GCCCAG-TCGCCT ***
13488988-AGGGTAGCTCCACCTCG-GGGGCATCTGCACATCA 11333312-AGGGTAGCTCCACCTCG-GGGGCATCTGCACATCA ***
13716447-CGC-GGA 11560771-CGC-GGA ***
20226089-AAT-TGTTC 18064203-AAT-TGTTC P5_Dst ***
13923535-AA-TT 11802829-AA-TT ***
14698458-C-CAAAAAAAAAAA 12586524-C-CAAAAAAAAAAA 19×A***
16147493-AGAGAGAG-GGAGGGAGGGA 14035613-AGAGAGAG-GGAGGGAGGGA P8_Dst ***
16292546-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 14180666-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 48×T***
16301002-G-GAAAAAAA 14189122-G-GAAAAAAA 18×A***
17474936-TTTTTTTTTCTT-CTTTCTTTCCTTC 15363056-TTTTTTTTTCTT-CTTTCTTTCCTTC ***
19777758-TGT-AGA 17665878-TGT-AGA P5_Prx ***
27751261-CA-GT 25605114-CA-GT P1_Y2 ***
27751290-AG-CA 25605143-AG-CA P1_Y2 ***
9345037-AGGC-GGGG 9507428-AGGC-GGGG ***
58980531-A-T 56834384-A-T ***
13745573-T-A 11589897-T-A ***
13857929-T-C 11737223-T-C ***
13857956-G-A 11737250-G-A ***
13861574-G-A 11740868-G-A ***
13866892-A-G 11746186-A-G ***
13868849-T-A 11748143-T-A ***
58978014-CCTTTCCATTG-C 56831867-CCTTTCCATTG-C ***
10032441-A-G 10194832-A-G ***
13138577-T-C 10628063-T-C ***
10023478-C-T 10185869-C-T ***
28802553-T-G 26656406-T-G ***
7164509-T-G 7296468-T-G ***
28802556-A-G 26656409-A-G ***
58997004-A-T 56850857-A-T ***
58974236-C-T 56828089-C-T ***
13691816-C-G 11536140-C-G ***
13194849-C-G 11039173-C-G ***
13138574-C-T 10628060-C-T ***
27752131-CTCTG-TTCCA 25605984-CTCTG-TTCCA P1_Y2 ***
28500822-TTTG-GGAC 26354675-TTTG-GGAC ***
27752148-ATCCC-TTCCT 25606001-ATCCC-TTCCT P1_Y2 ***
27752314-TG-CA 25606167-TG-CA P1_Y2 ***
27752331-ATTG-TTCA 25606184-ATTG-TTCA P1_Y2 ***
28030783-CCTTC-TCTTT 25884636-CCTTC-TCTTT P1_Y2 ***
28253524-C-CAAAAA 26107377-C-CAAAAA P1_b4 ***
28491336-A-AAAACCCCCC 26345189-A-AAAACCCCCC ***
28491337-A-AAAAAACACCCCC 26345190-A-AAAAAACACCCCC ***
58819347-N-NC ***
13138571-A-C 10628057-A-C ***
58831380-AT-CC 56759490-AT-GG ***
58832622-GCAGTCTT-CCATTCAA 56758242-AAGACTGC-TTGAATGG ***
58842266-ATCCC-TTCCT 56748601-GGGAT-AGGAA ***
58847167-GTCTCTT-TTC 56743698-AAGAGAC-GAA ***
58848549-TGATGT-CCATTC 56742317-ACATCA-GAATGG ***
58911349-GAC-CAT 56679520-GTC-ATG ***
13138484-G-T 10627970-G-T ***
9403521-G-GTTTTTTTTTTTTTTTTTTTT 9565912-G-GTTTTTTTTTTTTTTTTTTTT 21×T***
8740664-G-GTTTTTTTT 8872623-G-GTTTTTTTT 10×T***
13866912-G-A 11746206-G-A ***
27752169-T-A 25606022-T-A P1_Y2 ***
27751254-G-C 25605107-G-C P1_Y2 ***
27751277-T-A 25605130-T-A P1_Y2 ***
27752143-C-T 25605996-C-T P1_Y2 ***
27752157-G-A 25606010-G-A P1_Y2 ***
27752162-G-A 25606015-G-A P1_Y2 ***
27752165-C-T 25606018-C-T P1_Y2 ***
27752168-T-C 25606021-T-C P1_Y2 ***
27752172-T-G 25606025-T-G P1_Y2 ***
27581652-T-G 25435505-T-G P1_Y2 ***
27752176-G-T 25606029-G-T P1_Y2 ***
27752272-G-T 25606125-G-T P1_Y2 ***
27752295-G-A 25606148-G-A P1_Y2 ***
27752347-A-G 25606200-A-G P1_Y2 ***
27866313-A-G 25720166-A-G P1_Y2 ***
27866323-A-T 25720176-A-T P1_Y2 ***
28013865-T-C 25867718-T-C P1_Y2 ***
27751230-T-C 25605083-T-C P1_Y2 ***
27508725-G-A 25362578-G-A P1_Y2 ***
28162263-T-C 26016116-T-C P1_b4 ***
26362246-C-T 24216099-C-T P1_Y1 ***
25588251-C-T 23442104-C-T P1_gr1 ***
25590618-T-C 23444471-T-C P1_gr1 ***
25819593-T-G 23673446-T-G P1_b3 ***
26208101-A-T 24061954-A-T P1_Y1 ***
26208103-A-T 24061956-A-T P1_Y1 ***
26214887-G-A 24068740-G-A P1_Y1 ***
26362237-G-A 24216090-G-A P1_Y1 ***
26374299-G-A 24228152-G-A P1_Y1 ***
27484022-G-T 25337875-G-T P1_Y2 ***
26374302-G-A 24228155-G-A P1_Y1 ***
26374306-T-G 24228159-T-G P1_Y1 ***
26427500-C-T 24281353-C-T P1_Y1 ***
27406364-C-T 25260217-C-T P1_g3 ***
27419693-T-A 25273546-T-A P1_g3 ***
27422259-C-T 25276112-C-T P1_g3 ***
27422275-A-G 25276128-A-G P1_g3 ***
28162257-A-G 26016110-A-G P1_b4 ***
28395793-G-A 26249646-G-A P1_gr2 ***
8740675-G-TTTTTTTTT 8872634-G-TTTTTTTTT 17×T***
58907403-T-A 56683468-A-T ***
58892080-G-A 56698791-C-T ***
58903580-A-T 56687291-T-A ***
58903597-T-C 56687274-A-G ***
58904226-C-A 56686645-G-T ***
58904246-A-C 56686625-T-G ***
58905732-A-G 56685139-T-C ***
58907225-C-G 56683646-G-C ***
58908592-C-T 56682279-G-A ***
58870123-T-C 56720748-A-G ***
58909842-A-G 56681029-T-C ***
58911339-A-G 56679532-T-C ***
10033141-AG-A 10195532-AG-A ***
2888870-CAAAAAAAAAAAAAAAAAA-C 3020829-CAAAAAAAAAAAAAAAAAA-C 32×A***
2957323-CT-C 3089282-CT-C 15×T***
4118470-TG-CA 4250429-TG-CA ***
5512875-CA-C 5644834-CA-C 22×A***
58882798-G-C 56708073-C-G ***
58866940-G-C 56723931-C-G ***
28491189-C-T 26345042-C-T ***
58842241-G-T 56748630-C-A ***
58827249-A-T 56763622-T-A ***
58828009-A-T 56762862-T-A ***
58830797-G-A 56760074-C-T ***
58832643-C-T 56758228-G-A ***
58832653-G-C 56758218-C-G ***
58842234-T-C 56748637-A-G ***
58842238-G-C 56748633-C-G ***
58842256-G-T 56748615-C-A ***
58863553-A-T 56727318-T-A ***
58847960-T-C 56742911-A-G ***
58856201-T-A 56734670-A-T ***
58859261-T-C 56731610-A-G ***
58859265-G-T 56731606-C-A ***
58863533-G-A 56727338-C-T ***
58863537-G-C 56727334-C-G ***
58863541-C-A 56727330-G-T ***
13691814-G-A 11536138-G-A ***
58987895-T-C 56841748-T-C ***
