Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z41150 > Z49 > 10023952GTCTC-G > S8183 > Y4356 > Y4354 > Y4355 > FGC20800 > FGC20775

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
195364
FGC-BigY
H3G7C
FGC
KK2P9
17579706-G-T 15467826-G-T FGC20775FGC20794 Y14093 YY*+
6999485-A-G 7131444-A-G FGC31484 Y+
21552883-C-T 19390997-C-T FGC31489 Y+
22173652-A-G 20011766-A-G FGC20775FGC20807 Y14100 YY*+
4385730-C-T 4517689-C-T FGC31477 +
5739310-T-C 5871269-T-C FGC31479 +
5762800-A-G 5894759-A-G FGC31480 +
6476811-T-C 6608770-T-C FGC31482 +
28621381-G-A 26475234-G-A FGC31491 Y14103 Y**+
6507549-G-A 6639508-G-A FGC31483 +
6449473-T-C 6581432-T-C FGC31481 +
7315755-T-G 7447714-T-G FGC20775FGC20779 Y14089 YY+++
9076129-G-A 9238520-G-A FGC31485 +
15773565-C-A 13661685-C-A FGC31487 YY+
15429333-G-A 13317453-G-A FGC20775FGC20789 Y14091 YY+++
14391678-C-G 12270974-C-G FGC31486 YY+
5024010-G-C 5155969-G-C FGC31478 *
3224887-A-G 3356846-A-G FGC31476 *
13840799-G-A 11720093-G-A FGC20775FGC20785 Y14139 ***
20454018-T-C 18292132-T-C FGC31488 P5_Dst *
58893615-G-A 56697256-C-T **
28588296-A-G 26442149-A-G **
16681591-C-A 14569711-C-A **
5147441-C-CAAAAA 5279400-C-CAAAAA 30×A**
13862506-A-G 11741800-A-G **
5313691-C-A 5445650-C-A Y19503 FGC45705 **
21821577-C-A 19659691-C-A **
21694858-C-G 19532972-C-G **
15797259-C-G 13685379-C-G **
24627729-C-A 22481582-C-A P3_t2 **
5626057-C-A 5758016-C-A **
13291276-C-A 11135600-C-A **
17929655-G-T 15817775-G-T **
7120613-T-G 7252572-T-G **
13856812-A-C 11736106-A-C **
3158906-C-A 3290865-C-A **
18901126-C-G 16789246-C-G **
2773757-G-T 2905716-G-T **
15637870-G-T 13525990-G-T **
9930192-T-G 10092583-T-G **
15168976-C-A 13057062-C-A **
4503310-GTATTAT-G 4635269-GTATTAT-G 16×TAT**
28577950-T-TAC 26431803-T-TAC 17×AC**
7359768-AATAT-A 7491727-AATAT-A 10×AT**
24627794-CGT-C 22481647-CGT-C P3_t2 **
15644626-G-A 13532746-G-A **
7717737-C-CTTCT 7849696-C-CTTCT 13×TTCT**
28253491-C-CAAAAAAAAAAAAA 26107344-C-CAAAAAAAAAAAAA P1_b4 32×A**
15770505-G-T 13658625-G-T **
9930169-G-T 10092560-G-T **
13416471-T-C 11260795-T-C **
8634381-T-TAC 8766340-T-TAC 22×AC**
24760000-TTATA-T 22613853-TTATA-T P3_b2 11×TA**
6419046-ATG-A 6551005-ATG-A 18×TG**
14681563-A-T 12569629-A-T **
20248136-GTC-G 18086250-GTC-G P5_Dst 9×TC**
13194286-TTTCCATTCCATTCCA-T 11038610-TTTCCATTCCATTCCA-T 9×TTCCA****
9930039-G-A 10092430-G-A **
9930050-A-G 10092441-A-G **
9930165-A-C 10092556-A-C **
17086602-CATAT-C 14974722-CATAT-C 22×AT**
9930174-A-G 10092565-A-G **
28602309-C-A 26456162-C-A **
14187101-C-A 12066395-C-A **
16292546-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 14180666-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 48×T*****
9340793-G-A 9503184-G-A **
14295385-C-A 12174679-C-A **
14380937-C-T 12260233-C-T **
7139159-C-T 7271118-C-T Z22015 **
18365541-ATGTGTG-A 16253661-ATGTGTG-A P6_Prx 20×TG**