23838845-G-T 21676959-G-T ***
7242041-C-T 7374000-C-T ***
7217335-T-C 7349294-T-C ***
7217337-T-G 7349296-T-G ***
7217339-T-C 7349298-T-C ***
7217340-T-A 7349299-T-A ***
7217342-T-C 7349301-T-C ***
7217343-A-C 7349302-A-C ***
7489285-G-T 7621244-G-T IR1_L ***
7217333-A-G 7349292-A-G ***
7501232-T-G 7633191-T-G IR1_L ***
7535885-T-A 7667844-T-A ***
7535894-T-A 7667853-T-A ***
8172711-A-T 8304670-A-T ***
8181341-A-T 8313300-A-T ***
8288839-G-A 8420798-G-A ***
9127449-G-T 9289840-G-T ***
7217334-T-C 7349293-T-C ***
7217332-A-T 7349291-A-T ***
9215996-A-G 9378387-A-G ***
7217316-T-C 7349275-T-C ***
6179592-A-T 6311551-A-T IR3_Dst 22×T***
6250586-T-C 6382545-T-C IR3_Dst ***
6285676-C-A 6417635-C-A IR3_Dst ***
6305880-C-T 6437839-C-T IR3_Dst ***
6918506-G-C 7050465-G-C ***
7139141-T-A 7271100-T-A ***
7197239-C-A 7329198-C-A ***
7217318-A-G 7349277-A-G ***
7217331-A-G 7349290-A-G ***
7217322-A-T 7349281-A-T ***
7217323-T-G 7349282-T-G ***
7217324-T-G 7349283-T-G ***
7217326-T-G 7349285-T-G ***
7217327-T-G 7349286-T-G ***
7217329-A-G 7349288-A-G ***
7217330-A-T 7349289-A-T ***
9156688-T-C 9319079-T-C ***
9215999-C-G 9378390-C-G ***
6150007-G-A 6281966-G-A IR3_Dst ***
22309919-A-C 20148033-A-C DYZ19 ***
9234252-G-C 9396643-G-C ***
9234253-A-C 9396644-A-C ***
9234255-T-G 9396646-T-G ***
9234256-G-C 9396647-G-C ***
9234258-G-C 9396649-G-C ***
9234259-C-A 9396650-C-A ***
9234260-A-G 9396651-A-G ***
9234263-T-C 9396654-T-C ***
9234250-A-G 9396641-A-G ***
9234264-G-A 9396655-G-A ***
9234266-G-T 9396657-G-T ***
9234268-A-C 9396659-A-C ***
9234269-G-C 9396660-G-C ***
9234271-T-C 9396662-T-C ***
9234273-G-C 9396664-G-C ***
9234274-T-A 9396665-T-A ***
9234251-T-A 9396642-T-A ***
9234249-G-A 9396640-G-A ***
9216002-A-C 9378393-A-C ***
9234233-G-T 9396624-G-T ***
9216008-C-G 9378399-C-G ***
9216009-A-C 9378400-A-C ***
9216018-T-G 9378409-T-G ***
9223864-G-C 9386255-G-C ***
9234230-A-C 9396621-A-C ***
9234231-G-C 9396622-G-C ***
9234232-T-C 9396623-T-C ***
9234234-C-G 9396625-C-G ***
9234248-G-C 9396639-G-C ***
9234235-A-G 9396626-A-G ***
9234238-G-C 9396629-G-C ***
9234239-C-T 9396630-C-T ***
9234240-C-G 9396631-C-G ***
9234241-T-C 9396632-T-C ***
9234246-T-C 9396637-T-C ***
9234247-T-C 9396638-T-C ***
6150008-T-C 6281967-T-C IR3_Dst ***
6150005-G-A 6281964-G-A IR3_Dst ***
28808718-C-G 26662571-C-G ***
6135368-C-T 6267327-C-T ***
5261767-C-G 5393726-C-G ***
5669623-C-A 5801582-C-A ***
5785845-T-A 5917804-T-A ***
6134451-A-G 6266410-A-G ***
6135363-G-A 6267322-G-A ***
6135366-T-C 6267325-T-C ***
6135367-A-G 6267326-A-G ***
6135369-G-A 6267328-G-A ***
5261749-C-A 5393708-C-A ***
6135373-T-C 6267332-T-C ***
6135375-C-G 6267334-C-G ***
6135376-T-G 6267335-T-G ***
6145041-G-C 6277000-G-C IR3_Dst ***
6145042-C-G 6277001-C-G IR3_Dst ***
6145043-T-G 6277002-T-G IR3_Dst ***
6145045-C-G 6277004-C-G IR3_Dst ***
5261761-A-G 5393720-A-G ***
5261746-A-C 5393705-A-C ***
6145053-G-T 6277012-G-T IR3_Dst ***
13833434-A-T 11712728-A-T ***
13691815-G-T 11536139-G-T ***
9925222-T-A 10087613-T-A ***
58996150-A-T 56850003-A-T ***
14550735-G-A 12438936-G-A ZS814 ***
58996149-T-C 56850002-T-C ***
13833409-T-A 11712703-T-A ***
13691820-A-T 11536144-A-T ***
58987981-C-G 56841834-C-G ***
4951415-G-T 5083374-G-T ***
2649782-G-A 2781741-G-A ***
2980680-C-A 3112639-C-A ***
3622308-C-A 3754267-C-A ***
3994857-T-A 4126816-T-A ***
4138851-G-T 4270810-G-T ***
4144009-C-A 4275968-C-A ***
4179086-T-A 4311045-T-A ***
6145046-A-G 6277005-A-G IR3_Dst ***
6145054-A-G 6277013-A-G IR3_Dst ***
6150003-G-A 6281962-G-A IR3_Dst ***
6145105-C-G 6277064-C-G IR3_Dst ***
6145092-T-A 6277051-T-A IR3_Dst ***
6145093-A-C 6277052-A-C IR3_Dst ***
6145094-G-A 6277053-G-A IR3_Dst ***
6145096-A-C 6277055-A-C IR3_Dst ***
6145099-A-C 6277058-A-C IR3_Dst ***
6145100-T-A 6277059-T-A IR3_Dst ***
6145103-T-G 6277062-T-G IR3_Dst ***
6145106-C-A 6277065-C-A IR3_Dst ***
6145090-A-C 6277049-A-C IR3_Dst ***
6149994-T-C 6281953-T-C IR3_Dst ***
6149996-T-C 6281955-T-C IR3_Dst ***
6149997-G-A 6281956-G-A IR3_Dst ***
6149998-T-C 6281957-T-C IR3_Dst ***
6149999-G-A 6281958-G-A IR3_Dst ***
6150000-G-C 6281959-G-C IR3_Dst ***
6150001-G-A 6281960-G-A IR3_Dst ***
6145091-T-A 6277050-T-A IR3_Dst ***
6145088-C-A 6277047-C-A IR3_Dst ***
6145055-G-C 6277014-G-C IR3_Dst ***
6145069-A-C 6277028-A-C IR3_Dst ***
6145057-A-C 6277016-A-C IR3_Dst ***
6145059-C-A 6277018-C-A IR3_Dst ***
6145060-C-T 6277019-C-T IR3_Dst ***
6145062-A-T 6277021-A-T IR3_Dst ***
6145063-T-C 6277022-T-C IR3_Dst ***
6145064-G-A 6277023-G-A IR3_Dst ***
6145066-G-C 6277025-G-C IR3_Dst ***
6145070-G-A 6277029-G-A IR3_Dst ***
6145087-A-C 6277046-A-C IR3_Dst ***
6145071-G-A 6277030-G-A IR3_Dst ***
6145072-T-C 6277031-T-C IR3_Dst ***
6145073-G-A 6277032-G-A IR3_Dst ***
6145075-A-C 6277034-A-C IR3_Dst ***
6145076-T-A 6277035-T-A IR3_Dst ***
6145078-G-C 6277037-G-C IR3_Dst ***
6145084-A-C 6277043-A-C IR3_Dst ***
24047841-A-C 21901694-A-C ***
22498507-T-A 20336621-T-A DYZ19 ***
9234278-C-G 9396669-C-G ***
28253574-G-A 26107427-G-A P1_b4 ***
20230681-A-G 18068795-A-G P5_Dst ***
20886818-T-A 18724932-T-A P4_Dst ***
25312613-T-A 23166466-T-A P2_r1 ***
26902340-G-A 24756193-G-A P1_r3 ***
28253570-T-A 26107423-T-A P1_b4 ***
28253572-G-A 26107425-G-A P1_b4 ***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
13275918-C-T 11120242-C-T ***
27861040-GT-G 25714893-GT-G P1_Y2 17×T***
27644230-C-CA 25498083-C-CA P1_Y2 12×A***
20078758-C-CA 17966878-C-CA P5_Dst 16×A***
25273788-AT-A 23127641-AT-A P2_r1 21×T***
6308050-GCACA-G 6440009-GCACA-G IR3_Dst 9×CA***
25662111-TA-T 23515964-TA-T P1_b3 14×A***
9529142-CT-C 9691533-CT-C IR3_Prx 15×T***
16148183-C-T 14036303-C-T P8_Dst 27×T***
13203963-T-A 11048287-T-A ***
13801053-TGGATAGAACGG-GGAATGGAGATT 11680347-TGGATAGAACGG-GGAATGGAGATT ***
13203974-C-G 11048298-C-G ***
22232196-T-A 20070310-T-A DYZ19 ***
22265856-G-T 20103970-G-T DYZ19 ***
58914180-T-G 56676691-A-C ***
22232055-ACAC-GCAT 20070169-ACAC-GCAT DYZ19 ***
13203979-C-T 11048303-C-T ***
13203975-C-A 11048299-C-A ***
13203973-C-T 11048297-C-T ***
13484985-G-A 11329309-G-A ***
13203960-T-A 11048284-T-A ***
7483663-T-G 7615622-T-G IR1_L ***
9215993-A-G 9378384-A-G ***
9304875-A-G 9467266-A-G ***
9325208-C-G 9487599-C-G ***
13140109-C-T 10629595-C-T ***
13203958-C-T 11048282-C-T ***
13203959-A-G 11048283-A-G ***
13801031-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA 11680325-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA ***
16040802-CTTTTT-C 13928922-CTTTTT-C 16×T***
25207887-G-A 23061740-G-A P2_r1 ***
25417422-CT-C 23271275-CT-C P2_r2 16×T***
24830466-CAACAAC-AAAAAAA 22684319-CAACAAC-AAAAAAA P3_b2 ***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
25289249-GA-G 23143102-GA-G P2_r1 ***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
25301411-GA-G 23155264-GA-G P2_r1 ***
25412653-CT-C 23266506-CT-C P2_r2 16×T***
25415037-C-CT 23268890-C-CT P2_r2 17×T***
25422190-CT-C 23276043-CT-C P2_r2 16×T***
24796652-GT-G 22650505-GT-G P3_b2 8×T***
25429198-CT-C 23283051-CT-C P2_r2 13×T***
25662890-CA-C 23516743-CA-C P1_b3 15×A***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25717471-CA-C 23571324-CA-C P1_b3 17×A***
25766541-C-CA 23620394-C-CA P1_b3 16×A***
26117889-TAAC-AAAA 23971742-TAAC-AAAA P1_Y1 ***
26990934-CT-C 24844787-CT-C P1_r4 17×T***
24826348-CT-C 22680201-CT-C P3_b2 14×T***
24771003-CT-C 22624856-CT-C P3_b2 17×T***
18984946-CTTTC-TTTTT 16873066-CTTTC-TTTTT ***
20347544-ATTAT-A 18185658-ATTAT-A P5_Dst 5×TTAT***
20129006-CA-C 18017126-CA-C P5_Dst 11×A***
20197205-G-GA 18035319-G-GA P5_Dst 14×A***
20213749-ATT-A 18051863-ATT-A P5_Dst 14×T***
20230667-TTT-CTG 18068781-TTT-CTG P5_Dst ***
20230695-GTATG-CTATA 18068809-GTATG-CTATA P5_Dst ***
20230740-AAT-GAC 18068854-AAT-GAC P5_Dst ***
20255094-TA-T 18093208-TA-T P5_Dst 20×A***
20478953-C-CA 18317067-C-CA P5_Dst 15×A***
24739651-CT-C 22593504-CT-C P3_b2 13×T***
20993598-CA-C 18831712-CA-C P4_Dst 17×A***
22256872-ATGAAGC-TGTTATG 20094986-ATGAAGC-TGTTATG DYZ19 ***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
24035198-T-TA 21889051-T-TA 14×A***
24096349-CA-C 21950202-CA-C P3_b1 16×A***
24295863-CT-C 22149716-CT-C P3_t1 17×T***
24336793-C-TT 22190646-C-TT P3_t1 20×T***
22232192-G-T 20070306-G-T DYZ19 ***
13801118-G-A 11680412-G-A ***
27035480-CT-C 24889333-CT-C P1_r4 16×T***
24033715-GTTTA-G 21887568-GTTTA-G 4×TTTA***
13803178-G-A 11682472-G-A ***
13817643-A-C 11696937-A-C ***
20196323-C-CA 18034437-C-CA P5_Dst 10×A***
13447668-G-GCATTCCATTC 11291992-G-GCATTCCATTC 4×CATTC***
13447687-T-A 11292011-T-A ***
13804706-T-G 11684000-T-G ***
16108594-T-C 13996714-T-C P8_Prx ***
20230710-T-G 18068824-T-G P5_Dst ***
13735162-A-G 11579486-A-G 4×AATGG***
13723348-T-A 11567672-T-A ***
13723350-A-T 11567674-A-T ***
13469059-G-T 11313383-G-T ***
13139533-T-C 10629019-T-C ***
27815070-CT-C 25668923-CT-C P1_Y2 10×T***
26953179-G-A 24807032-G-A P1_r3 ***
13479211-G-C 11323535-G-C ***
13140580-C-T 10630066-C-T ***
13850311-G-A 11729605-G-A ***
25207883-G-A 23061736-G-A P2_r1 ***
13465331-A-G 11309655-A-G ***
13833416-C-G 11712710-C-G ***
22256898-T-G 20095012-T-G DYZ19 ***
20045274-AAAAG-A 17933394-AAAAG-A P5_Prx 14×AAAG***
28132475-C-CT 25986328-C-CT P1_b4 15×T***
13866859-C-G,T 11746153-C-G,T ***
13869985-A-G 11749279-A-G ***
13870003-C-A 11749297-C-A ***
58819393-C-T 56771478-G-A ***
13847069-T-G 11726363-T-G ***
22498241-A-T 20336355-A-T DYZ19 ***
28253529-G-A 26107382-G-A P1_b4 ***
13839918-A-G 11719212-A-G ***
20214463-C-CA 18052577-C-CA P5_Dst 10×A***
24669478-CT-C 22523331-CT-C P3_b2 10×T***
28142885-A-AT 25996738-A-AT P1_b4 11×T***
58858969-G-C 56731902-C-G ***
24038488-T-TAC 21892341-T-TAC 24×AC***
27936764-CA-C 25790617-CA-C P1_Y2 15×A***
25458706-G-GA 23312559-G-GA P2_r2 9×A***
22293405-T-C 20131519-T-C DYZ19 ***
22802904-G-T 20641018-G-T ***
22802929-G-T 20641043-G-T ***
20872237-A-AT 18710351-A-AT P4_Dst 11×T***
27792527-AT-A 25646380-AT-A P1_Y2 10×T***
13140106-T-C 10629592-T-C ***
22250200-A-T 20088314-A-T DYZ19 ***
22490753-G-T 20328867-G-T DYZ19 ******
13868428-A-C 11747722-A-C ***