19006136-C-CAAAAAAA 16894256-C-CAAAAAAA 21×A**
2745740-T-A 2877699-T-A **
58893635-C-A 56697236-G-T **
17998049-A-G 15886169-A-G P7_Gap **
19055513-C-T 16943633-C-T **
13596381-G-A 11440705-G-A **
13601177-C-A 11445501-C-A **
20248110-C-A 18086224-C-A P5_Dst **
13637312-C-A 11481636-C-A **
18789838-C-A 16677958-C-A **
7217732-C-A 7349691-C-A **
20206590-C-A 18044704-C-A FGC14744 P5_Dst **
18930549-C-A 16818669-C-A **
7012613-C-A 7144572-C-A **
8850048-C-A 8982007-C-A **
18121509-G-T 16009629-G-T **
7142216-C-A 7274175-C-A **
8786586-C-T 8918545-C-T **
8293744-C-A 8425703-C-A **
14429405-TTA-T 12308680-T-. 15×TA**
15336018-TC-T 13224136-TC-T **
8075905-C-A 8207864-C-A **
7969158-G-T 8101117-G-T **
7754735-G-T 7886694-G-T **
28487325-G-T 26341178-G-T **
17648009-CAAA-C 15536129-CAAA-C 17×A**
18153389-G-T 16041509-G-T **
21362958-A-G 19201072-A-G FGC20775A9522 *****
13437029-G-C 11281353-G-C **
19644575-C-T 17532695-C-T P5_Prx **
26089868-G-A 23943721-G-A P1_Y1 ***
26089882-A-T 23943735-A-T P1_Y1 ***
26089881-G-T 23943734-G-T P1_Y1 ***
26089879-C-T 23943732-C-T P1_Y1 ***
25207740-G-A 23061593-G-A P2_r1 ***
25207741-T-A 23061594-T-A P2_r1 ***
26089876-C-T 23943729-C-T P1_Y1 ***
25207742-G-A 23061595-G-A P2_r1 ***
26089873-C-T 23943726-C-T P1_Y1 ***
25366439-T-G 23220292-T-G P2_r2 ***
25207745-C-A 23061598-C-A P2_r1 ***
26089870-A-T 23943723-A-T P1_Y1 ***
25364631-C-T 23218484-C-T P2_r2 ***
26089885-A-T 23943738-A-T P1_Y1 ***
26068751-A-G 23922604-A-G P1_Y1 ***
25429115-C-A 23282968-C-A P2_r2 ***
26010270-A-G 23864123-A-G P1_Y1 ***
25207746-C-A 23061599-C-A P2_r1 ***
26008346-T-C 23862199-T-C P1_Y1 ***
25979361-C-A 23833214-C-A P1_Y1 ***
25956461-A-G 23810314-A-G P1_Y1 ***
25845064-C-A 23698917-C-A P1_b3 ***
25429594-A-C 23283447-A-C P2_r2 ***
25845063-C-A 23698916-C-A P1_b3 ***
25845062-T-A 23698915-T-A P1_b3 ***
26089884-C-T 23943737-C-T P1_Y1 ***
25372136-A-C 23225989-A-C P2_r2 ***
25845055-C-A 23698908-C-A P1_b3 ***
25394968-T-A 23248821-T-A P2_r2 ***
25207723-T-G 23061576-T-G P2_r1 ***
25376536-C-T 23230389-C-T P2_r2 24×T***
26495658-C-A 24349511-C-A P1_Y1 ***
25207724-G-A 23061577-G-A P2_r1 ***
25382119-G-T 23235972-G-T P2_r2 ***
25207726-G-A 23061579-G-A P2_r1 ***
26495657-A-C 24349510-A-C P1_Y1 ***
25207727-G-A 23061580-G-A P2_r1 ***
25207731-G-A 23061584-G-A P2_r1 ***
25207733-G-A 23061586-G-A P2_r1 ***
26440434-C-T 24294287-C-T P1_Y1 ***
26344122-T-C 24197975-T-C P1_Y1 ***
25207738-G-A 23061591-G-A P2_r1 ***
26278279-C-A 24132132-C-A P1_Y1 ***
26277795-C-T 24131648-C-T P1_Y1 ***
26277742-A-G 24131595-A-G P1_Y1 ***
26171280-T-C 24025133-T-C P1_Y1 ***
25207736-T-G 23061589-T-G P2_r1 ***
25395106-G-C 23248959-G-C P2_r2 ***
26141237-A-C 23995090-A-C P1_Y1 ***
26128902-G-A 23982755-G-A P1_Y1 ***
25428344-A-C 23282197-A-C P2_r2 ***
26098042-G-A 23951895-G-A P1_Y1 ***
26089887-C-T 23943740-C-T P1_Y1 ***
25207737-G-A 23061590-G-A P2_r1 ***
25845058-T-A 23698911-T-A P1_b3 ***
25470576-T-A 23324429-T-A P2_r2 ***
25524618-C-A 23378471-C-A P1_gr1 ***
25626781-T-A 23480634-T-A A3560 P1_b3 ***
25207759-C-A 23061612-C-A P2_r1 ***
25207762-G-A 23061615-G-A P2_r1 ***
25646993-A-T 23500846-A-T P1_b3 ***
25456422-T-A 23310275-T-A P2_r2 ***
25207763-C-A 23061616-C-A P2_r1 ***
25626846-T-A 23480699-T-A P1_b3 ***
25207889-C-A 23061742-C-A P2_r1 ***
25626845-G-A 23480698-G-A P1_b3 ***
25456426-C-A 23310279-C-A P2_r2 ***
25456428-G-A 23310281-G-A P2_r2 ***
25207893-G-A 23061746-G-A P2_r1 ***
25456430-G-A 23310283-G-A P2_r2 ***
25662049-C-A 23515902-C-A P1_b3 ***
25231987-A-G 23085840-A-G P2_r1 ***
25268463-T-A 23122316-T-A P2_r1 ***
25268497-G-A 23122350-G-A P2_r1 ***
25268501-T-A 23122354-T-A P2_r1 ***
25268507-G-A 23122360-G-A P2_r1 ***
25268516-G-A 23122369-G-A P2_r1 ***
25268543-T-G 23122396-T-G P2_r1 ***
25268546-C-A 23122399-C-A P2_r1 ***
25603687-C-A 23457540-C-A P1_gr1 ***
25456432-T-A 23310285-T-A P2_r2 ***
25466457-T-G 23320310-T-G P2_r2 ***
25524846-A-T 23378699-A-T P1_gr1 ***
25334360-C-A 23188213-C-A P2_r1 ***
25207758-G-A 23061611-G-A P2_r1 ***
25845042-C-A 23698895-C-A P1_b3 ***
25207752-G-A 23061605-G-A P2_r1 ***
25835327-A-C 23689180-A-C P1_b3 ***
25207747-C-A 23061600-C-A P2_r1 ***
25207748-G-A 23061601-G-A P2_r1 ***
25804964-C-G 23658817-C-G P1_b3 ***
25766632-G-T 23620485-G-T P1_b3 ***
25766625-G-T 23620478-G-T P1_b3 ***
25766599-T-A 23620452-T-A P1_b3 ***
25757968-T-A 23611821-T-A P1_b3 ***
25429649-T-G 23283502-T-G P2_r2 ***
25207750-G-A 23061603-G-A P2_r1 ***
25431760-G-T 23285613-G-T P2_r2 ***
25382068-A-T 23235921-A-T P2_r2 ***
25757965-T-A 23611818-T-A P1_b3 ***
25456391-G-T 23310244-G-T P2_r2 ***
25207754-C-A 23061607-C-A P2_r1 ***
25207755-G-A 23061608-G-A P2_r1 ***
25727454-C-A 23581307-C-A P1_b3 ***
25207756-G-A 23061609-G-A P2_r1 ***
25434924-C-A 23288777-C-A P2_r2 ***
25439728-T-G 23293581-T-G P2_r2 ***
25697968-G-T 23551821-G-T P1_b3 ***
25690052-A-C 23543905-A-C P1_b3 ***
25207757-A-G 23061610-A-G P2_r1 ***
25689013-G-T 23542866-G-T P1_b3 ***
25675732-G-T 23529585-G-T P1_b3 ***
25662996-G-T 23516849-G-T P1_b3 ***
25845054-T-A 23698907-T-A P1_b3 ***
26953187-G-A 24807040-G-A P1_r3 ***
26495660-C-A 24349513-C-A P1_Y1 ***
27981977-C-A 25835830-C-A P1_Y2 ***
27896110-C-A 25749963-C-A P1_Y2 ***
27896112-G-T 25749965-G-T P1_Y2 ***
27904409-C-A 25758262-C-A P1_Y2 ***
27916323-T-A 25770176-T-A P1_Y2 ***
27916411-G-A 25770264-G-A P1_Y2 ***
27958515-A-T 25812368-A-T P1_Y2 ***
27974271-G-T 25828124-G-T P1_Y2 ***
27982298-G-A 25836151-G-A P1_Y2 ***
27873407-A-T 25727260-A-T P1_Y2 ***
27991609-A-G 25845462-A-G P1_Y2 ***
27994637-C-A 25848490-C-A P1_Y2 ***
27994780-C-A 25848633-C-A P1_Y2 ***
27997704-T-A 25851557-T-A P1_Y2 ***