20995546-TCTTTC-T 18833660-TCTTTC-T P4_Dst 11×CTTTC***
13868431-G-A 11747725-G-A ***
13868435-G-A 11747729-G-A ***
58820540-T-C 56770331-A-G ***
25657077-A-AT 23510930-A-AT P1_b3 12×T***
13866925-A-G 11746219-A-G ***
24060374-GT-G 21914227-GT-G P3_b1 ***
13748541-A-T 11592865-A-T ***
28027982-A-AT 25881835-A-AT P1_Y2 17×T***
28802531-G-A 26656384-G-A ***
13203980-T-A 11048304-T-A ***
9745931-T-C 9908322-T-C ***
20442453-G-GA 18280567-G-GA P5_Dst 11×A***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
28214049-C-CT 26067902-C-CT P1_b4 14×T***
25207886-T-A 23061739-T-A P2_r1 ***
25364735-A-AT 23218588-A-AT P2_r2 9×T***
9745927-A-C 9908318-A-C ***
9745928-G-C 9908319-G-C ***
13812792-A-G 11692086-A-G ***
20902303-GA-G 18740417-GA-G P4_Dst 14×A***
13866923-A-T 11746217-A-T ***
22498176-G-T 20336290-G-T DYZ19 ***
13804711-A-C 11684005-A-C ***
27778164-C-CT 25632017-C-CT P1_Y2 12×T***
20416397-AT-A 18254511-AT-A P5_Dst 15×T***
24629530-C-CT 22483383-C-CT P3_t2 11×T***
16108635-A-C 13996755-A-C P8_Prx ***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
27149714-TA-T 25003567-TA-T P1_g3 16×A***
22366818-C-T 20204932-C-T DYZ19 ***
13697692-C-G 11542016-C-G ***
13115446-G-C 10604932-G-C ***
13122125-A-G 10611611-A-G ***
13487475-G-T 11331799-G-T ***
13530684-A-T 11375008-A-T ***
13636066-T-C 11480390-T-C ***
13697677-G-C 11542001-G-C ***
13748472-G-C 11592796-G-C ***
13115391-G-C 10604877-G-C ***
13923545-A-C 11802839-A-C ***
16129437-T-C 14017557-T-C P8_Prx ***
16351738-G-A 14239858-G-A ***
17474961-G-A 15363081-G-A ***
17543794-T-A 15431914-T-A ***
17633682-C-A 15521802-C-A ***
18331568-C-T 16219688-C-T P6_Prx ***
13115403-A-T 10604889-A-T ***
13110043-G-T 10599529-G-T ***
18459161-G-A 16347281-G-A P6_Dst ***
3312978-T-G 3444937-T-G ***
13431028-A-T 11275352-A-T ***
13556416-C-A 11400740-C-A ***
13416424-G-C 11260748-G-C ***
24023731-A-G 21877584-A-G ***
3321010-A-G 3452969-A-G ***
27752341-T-C 25606194-T-C P1_Y2 ***
22354781-G-T 20192895-G-T DYZ19 ***
4118471-G-A 4250430-G-A ***
13109962-A-T 10599448-A-T ***
4976819-G-A 5108778-G-A ***
5477704-G-C 5609663-G-C ***
6247429-C-A 6379388-C-A IR3_Dst ***
7026510-G-C 7158469-G-C ***
9571096-C-A 9733487-C-A IR3_Prx ***
9983966-G-A 10146357-G-A ***
13109790-G-A 10599276-G-A ***
18331581-C-T 16219701-C-T P6_Prx ***
18459166-T-C 16347286-T-C P6_Dst ***
13399807-G-A 11244131-G-A ***
22263783-T-C 20101897-T-C DYZ19 ***
20958441-T-G 18796555-T-G P4_Dst ***
21013240-T-C 18851354-T-C P4_Dst ***
21013243-C-T 18851357-C-T P4_Dst ***
21028666-A-G 18866780-A-G P4_Dst ***
21477779-A-G 19315893-A-G ***
22226576-A-C 20064690-A-C DYZ19 ***
22248600-T-C 20086714-T-C DYZ19 ***
22336093-C-A 20174207-C-A DYZ19 ***
20956086-G-T 18794200-G-T P4_Dst ***
22336099-T-A 20174213-T-A DYZ19 ***
22343307-A-T 20181421-A-T DYZ19 ***
22354830-T-G 20192944-T-G DYZ19 ***
22354838-G-T 20192952-G-T DYZ19 ***
22354854-T-G 20192968-T-G DYZ19 ***
22364698-A-C 20202812-A-C DYZ19 ***
22364710-C-G 20202824-C-G DYZ19 ***
20956088-A-T 18794202-A-T P4_Dst ***
20956082-T-C 18794196-T-C P4_Dst ***
19746899-G-A 17635019-G-A P5_Prx ***
20226094-G-C 18064208-G-C P5_Dst ***
19754989-A-C 17643109-A-C P5_Prx ***
19759589-T-C 17647709-T-C P5_Prx ***
19777746-T-C 17665866-T-C P5_Prx ***
19777749-T-C 17665869-T-C P5_Prx ***
19777758-T-A 17665878-T-A P5_Prx ***
19777760-T-A 17665880-T-A P5_Prx ***
19810012-T-A 17698132-T-A P5_Prx ***
20228022-C-A 18066136-C-A P5_Dst ***
20956073-G-A 18794187-G-A P4_Dst ***
20248995-C-T 18087109-C-T P5_Dst ***
20248997-A-G 18087111-A-G P5_Dst ***
20248998-T-G 18087112-T-G P5_Dst ***
20462541-G-T 18300655-G-T P5_Dst ***
20464352-A-G 18302466-A-G P5_Dst ***
20746996-T-C 18585110-T-C P4_Prx ***
20950309-C-T 18788423-C-T P4_Dst ***
13431018-A-G 11275342-A-G ***
13241659-T-C 11085983-T-C ***
27427815-GA-G 25281668-GA-G P1_g3 14×A***
13474811-A-T 11319135-A-T ***
20645841-TTC-T 18483955-TTC-T P4_Prx ***
22498283-C-G 20336397-C-G DYZ19 ***
58980802-T-C 56834655-T-C ***
2795555-ATTTG-TTTT 2927514-ATTTG-TTTT ***
25207874-G-AAA 23061727-G-AAA P2_r1 ***
13485114-T-G 11329438-T-G ***
13474808-T-A 11319132-T-A ***
27585912-G-T 25439765-G-T P1_Y2 ***
22337817-AG-GT 20175931-AG-GT DYZ19 ***
22422828-TT-CA 20260942-TT-CA DYZ19 ***
13140069-CACTCGAGTGCGTGTG-C 10629555-CACTCGAGTGCGTGTG-C ***
58908515-A-C 56682356-T-G ***
58913090-T-G 56677781-A-C ***
22248578-CT-C 20086692-CT-C DYZ19 ***
13876452-G-A 11755746-G-A ***
20501022-T-G 18339136-T-G P5_Dst ***
18378958-AC-A 16267078-AC-A P6_Prx ***
58848420-A-C 56742451-T-G ***
3205858-C-CAAAAAAA 3337817-C-CAAAAAAA 15×A***
19646223-ACTATG-TCCATC 17534343-ACTATG-TCCATC P5_Prx ***
27780449-C-CA 25634302-C-CA P1_Y2 18×A***
27889296-AAT-A 25743149-AAT-A P1_Y2 ***
28008591-C-CA 25862444-C-CA P1_Y2 11×A***
28802831-ATTGAG-GTGGAC 26656684-ATTGAG-GTGGAC ***
58983182-CTAC-GCAT 56837035-CTAC-GCAT ***
58985514-GATCACC-TATCTCG 56839367-GATCACC-TATCTCG ***
22309415-A-C 20147529-A-C DYZ19 ***
22367219-C-G 20205333-C-G DYZ19 ***
22355122-T-G 20193236-T-G DYZ19 ***