27997706-C-A 25851559-C-A P1_Y2 ***
27997709-G-A 25851562-G-A P1_Y2 ***
27997712-G-A 25851565-G-A P1_Y2 ***
28006432-T-A 25860285-T-A P1_Y2 ***
27873523-A-T 25727376-A-T P1_Y2 ***
27873295-C-T 25727148-C-T P1_Y2 ***
28102879-T-C 25956732-T-C P1_Y2 ***
27838064-A-T 25691917-A-T P1_Y2 ***
27732431-A-G 25586284-A-G P1_Y2 ***
27733436-T-A 25587289-T-A P1_Y2 ***
27733733-A-G 25587586-A-G P1_Y2 ***
27772564-T-G 25626417-T-G P1_Y2 ***
27772636-A-C 25626489-A-C P1_Y2 ***
27793188-G-T 25647041-G-T P1_Y2 ***
27808432-G-T 25662285-G-T P1_Y2 ***
27821642-C-A 25675495-C-A P1_Y2 ***
27838157-A-T 25692010-A-T P1_Y2 ***
27859452-G-A 25713305-G-A P1_Y2 ***
27838162-A-T 25692015-A-T P1_Y2 ***
27844487-C-T 25698340-C-T P1_Y2 ***
27844503-A-T 25698356-A-T P1_Y2 ***
27844504-G-T 25698357-G-T P1_Y2 ***
27844508-C-T 25698361-C-T P1_Y2 ***
27844510-C-T 25698363-C-T P1_Y2 ***
27844528-G-T 25698381-G-T P1_Y2 ***
27859448-T-A 25713301-T-A P1_Y2 ***
28076198-T-A 25930051-T-A P1_Y2 ***
28160806-A-T 26014659-A-T P1_b4 ***
27716888-C-A 25570741-C-A P1_Y2 ***
28253606-C-A 26107459-C-A P1_b4 ***
28253594-T-A 26107447-T-A P1_b4 ***
28253595-G-A 26107448-G-A P1_b4 ***
28253597-T-A 26107450-T-A P1_b4 ***
28253599-C-A 26107452-C-A P1_b4 ***
28253601-C-A 26107454-C-A P1_b4 ***
28253603-T-A 26107456-T-A P1_b4 ***
28253604-G-A 26107457-G-A P1_b4 ***
28253610-T-A 26107463-T-A P1_b4 ***
28253592-C-A 26107445-C-A P1_b4 ***
28253611-G-A 26107464-G-A P1_b4 ***
28360468-C-T 26214321-C-T P1_gr2 ***
28460874-C-A 26314727-C-A ***
28481058-T-G 26334911-T-G ***
28481074-T-G 26334927-T-G ***
28491351-C-G 26345204-C-G ***
28491353-A-G 26345206-A-G ***
28491354-A-G 26345207-A-G ***
28253593-C-A 26107446-C-A P1_b4 ***
28253589-C-A 26107442-C-A P1_b4 ***
28170325-A-C 26024178-A-C P1_b4 ***
28253545-G-A 26107398-G-A P1_b4 ***
28170576-C-T 26024429-C-T P1_b4 ***
28170582-A-T 26024435-A-T P1_b4 ***
28170668-G-A 26024521-G-A P1_b4 ***
28170939-T-C 26024792-T-C P1_b4 ***
28253528-T-A 26107381-T-A P1_b4 ***
28253534-T-A 26107387-T-A P1_b4 ***
28253537-G-A 26107390-G-A P1_b4 ***
28253544-T-C 26107397-T-C P1_b4 ***
28253548-C-A 26107401-C-A P1_b4 ***
28253588-T-A 26107441-T-A P1_b4 ***
28253551-T-A 26107404-T-A P1_b4 ***
28253552-G-C 26107405-G-C P1_b4 ***
28253580-T-A 26107433-T-A P1_b4 ***
28253581-T-A 26107434-T-A P1_b4 ***
28253583-C-A 26107436-C-A P1_b4 ***
28253584-C-A 26107437-C-A P1_b4 ***
28253586-C-A 26107439-C-A P1_b4 ***
28253587-C-A 26107440-C-A P1_b4 ***
27721218-G-A 25575071-G-A P1_Y2 ***
27713548-G-T 25567401-G-T P1_Y2 ***
26495662-G-A 24349515-G-A P1_Y1 ***
27004312-G-C 24858165-G-C P1_r4 ***
26991381-C-A 24845234-C-A P1_r4 ***
26991383-G-A 24845236-G-A P1_r4 ***
26991388-G-A 24845241-G-A P1_r4 ***
26995027-G-T 24848880-G-T P1_r4 ***
27004219-G-T 24858072-G-T P1_r4 ***
27004256-A-C 24858109-A-C P1_r4 ***