22127975-C-CTTTTTT 19966089-C-CTTTTTT 20×T***
13122138-C-G 10611624-C-G ***
22481786-A-T 20319900-A-T DYZ19 ***
24314070-G-A 22167923-G-A P3_t1 ***
58820437-A-C 56770434-T-G ***
18447621-G-GTTTTTTTTTTTT 16335741-G-GTTTTTTTTTTTT P6_Dst 18×T***
22355082-G-C 20193196-G-C DYZ19 ***
22232063-AAGTGCTGT-CATTTCTGA 20070177-AAGTGCTGT-CATTTCTGA DYZ19 ***
9962207-A-T 10124598-A-T ***
13740650-CTGG-ATGA 11584974-CTGG-ATGA ***
58851821-C-T 56739050-G-A ***
22367180-A-T 20205294-A-T DYZ19 ***
22421427-G-C 20259541-G-C DYZ19 ***
22802905-G-T 20641019-G-T ***
58889841-T-C 56701030-A-G ***
13485341-ACAAG-TCAATC 11329665-ACAAG-TCAATC ***
13398262-G-T 11242586-G-T ***
13398283-C-A 11242607-C-A ***
58863586-T-C 56727285-A-G ***
58859215-AG-TC 56731655-CT-GA ***
13437785-A-T 11282109-A-T ***
13856470-C-A 11735764-C-A FGC73621 ***
58866931-T-A 56723940-A-T ***
58866939-C-T 56723932-G-A ***
58907234-A-C 56683637-T-G ***
6247511-A-G 6379470-A-G IR3_Dst ***
22354749-G-T 20192863-G-T DYZ19 ***
9936852-A-C 10099243-A-C ***
58842299-CAATAG-C 56748565-ATCTAT-A ***
15912055-C-T 13800175-C-T M12014 21×T***
58894609-C-G 56696262-G-C ***
22260679-G-C 20098793-G-C DYZ19 ***
28808738-G-A 26662591-G-A ***
27751301-C-G 25605154-C-G P1_Y2 ***
22223298-CTTC-ATTT 20061412-CTTC-ATTT DYZ19 ***
13838038-C-A 11717332-C-A ***
58867486-TATTTTATTCCATGCC-T 56723365-CAAATGGCATGGAATA-C ***
13876403-T-C 11755697-T-C ***
13556376-G-C 11400700-G-C ***
58842288-ACAG-CCAT 56748580-CTGT-ATGG ***
22355162-T-G 20193276-T-G DYZ19 ***
13725096-GT-TA 11569420-GT-TA ***
22342821-TT-GG 20180935-TT-GG DYZ19 ***
16108634-A-T 13996754-A-T P8_Prx ***
13734088-C-A 11578412-C-A ***
58909939-G-A 56680932-C-T ***
58819351-N-NTT ***
9234275-G-C 9396666-G-C ***
9234280-C-A 9396671-C-A ***
24216307-G-T 22070160-G-T P3_b1 ***
19730970-T-C 17619090-T-C P5_Prx ***
19682090-T-A 17570210-T-A P5_Prx ***
19693569-C-A 17581689-C-A P5_Prx ***
19709815-G-T 17597935-G-T P5_Prx ***
19727375-T-C 17615495-T-C P5_Prx ***
19727376-A-C 17615496-A-C P5_Prx ***
19727382-A-C 17615502-A-C P5_Prx ***
19731007-A-C 17619127-A-C P5_Prx ***
19189522-A-C 17077642-A-C ***
19758694-C-A 17646814-C-A P5_Prx ***
19930451-G-T 17818571-G-T P5_Prx ***
19930452-C-T 17818572-C-T P5_Prx ***
19930462-C-T 17818582-C-T P5_Prx ***
19930466-C-T 17818586-C-T P5_Prx ***
19938933-G-A 17827053-G-A P5_Prx ***
19943085-T-G 17831205-T-G P5_Prx ***
19189524-T-C 17077644-T-C ***
19187583-C-T 17075703-C-T ***
20025443-C-T 17913563-C-T P5_Prx ***
18492523-C-T 16380643-C-T P6_Dst ***
18369620-G-A 16257740-G-A P6_Prx ***
18369668-T-G 16257788-T-G P6_Prx ***
18369716-T-A 16257836-T-A P6_Prx ***
18369734-C-G 16257854-C-G P6_Prx ***
18430054-T-A 16318174-T-A P6_Dst ***
18443528-C-T 16331648-C-T P6_Dst ***
18466985-C-A 16355105-C-A P6_Dst ***
18520375-G-T 16408495-G-T P6_Dst ***
19187577-C-T 17075697-C-T ***
18527814-G-T 16415934-G-T P6_Dst ***
18533120-C-A 16421240-C-A P6_Dst ***
18533123-A-T 16421243-A-T P6_Dst ***
18789597-G-A 16677717-G-A ***
19100499-T-C 16988619-T-C ***
19187525-C-T 17075645-C-T ***
19187534-C-T 17075654-C-T ***
20025441-C-T 17913561-C-T P5_Prx ***
20025454-T-C 17913574-T-C P5_Prx ***
18015934-A-T 15904054-A-T P7_Dst ***
20199979-G-A 18038093-G-A P5_Dst ***
20199950-A-T 18038064-A-T P5_Dst ***
20199958-C-T 18038072-C-T P5_Dst ***
20199968-G-A 18038082-G-A P5_Dst ***
20199972-T-C 18038086-T-C P5_Dst ***
20199974-C-A 18038088-C-A P5_Dst ***
20199975-A-T 18038089-A-T P5_Dst ***
20199976-T-A 18038090-T-A P5_Dst ***
20199991-T-C 18038105-T-C P5_Dst ***
20198587-T-G 18036701-T-G P5_Dst ***
20199992-C-T 18038106-C-T P5_Dst ***
20199993-T-C 18038107-T-C P5_Dst ***
20199994-C-A 18038108-C-A P5_Dst ***
20199996-T-A 18038110-T-A P5_Dst ***
20201331-G-T 18039445-G-T P5_Dst ***
20213623-T-A 18051737-T-A P5_Dst ***
20214435-C-T 18052549-C-T P5_Dst ***
20199946-T-A 18038060-T-A P5_Dst ***
20197222-T-C 18035336-T-C P5_Dst ***
20025459-C-T 17913579-C-T P5_Prx ***
20062538-G-T 17950658-G-T P5_Prx ***
20025462-T-C 17913582-T-C P5_Prx ***
20025464-T-C 17913584-T-C P5_Prx ***
20025475-C-T 17913595-C-T P5_Prx ***
20045200-C-A 17933320-C-A P5_Prx ***
20057778-A-G 17945898-A-G P5_Prx ***
20057782-T-C 17945902-T-C P5_Prx ***
20062536-C-T 17950656-C-T P5_Prx ***
20062576-G-T 17950696-G-T P5_Prx ***
20134418-C-T 18022538-C-T P5_Dst ***
20104118-A-G 17992238-A-G P5_Dst ***
20110583-G-A 17998703-G-A P5_Dst ***
20110584-C-A 17998704-C-A P5_Dst ***
20110585-G-A 17998705-G-A P5_Dst ***
20110586-T-A 17998706-T-A P5_Dst ***
20110587-T-A 17998707-T-A P5_Dst ***
20110588-T-A 17998708-T-A P5_Dst ***
18316557-G-A 16204677-G-A P6_Prx ***
18008809-C-T 15896929-C-T P7_Dst ***
20230788-T-C 18068902-T-C P5_Dst ***
16113327-A-T 14001447-A-T P8_Prx ***
16108798-G-C 13996918-G-C P8_Prx ***
16113310-C-G 14001430-C-G P8_Prx ***
16113312-C-G 14001432-C-G P8_Prx ***
16113318-T-C 14001438-T-C P8_Prx ***
16113320-C-G 14001440-C-G P8_Prx ***
16113321-A-C 14001441-A-C P8_Prx ***
16113324-C-A 14001444-C-A P8_Prx ***
16148097-C-A 14036217-C-A P8_Dst ***
16108674-G-A 13996794-G-A P8_Prx ***
16165106-G-A 14053226-G-A P8_Dst ***
16305850-G-A 14193970-G-A ***
16583335-A-T 14471455-A-T ***
16583342-G-A 14471462-G-A ***
16583344-C-G 14471464-C-G ***
16834746-C-A 14722866-C-A 45×A***
17090871-T-G 14978991-T-G ***
16108797-A-T 13996917-A-T P8_Prx ***
16108673-T-C 13996793-T-C P8_Prx ***
17994731-T-A 15882851-T-A P7_Prx ***
16108654-A-T 13996774-A-T P8_Prx ***
16108632-A-G 13996752-A-G P8_Prx ***
16108636-A-T 13996756-A-T P8_Prx ***
16108637-A-T 13996757-A-T P8_Prx ***
16108640-C-A 13996760-C-A P8_Prx ***
16108641-C-A 13996761-C-A P8_Prx ***
16108645-G-T 13996765-G-T P8_Prx ***
16108651-A-T 13996771-A-T P8_Prx ***
16108655-T-C 13996775-T-C P8_Prx ***
16108672-T-A 13996792-T-A P8_Prx ***
16108656-G-C 13996776-G-C P8_Prx ***
16108657-A-C 13996777-A-C P8_Prx ***
16108658-G-A 13996778-G-A P8_Prx ***
16108660-A-G 13996780-A-G P8_Prx ***
16108661-G-A 13996781-G-A P8_Prx ***
16108670-A-C 13996790-A-C P8_Prx ***
16108671-G-A 13996791-G-A P8_Prx ***
17622770-C-A 15510890-C-A ***
17994744-T-A 15882864-T-A P7_Prx ***
18008803-C-T 15896923-C-T P7_Dst ***
18008786-A-T 15896906-A-T P7_Dst ***
18008767-G-T 15896887-G-T P7_Dst ***
18008773-C-T 15896893-C-T P7_Dst ***
18008774-C-T 15896894-C-T P7_Dst ***
18008777-C-T 15896897-C-T P7_Dst ***
18008780-G-T 15896900-G-T P7_Dst ***
18008781-G-T 15896901-G-T P7_Dst ***
18008782-G-T 15896902-G-T P7_Dst ***
18008787-C-T 15896907-C-T P7_Dst ***
18008765-A-T 15896885-A-T P7_Dst ***
18008788-G-T 15896908-G-T P7_Dst ***
18008789-C-T 15896909-C-T P7_Dst ***
18008791-A-T 15896911-A-T P7_Dst ***
18008794-C-T 15896914-C-T P7_Dst ***
18008796-C-T 15896916-C-T P7_Dst ***
18008797-C-T 15896917-C-T P7_Dst ***
18008799-G-T 15896919-G-T P7_Dst ***
18008766-G-T 15896886-G-T P7_Dst ***
18008764-C-T 15896884-C-T P7_Dst ***
17994748-G-A 15882868-G-A P7_Prx ***
18008740-C-T 15896860-C-T P7_Dst ***
17994752-C-A 15882872-C-A P7_Prx ***
17994753-T-A 15882873-T-A P7_Prx ***
17994793-G-A 15882913-G-A P7_Prx ***
17994794-C-A 15882914-C-A P7_Prx ***
17994919-G-A 15883039-G-A P7_Prx ***
18008632-C-T 15896752-C-T P7_Dst ***
18008739-G-T 15896859-G-T P7_Dst ***
18008744-G-T 15896864-G-T P7_Dst ***
18008759-C-T 15896879-C-T P7_Dst ***
18008745-G-T 15896865-G-T P7_Dst ***
18008746-C-T 15896866-C-T P7_Dst ***
18008748-C-T 15896868-C-T P7_Dst ***
18008754-C-T 15896874-C-T P7_Dst ***
18008755-G-T 15896875-G-T P7_Dst ***
18008756-G-T 15896876-G-T P7_Dst ***
18008757-C-T 15896877-C-T P7_Dst ***
20217481-A-C 18055595-A-C P5_Dst ***
20230838-T-C 18068952-T-C P5_Dst ***
16108630-G-C 13996750-G-C P8_Prx ***
22481310-G-T 20319424-G-T DYZ19 ***
22431996-C-A 20270110-C-A DYZ19 ***
22435171-A-G 20273285-A-G DYZ19 ***
22435177-T-G 20273291-T-G DYZ19 ***
22435197-G-A 20273311-G-A DYZ19 ***
22435209-T-G 20273323-T-G DYZ19 ***
22456848-C-A 20294962-C-A DYZ19 ***
22485798-T-C 20323912-T-C DYZ19 ***
22358798-T-G 20196912-T-G DYZ19 ***
22498472-T-A 20336586-T-A DYZ19 ***
22502778-T-C 20340892-T-C A4404 DYZ19 ***
22508107-T-C 20346221-T-C DYZ19 ***
22520585-G-C 20358699-G-C ***
22802908-G-T 20641022-G-T ***
22802909-G-T 20641023-G-T ***
22802911-C-T 20641025-C-T ***
22359508-T-C 20197622-T-C DYZ19 ***
22345689-G-T 20183803-G-T DYZ19 ***
22802914-C-T 20641028-C-T ***
22315990-T-A 20154104-T-A DYZ19 ***
22315982-C-A 20154096-C-A DYZ19 ***
22315983-T-A 20154097-T-A DYZ19 ***
22315984-T-G 20154098-T-G DYZ19 ***
22315985-C-A 20154099-C-A DYZ19 ***
22315986-C-A 20154100-C-A DYZ19 ***
22315988-T-G 20154102-T-G DYZ19 ***
22315989-C-A 20154103-C-A DYZ19 ***
22315992-G-C 20154106-G-C DYZ19 ***
22341711-G-A 20179825-G-A DYZ19 ***
22315993-C-T 20154107-C-T DYZ19 ***
22315994-A-G 20154108-A-G DYZ19 ***
22334654-G-A 20172768-G-A DYZ19 ***
22341557-G-T 20179671-G-T DYZ19 ***
22341567-C-A 20179681-C-A DYZ19 ***
22341578-G-A 20179692-G-A DYZ19 ***
22341586-G-C 20179700-G-C DYZ19 ***
22802913-C-T 20641027-C-T ***
22802916-G-T 20641030-G-T ***
22315978-G-C 20154092-G-C DYZ19 ***
24084193-A-C 21938046-A-C P3_b1 ***
24041089-T-G 21894942-T-G ***
24041125-T-G 21894978-T-G ***
24042923-A-G 21896776-A-G ***
24044366-A-C 21898219-A-C ***
24044842-G-T 21898695-G-T ***
24046192-T-G 21900045-T-G ***
24060333-C-A 21914186-C-A P3_b1 ***
24084198-T-C 21938051-T-C P3_b1 ***
24039543-A-C 21893396-A-C ***
24084207-A-C 21938060-A-C P3_b1 ***
24084229-A-C 21938082-A-C P3_b1 ***
24084237-A-C 21938090-A-C P3_b1 ***
24084247-T-C 21938100-T-C P3_b1 ***
24084251-A-C 21938104-A-C P3_b1 ***
24116397-T-G 21970250-T-G P3_b1 ***
24192261-T-A 22046114-T-A P3_b1 ***
24039589-A-C 21893442-A-C ***
24034018-A-G 21887871-A-G ***
22802917-C-T 20641031-C-T ***
22802927-G-T 20641041-G-T ***
22802918-C-T 20641032-C-T ***
22802919-A-T 20641033-A-T ***
22802921-A-T 20641035-A-T ***
22802922-A-T 20641036-A-T ***
22802923-G-T 20641037-G-T ***
22802924-G-T 20641038-G-T ***
22802926-G-T 20641040-G-T ***
22802930-C-T 20641044-C-T ***
24025025-T-G 21878878-T-G ***
22816340-C-G 20654454-C-G ***
23181428-T-A 21019542-T-A ***
23693647-G-A 21531761-G-A ***