27004305-T-G 24858158-T-G P1_r4 ***
27048225-A-C 24902078-A-C P1_r4 ***
26991375-G-A 24845228-G-A P1_r4 ***
27049748-C-T 24903601-C-T P1_r4 ***
27062076-G-T 24915929-G-T P1_r4 ***
27062081-A-T 24915934-A-T P1_r4 ***
27062085-C-T 24915938-C-T P1_r4 ***
27062108-A-T 24915961-A-T P1_r4 ***
27062118-C-T 24915971-C-T P1_r4 22×T***
27082115-C-G 24935968-C-G P1_r4 ***
27082130-T-G 24935983-T-G P1_r4 ***
26991377-G-A 24845230-G-A P1_r4 ***
26991372-C-A 24845225-C-A P1_r4 ***
27095971-G-T 24949824-G-T P1_r4 ***
26880358-A-T 24734211-A-T P1_r3 ***
26495665-G-A 24349518-G-A P1_Y1 ***
26511855-T-A 24365708-T-A P1_Y1 ***
26810690-T-C 24664543-T-C P1_g2 ***
26810711-A-T 24664564-A-T P1_g2 ***
26810747-C-A 24664600-C-A P1_g2 ***
26874053-T-A 24727906-T-A P1_r3 ***
26874061-G-A 24727914-G-A P1_r3 ***
26880327-A-T 24734180-A-T P1_r3 ***
26902338-C-A 24756191-C-A P1_r3 ***
26991371-T-A 24845224-T-A P1_r4 ***
26907499-A-T 24761352-A-T P1_r3 ***
26907554-A-C 24761407-A-C P1_r3 ***
26914231-A-T 24768084-A-T P1_r3 ***
26914240-C-T 24768093-C-T P1_r3 ***
25165722-G-A 23019575-G-A g1 ***
26991212-G-A 24845065-G-A P1_r4 ***
26991368-T-A 24845221-T-A P1_r4 ***
26991369-G-A 24845222-G-A P1_r4 ***
27082179-T-C 24936032-T-C P1_r4 ***
27129854-G-A 24983707-G-A P1_g3 ***
27694831-C-A 25548684-C-A P1_Y2 ***
27424074-G-T 25277927-G-T P1_g3 ***
27369053-G-T 25222906-G-T P1_g3 ***
27395392-G-T 25249245-G-T P1_g3 ***
27397157-G-C 25251010-G-C P1_g3 ***
27404358-A-C 25258211-A-C P1_g3 ***
27411628-A-G 25265481-A-G P1_g3 ***
27411646-A-G 25265499-A-G P1_g3 ***
27411648-A-G 25265501-A-G P1_g3 ***
27427768-G-T 25281621-G-T P1_g3 ***
27313331-C-A 25167184-C-A P1_g3 ***
27466735-C-A 25320588-C-A P1_Y2 ***
27579055-G-T 25432908-G-T P1_Y2 ***
27585891-A-T 25439744-A-T P1_Y2 ***
27585905-A-T 25439758-A-T P1_Y2 ***
27602801-A-G 25456654-A-G P1_Y2 ***
27602821-A-G 25456674-A-G P1_Y2 ***
27618293-C-G 25472146-C-G P1_Y2 ***
27694797-C-A 25548650-C-A P1_Y2 ***
27354671-A-C 25208524-A-C P1_g3 ***
27306081-T-C 25159934-T-C P1_g3 ***
27129891-C-A 24983744-C-A P1_g3 ***
27151345-T-G 25005198-T-G P1_g3 ***
27129895-C-A 24983748-C-A P1_g3 ***
27130402-G-A 24984255-G-A P1_g3 ***
27134966-G-T 24988819-G-T P1_g3 ***
27150672-A-T 25004525-A-T P1_g3 ***
27151338-G-A 25005191-G-A P1_g3 ***
27151341-G-A 25005194-G-A P1_g3 ***
27151342-A-G 25005195-A-G P1_g3 ***
27151343-G-A 25005196-G-A P1_g3 ***
27151356-C-A 25005209-C-A P1_g3 ***
27306022-C-T 25159875-C-T P1_g3 ***
27151358-T-A 25005211-T-A P1_g3 ***
27151399-C-A 25005252-C-A P1_g3 ***
27151410-G-C 25005263-G-C P1_g3 ***
27165214-C-A 25019067-C-A P1_g3 ***
27172243-G-T 25026096-G-T P1_g3 ***
27190518-A-G 25044371-A-G P1_g3 ***
27199101-C-T 25052954-C-T P1_g3 ***
27210976-G-T 25064829-G-T P1_g3 ***
25177354-T-G 23031207-T-G g1 ***
24794442-A-G 22648295-A-G P3_b2 ***
25165717-G-A 23019570-G-A g1 ***