23807520-G-C 21645634-G-C ***
23816070-C-A 21654184-C-A ***
24022644-A-C 21876497-A-C ***
24023811-T-A 21877664-T-A ***
22315981-T-C 20154095-T-C DYZ19 ***
22315976-G-C 20154090-G-C DYZ19 ***
20230845-A-G 18068959-A-G P5_Dst ***
20868988-C-A 18707102-C-A P4_Dst 10×T***
20598415-C-T 18436529-C-T P5_Dst ***
20653986-T-G 18492100-T-G P4_Prx ***
20654063-G-C 18492177-G-C P4_Prx ***
20703678-C-T 18541792-C-T P4_Prx ***
20800140-C-A 18638254-C-A P4_Prx ***
20845289-A-T 18683403-A-T P4_Dst ***
20845295-A-T 18683409-A-T P4_Dst ***
20886833-G-A 18724947-G-A P4_Dst ***
20508973-C-A 18347087-C-A P5_Dst ***
20913317-C-A 18751431-C-A P4_Dst ***
20917293-G-A 18755407-G-A P4_Dst ***
20927148-T-G 18765262-T-G P4_Dst ***
20927151-T-G 18765265-T-G P4_Dst ***
20947529-T-C 18785643-T-C P4_Dst ***
20950473-C-A 18788587-C-A P4_Dst ***
20973339-C-T 18811453-C-T P4_Dst ***
20587756-C-A 18425870-C-A P5_Dst ***
20500993-T-C 18339107-T-C P5_Dst ***
20993673-A-C 18831787-A-C P4_Dst ***
20347965-C-A 18186079-C-A P5_Dst ***
20230851-T-G 18068965-T-G P5_Dst ***
20242939-C-T 18081053-C-T P5_Dst ***
20243005-A-C 18081119-A-C P5_Dst ***
20255008-T-G 18093122-T-G P5_Dst ***
20311687-T-A 18149801-T-A P5_Dst ***
20332069-T-A 18170183-T-A P5_Dst ***
20340704-G-T 18178818-G-T P5_Dst ***
20404559-T-G 18242673-T-G P5_Dst ***
20500986-A-G 18339100-A-G P5_Dst ***
20432812-G-T 18270926-G-T P5_Dst ***
20440369-A-G 18278483-A-G P5_Dst ***
20447741-A-C 18285855-A-C P5_Dst ***
20447748-A-C 18285862-A-C P5_Dst ***
20447749-C-T 18285863-C-T P5_Dst ***
20447811-T-A 18285925-T-A P5_Dst ***
20452414-T-G 18290528-T-G P5_Dst ***
20993669-T-A 18831783-T-A P4_Dst ***
20993675-A-T 18831789-A-T P4_Dst ***
22315975-A-T 20154089-A-T DYZ19 ***
22267670-T-C 20105784-T-C DYZ19 ***
22256892-G-C 20095006-G-C DYZ19 ***
22256893-G-C 20095007-G-C DYZ19 ***
22256895-G-T 20095009-G-T DYZ19 ***
22256896-A-C 20095010-A-C DYZ19 ***
22256897-G-A 20095011-G-A DYZ19 ***
22258589-C-A 20096703-C-A DYZ19 ***
22262322-A-T 20100436-A-T DYZ19 ***
22273581-T-G 20111695-T-G DYZ19 ***
22256890-A-T 20095004-A-T DYZ19 ***
22274733-G-T 20112847-G-T BY37068 DYZ19 ***
22303520-A-T 20141634-A-T DYZ19 ***
22315968-T-G 20154082-T-G DYZ19 ***
22315969-G-T 20154083-G-T DYZ19 ***
22315970-T-C 20154084-T-C DYZ19 ***
10023676-C-T 10186067-C-T ***
22315973-C-G 20154087-C-G DYZ19 ***
22256891-C-T 20095005-C-T DYZ19 ***
22256889-T-G 20095003-T-G DYZ19 ***
20993691-T-A 18831805-T-A P4_Dst ***
21569956-T-A 19408070-T-A ***
20993692-A-T 18831806-A-T P4_Dst ***
20998053-T-A 18836167-T-A P4_Dst ***
20998062-T-A 18836176-T-A P4_Dst ***
21153473-C-T 18991587-C-T ***
21515804-A-G 19353918-A-G ***
21515814-G-A 19353928-G-A ***
21515816-T-C 19353930-T-C ***
21922105-A-T 19760219-A-T ***
22250202-T-C 20088316-T-C DYZ19 ***
21922106-A-T 19760220-A-T ***
21922111-G-T 19760225-G-T ***
22100768-T-A 19938882-T-A ***
22164458-G-A 20002572-G-A ***
22234119-T-A 20072233-T-A BY23234 DYZ19 ***
22234761-A-C 20072875-A-C DYZ19 ***
22250201-G-A 20088315-G-A DYZ19 ***
16108631-G-A 13996751-G-A P8_Prx ***
16108629-T-A 13996749-T-A P8_Prx ***
9234281-C-G 9396672-C-G ***
13203925-C-G 11048249-C-G ***
13203917-G-T 11048241-G-T ***
13203919-T-A 11048243-T-A ***
13203920-G-T 11048244-G-T ***
13203921-A-G 11048245-A-G ***
13203922-C-A 11048246-C-A ***
13203923-G-T 11048247-G-T ***
13203926-A-T 11048250-A-T ***
13203915-A-G 11048239-A-G ***
13203927-T-A 11048251-T-A ***
13203929-G-T 11048253-G-T ***
13203930-T-A 11048254-T-A ***
13203931-G-T 11048255-G-T ***
13203932-A-G 11048256-A-G ***
13203933-T-A 11048257-T-A ***
13203934-A-T 11048258-A-T ***
13203916-T-A 11048240-T-A ***
13203914-G-T 11048238-G-T ***
13203936-A-G 11048260-A-G ***
13140617-C-T 10630103-C-T ***
13140601-A-T 10630087-A-T ***
13140604-A-T 10630090-A-T ***
13140605-C-T 10630091-C-T ***
13140608-C-T 10630094-C-T ***
13140612-T-G 10630098-T-G ***
13140613-C-A 10630099-C-A ***
13140615-C-A 10630101-C-A ***
13140618-C-A 10630104-C-A ***
13203913-C-G 11048237-C-G ***
13140619-A-T 10630105-A-T ***
13140623-C-A 10630109-C-A ***
13143050-A-T 10632536-A-T ***
13143055-A-C 10632541-A-C ***
13143060-A-T 10632546-A-T ***
13143610-T-C 10633096-T-C ***
13193972-C-A 11038296-C-A ***
13203935-G-A 11048259-G-A ***
13203937-G-T 11048261-G-T ***
13140107-T-A 10629593-T-A ***
13433172-T-C 11277496-T-C ***
13304213-A-G 11148537-A-G ***
13325983-A-T 11170307-A-T ***
13372168-A-G 11216492-A-G ***
13393360-T-A 11237684-T-A ***
13417505-A-T 11261829-A-T ***
13433170-C-T 11277494-C-T ***
13433171-T-G 11277495-T-G ***
13433173-A-C 11277497-A-C ***
13253224-T-C 11097548-T-C ***
13433174-T-A 11277498-T-A ***
13433175-G-A 11277499-G-A ***
13437877-T-G 11282201-T-G ***
13447255-T-C 11291579-T-C ***
13460967-G-A 11305291-G-A ***
13465350-T-C 11309674-T-C ***
13467914-A-T 11312238-A-T ***
13275934-A-G 11120258-A-G ***
13239448-C-T 11083772-C-T ***
13203938-A-G 11048262-A-G ***
13203949-G-T 11048273-G-T ***
13203939-T-A 11048263-T-A ***
13203940-G-T 11048264-G-T ***
13203941-A-G 11048265-A-G ***