21709078-A-T 19547192-A-T ***
21515814-G-A 19353928-G-A ***
21515816-T-C 19353930-T-C ***
21554276-C-A 19392390-C-A ***
21569956-T-A 19408070-T-A ***
21583823-C-A 19421937-C-A ***
21584348-C-A 19422462-C-A ***
21584491-C-A 19422605-C-A ***
21709115-T-G 19547229-T-G ***
21515804-A-G 19353918-A-G ***
21852594-C-A 19690708-C-A ***
21922105-A-T 19760219-A-T ***
21922106-A-T 19760220-A-T ***
21922111-G-T 19760225-G-T ***
21922112-G-T 19760226-G-T ***
22100768-T-A 19938882-T-A ***
22146391-G-A 19984505-G-A ***
21515812-G-A 19353926-G-A ***
21409017-C-A 19247131-C-A ***
22234119-T-A 20072233-T-A DYZ19 ***
20993673-A-C 18831787-A-C P4_Dst ***
20927151-T-G 18765265-T-G P4_Dst ***
20942974-T-A 18781088-T-A P4_Dst ***
20947529-T-C 18785643-T-C P4_Dst ***
20949797-G-A 18787911-G-A P4_Dst ***
20950473-C-A 18788587-C-A P4_Dst ***
20973339-C-T 18811453-C-T P4_Dst ***
20993669-T-A 18831783-T-A P4_Dst ***
20993675-A-T 18831789-A-T P4_Dst ***
21347339-G-T 19185453-G-T ***
20993691-T-A 18831805-T-A P4_Dst ***
20993692-A-T 18831806-A-T P4_Dst ***
20998053-T-A 18836167-T-A P4_Dst ***
20998062-T-A 18836176-T-A P4_Dst ***
21149614-C-A 18987728-C-A ***
21153473-C-T 18991587-C-T ***
21200202-G-T 19038316-G-T ***
22164458-G-A 20002572-G-A ***
22234761-A-C 20072875-A-C DYZ19 ***
20917293-G-A 18755407-G-A P4_Dst ***
22315986-C-A 20154100-C-A DYZ19 ***
22315976-G-C 20154090-G-C DYZ19 ***
22315978-G-C 20154092-G-C DYZ19 ***
22315981-T-C 20154095-T-C DYZ19 ***
22315982-C-A 20154096-C-A DYZ19 ***
22315983-T-A 20154097-T-A DYZ19 ***
22315984-T-G 20154098-T-G DYZ19 ***
22315985-C-A 20154099-C-A DYZ19 ***
22315988-T-G 20154102-T-G DYZ19 ***
22315973-C-G 20154087-C-G DYZ19 ***
22315989-C-A 20154103-C-A DYZ19 ***
22315990-T-A 20154104-T-A DYZ19 ***
22315992-G-C 20154106-G-C DYZ19 ***
22315993-C-T 20154107-C-T DYZ19 ***
22315994-A-G 20154108-A-G DYZ19 ***
22334654-G-A 20172768-G-A DYZ19 ***
22341557-G-T 20179671-G-T DYZ19 ***
22315975-A-T 20154089-A-T DYZ19 ***
22315971-G-T 20154085-G-T DYZ19 ***
22250201-G-A 20088315-G-A DYZ19 ***
22256896-A-C 20095010-A-C DYZ19 ***
22250202-T-C 20088316-T-C DYZ19 ***
22256889-T-G 20095003-T-G DYZ19 ***
22256890-A-T 20095004-A-T DYZ19 ***
22256891-C-T 20095005-C-T DYZ19 ***
22256892-G-C 20095006-G-C DYZ19 ***
22256893-G-C 20095007-G-C DYZ19 ***
22256895-G-T 20095009-G-T DYZ19 ***
22256897-G-A 20095011-G-A DYZ19 ***
22315970-T-C 20154084-T-C DYZ19 ***
22258589-C-A 20096703-C-A DYZ19 ***
22262322-A-T 20100436-A-T DYZ19 ***
22267670-T-C 20105784-T-C DYZ19 ***
22273581-T-G 20111695-T-G DYZ19 ***
22274733-G-T 20112847-G-T DYZ19 ***
22303520-A-T 20141634-A-T DYZ19 ***
22315968-T-G 20154082-T-G DYZ19 ***
22315969-G-T 20154083-G-T DYZ19 ***
20927148-T-G 18765262-T-G P4_Dst ***
20913317-C-A 18751431-C-A P4_Dst ***
22341578-G-A 20179692-G-A DYZ19 ***
20199976-T-A 18038090-T-A P5_Dst ***
20199946-T-A 18038060-T-A P5_Dst ***
20199950-A-T 18038064-A-T P5_Dst ***
20199958-C-T 18038072-C-T P5_Dst ***
20199968-G-A 18038082-G-A P5_Dst ***
20199972-T-C 18038086-T-C P5_Dst ***
20199974-C-A 18038088-C-A P5_Dst ***
20199975-A-T 18038089-A-T P5_Dst ***
20199979-G-A 18038093-G-A P5_Dst ***
20197222-T-C 18035336-T-C P5_Dst ***
20199991-T-C 18038105-T-C P5_Dst ***
20199992-C-T 18038106-C-T P5_Dst ***
20199993-T-C 18038107-T-C P5_Dst ***
20199994-C-A 18038108-C-A P5_Dst ***
20199996-T-A 18038110-T-A P5_Dst ***
20201331-G-T 18039445-G-T P5_Dst ***
20213623-T-A 18051737-T-A P5_Dst ***
20198587-T-G 18036701-T-G P5_Dst ***
20134418-C-T 18022538-C-T P5_Dst ***
20217481-A-C 18055595-A-C P5_Dst ***
20062536-C-T 17950656-C-T P5_Prx ***
20025459-C-T 17913579-C-T P5_Prx ***
20025462-T-C 17913582-T-C P5_Prx ***
20025464-T-C 17913584-T-C P5_Prx ***
20025475-C-T 17913595-C-T P5_Prx ***
20045200-C-A 17933320-C-A P5_Prx ***
20057778-A-G 17945898-A-G P5_Prx ***
20057782-T-C 17945902-T-C P5_Prx ***
20062538-G-T 17950658-G-T P5_Prx ***
20110588-T-A 17998708-T-A P5_Dst ***
20062576-G-T 17950696-G-T P5_Prx ***
20084538-A-T 17972658-A-T P5_Dst ***
20104118-A-G 17992238-A-G P5_Dst ***
20110583-G-A 17998703-G-A P5_Dst ***
20110584-C-A 17998704-C-A P5_Dst ***
20110585-G-A 17998705-G-A P5_Dst ***
20110586-T-A 17998706-T-A P5_Dst ***
20110587-T-A 17998707-T-A P5_Dst ***
20214435-C-T 18052549-C-T P5_Dst ***
20230788-T-C 18068902-T-C P5_Dst ***
20888641-T-A 18726755-T-A P4_Dst ***
20598415-C-T 18436529-C-T P5_Dst ***
20447811-T-A 18285925-T-A P5_Dst ***
20452414-T-G 18290528-T-G P5_Dst ***
20497224-G-C 18335338-G-C P5_Dst ***
20500986-A-G 18339100-A-G P5_Dst ***
20500993-T-C 18339107-T-C P5_Dst ***
20508973-C-A 18347087-C-A P5_Dst ***
20587756-C-A 18425870-C-A P5_Dst ***
20653986-T-G 18492100-T-G P4_Prx ***
20447748-A-C 18285862-A-C P5_Dst ***
20654063-G-C 18492177-G-C P4_Prx ***
20703678-C-T 18541792-C-T P4_Prx ***
20800140-C-A 18638254-C-A P4_Prx ***
20845289-A-T 18683403-A-T P4_Dst ***
20845295-A-T 18683409-A-T P4_Dst ***
20868988-C-A 18707102-C-A P4_Dst 10×T***
20886833-G-A 18724947-G-A P4_Dst ***
20447749-C-T 18285863-C-T P5_Dst ***
20447741-A-C 18285855-A-C P5_Dst ***
20230838-T-C 18068952-T-C P5_Dst ***
20252827-T-A 18090941-T-A P5_Dst ***
20230845-A-G 18068959-A-G P5_Dst ***
20230851-T-G 18068965-T-G P5_Dst ***
20242939-C-T 18081053-C-T P5_Dst ***
20243005-A-C 18081119-A-C P5_Dst ***
20252821-G-A 18090935-G-A P5_Dst ***
20252822-C-A 18090936-C-A P5_Dst ***
20252825-G-A 18090939-G-A P5_Dst ***
20252829-G-A 18090943-G-A P5_Dst ***
20440369-A-G 18278483-A-G P5_Dst ***
20255008-T-G 18093122-T-G P5_Dst ***
20311687-T-A 18149801-T-A P5_Dst ***
20332069-T-A 18170183-T-A P5_Dst ***
20340135-C-T 18178249-C-T P5_Dst 26×T***
20340704-G-T 18178818-G-T P5_Dst ***
20347965-C-A 18186079-C-A P5_Dst ***
20404559-T-G 18242673-T-G P5_Dst ***