13203942-T-A 11048266-T-A ***
13203945-A-G 11048269-A-G ***
13203946-G-T 11048270-G-T ***
13203948-T-G 11048272-T-G ***
13203950-A-G 11048274-A-G ***
13239439-C-T 11083763-C-T ***
13203951-T-A 11048275-T-A ***
13203952-G-T 11048276-G-T ***
13203954-T-G 11048278-T-G ***
13203955-C-T 11048279-C-T ***
13203956-A-G 11048280-A-G ***
13203957-T-A 11048281-T-A ***
13218953-C-A 11063277-C-A ***
13140600-C-T 10630086-C-T ***
13140104-C-T 10629590-C-T ***
13472196-G-T 11316520-G-T ***
9589884-G-T 9752275-G-T IR3_Prx ***
9354929-G-A 9517320-G-A ***
9365385-C-G 9527776-C-G ***
9372450-T-G 9534841-T-G ***
9533756-G-T 9696147-G-T IR3_Prx ***
9539473-G-T 9701864-G-T IR3_Prx ***
9540304-G-T 9702695-G-T IR3_Prx ***
9540305-C-T 9702696-C-T IR3_Prx ***
9605852-G-T 9768243-G-T IR3_Prx ***
9343762-G-T 9506153-G-T ***
9622530-T-C 9784921-T-C IR3_Prx ***
9622549-T-G 9784940-T-G IR3_Prx ***
9626093-A-C 9788484-A-C IR3_Prx ***
9634139-T-C 9796530-T-C IR3_Prx ***
9637383-G-T 9799774-G-T IR3_Prx ***
9666931-G-T 9829322-G-T IR3_Prx ***
9740070-G-T 9902461-G-T IR3_Prx ***
9344040-T-C 9506431-T-C ***
9325211-A-C 9487602-A-C ***
9745937-G-C 9908328-G-C ***
9234294-G-C 9396685-G-C ***
9234283-T-C 9396674-T-C ***
9234284-C-T 9396675-C-T ***
9234285-A-C 9396676-A-C ***
9234286-G-T 9396677-G-T ***
9234288-T-G 9396679-T-G ***
9234291-T-G 9396682-T-G ***
9234293-G-C 9396684-G-C ***
9234295-C-G 9396686-C-G ***
9325205-A-G 9487596-A-G ***
9234296-A-C 9396687-A-C ***
9238563-T-G 9400954-T-G ***
9304113-A-C 9466504-A-C ***
9304678-T-G 9467069-T-G ***
9304878-C-G 9467269-C-G ***
9311515-A-G 9473906-A-G ***
9311531-T-G 9473922-T-G ***
9745934-T-C 9908325-T-C ***
9745938-A-C 9908329-A-C ***
13140103-T-C 10629589-T-C ***
10041614-G-T 10204005-G-T ***
9941272-T-G 10103663-T-G ***
9952621-T-A 10115012-T-A ***
9952636-G-A 10115027-G-A ***
9952652-T-C 10115043-T-C ***
10023484-C-T 10185875-C-T ***
10032496-C-G 10194887-C-G ***
10032547-C-T 10194938-C-T ***
10041627-A-G 10204018-A-G ***
9941270-T-C 10103661-T-C ***
10041636-G-A 10204027-G-A ***
10041649-A-C 10204040-A-C ***
10041691-T-G 10204082-T-G ***
10041698-T-A 10204089-T-A ***
10041741-G-T 10204132-G-T ***
13140101-A-C 10629587-A-C ***
13140102-T-A 10629588-T-A ***
9941271-G-A 10103662-G-A ***
9940850-A-G 10103241-A-G ***
9745939-G-C 9908330-G-C ***
9930013-C-G 10092404-C-G ***
9745942-G-C 9908333-G-C ***
9745946-T-C 9908337-T-C ***
9745947-T-C 9908338-T-C ***
9756772-G-T 9919163-G-T ***
9929952-G-A 10092343-G-A ***
9929958-G-A 10092349-G-A ***
9929998-G-T 10092389-G-T ***
9930200-G-A 10092591-G-A ***
9940799-C-G 10103190-C-G ***
9930204-A-G 10092595-A-G ***
9930207-A-G 10092598-A-G ***
9930211-C-G 10092602-C-G ***
9934778-A-G 10097169-A-G ***
9937535-A-G 10099926-A-G ***
9940741-G-A 10103132-G-A ***
9940753-T-C 10103144-T-C ***
13472187-C-G 11316511-C-G ***
13474810-G-T 11319134-G-T ***
16108628-T-C 13996748-T-C P8_Prx ***
14184509-C-A 12063803-C-A ***
13860545-C-G 11739839-C-G ***
13860620-G-C 11739914-G-C ***
14051714-C-A 11931008-C-A ***
14184505-G-T 12063799-G-T ***
14184506-G-C 12063800-G-C ***
14184507-C-T 12063801-C-T ***
14184508-T-C 12063802-T-C ***
14184511-C-T 12063805-C-T ***
13856662-G-T 11735956-G-T ***
14184513-A-T 12063807-A-T ***
14184514-G-T 12063808-G-T ***
14184515-G-T 12063809-G-T ***
14184516-T-G 12063810-T-G ***
14184517-C-T 12063811-C-T ***
14184518-T-G 12063812-T-G ***
14184519-G-A 12063813-G-A ***
13858402-T-A 11737696-T-A ***
13856579-T-A 11735873-T-A ***
14184523-A-T 12063817-A-T ***
13856462-G-C 11735756-G-C ***
13833427-G-A 11712721-G-A ***
13833431-G-A 11712725-G-A ***
13833435-T-G 11712729-T-G ***
13833437-G-A 11712731-G-A ***
13833449-C-T 11712743-C-T ***
13833457-C-A 11712751-C-A ***
13833459-G-T 11712753-G-T ***
13856468-G-A 11735762-G-A ***
13856577-A-G 11735871-A-G ***
13856471-C-T 11735765-C-T ***
13856472-C-G 11735766-C-G ***
13856474-A-C 11735768-A-C ***
13856478-T-G 11735772-T-G ***
13856495-G-T 11735789-G-T ***
13856569-A-T 11735863-A-T ***
13856573-C-G 11735867-C-G ***
14184520-G-T 12063814-G-T ***
14184525-A-G 12063819-A-G ***
13833417-G-T 11712711-G-T ***
16108609-A-T 13996729-A-T P8_Prx ***
16108599-C-A 13996719-C-A P8_Prx ***
16108602-G-C 13996722-G-C P8_Prx ***
16108604-T-A 13996724-T-A P8_Prx ***
16108605-C-G 13996725-C-G P8_Prx ***
16108606-T-A 13996726-T-A P8_Prx ***
16108607-A-T 13996727-A-T P8_Prx ***
16108608-C-T 13996728-C-T P8_Prx ***
16108610-A-G 13996730-A-G P8_Prx ***
16108597-T-G 13996717-T-G P8_Prx ***
16108612-A-C 13996732-A-C P8_Prx ***
16108614-A-C 13996734-A-C P8_Prx ***
16108616-A-C 13996736-A-C P8_Prx ***
16108617-T-A 13996737-T-A P8_Prx ***
16108624-G-T 13996744-G-T P8_Prx ***
16108625-A-C 13996745-A-C P8_Prx ***
16108627-C-G 13996747-C-G P8_Prx ***
16108598-G-T 13996718-G-T P8_Prx ***
16108596-G-A 13996716-G-A P8_Prx ***
14184526-G-T 12063820-G-T ***
15815250-T-A 13703370-T-A ***
14258539-C-T 12137833-C-T ***
14990146-T-C 12878231-T-C ***
15336018-T-A 13224136-T-A ***
15497952-A-T 13386072-A-T ***
15497953-A-T 13386073-A-T