20432812-G-T 18270926-G-T P5_Dst ***
22341567-C-A 20179681-C-A DYZ19 ***
22341586-G-C 20179700-G-C DYZ19 ***
25165697-G-C 23019550-G-C g1 ***
24671242-A-G 22525095-A-G P3_b2 ***
24636366-T-A 22490219-T-A P3_t2 ***
24662330-A-T 22516183-A-T P3_b2 ***
24662335-C-T 22516188-C-T P3_b2 ***
24662375-T-A 22516228-T-A P3_b2 ***
24665119-G-T 22518972-G-T P3_b2 ***
24666956-T-G 22520809-T-G P3_b2 ***
24671239-G-C 22525092-G-C P3_b2 ***
24673110-G-T 22526963-G-T P3_b2 ***
24629582-G-A 22483435-G-A P3_t2 ***
24674335-G-T 22528188-G-T P3_b2 ***
24681606-A-T 22535459-A-T P3_b2 ***
24694518-T-G 22548371-T-G P3_b2 ***
24712715-C-A 22566568-C-A P3_b2 ***
24714119-C-A 22567972-C-A P3_b2 ***
24715716-C-T 22569569-C-T P3_b2 ***
24728585-A-C 22582438-A-C P3_b2 ***
24636365-T-A 22490218-T-A P3_t2 ***
24623430-G-A 22477283-G-A P3_t2 ***
24728615-A-T 22582468-A-T P3_b2 ***
24472464-T-C 22326317-T-C ***
24420945-C-T 22274798-C-T ***
24420946-C-T 22274799-C-T ***
24420952-C-T 22274805-C-T ***
24420953-G-T 22274806-G-T ***
24420962-A-T 22274815-A-T ***
24420963-C-T 22274816-C-T ***
24472448-A-T 22326301-A-T ***
24548198-T-C 22402051-T-C P3_t2 ***
24614167-A-C 22468020-A-C P3_t2 ***
24548204-A-T 22402057-A-T P3_t2 ***
24562469-T-C 22416322-T-C P3_t2 ***
24575810-A-T 22429663-A-T P3_t2 ***
24575836-A-G 22429689-A-G P3_t2 ***
24575839-C-T 22429692-C-T P3_t2 ***
24577803-T-A 22431656-T-A P3_t2 ***
24582563-G-A 22436416-G-A P3_t2 ***
24728594-T-C 22582447-T-C P3_b2 ***
24728632-T-C 22582485-T-C P3_b2 ***
24420937-C-T 22274790-C-T ***
24878363-G-C 22732216-G-C g1 ***
24878354-C-G 22732207-C-G g1 ***
24878355-T-A 22732208-T-A g1 ***
24878356-G-A 22732209-G-A g1 ***
24878357-G-C 22732210-G-C g1 ***
24878360-A-G 22732213-A-G g1 ***
24878361-C-G 22732214-C-G g1 ***
24878362-A-G 22732215-A-G g1 ***
24878366-A-C 22732219-A-C g1 ***
24878352-A-C 22732205-A-C g1 ***
24878367-C-A 22732220-C-A g1 ***
24878368-A-T 22732221-A-T g1 ***
24883551-A-G 22737404-A-G g1 ***
24919558-A-T 22773411-A-T g1 ***
25127486-C-T 22981339-C-T g1 ***
25127490-A-C 22981343-A-C g1 ***
25127495-G-T 22981348-G-T g1 ***
24878353-T-A 22732206-T-A g1 ***
24878351-T-A 22732204-T-A g1 ***
24749003-T-A 22602856-T-A P3_b2 ***
24778841-A-C 22632694-A-C P3_b2 ***
24749023-T-C 22602876-T-C P3_b2 ***
24754972-T-A 22608825-T-A P3_b2 ***
24762202-T-C 22616055-T-C P3_b2 ***
24762341-A-C 22616194-A-C P3_b2 ***
24775578-T-C 22629431-T-C P3_b2 ***
24778462-T-C 22632315-T-C P3_b2 ***
24778804-A-G 22632657-A-G P3_b2 ***
24778872-G-A 22632725-G-A P3_b2 ***
24878350-A-G 22732203-A-G g1 ***
24778874-G-A 22632727-G-A P3_b2 ***
24778890-C-A 22632743-C-A P3_b2 ***
24783607-G-T 22637460-G-T P3_b2 ***
24794427-T-G 22648280-T-G P3_b2 ***
24796612-G-T 22650465-G-T P3_b2 ***
24878340-C-G 22732193-C-G g1 ***
24878341-T-G 22732194-T-G g1 ***
24878344-A-T 22732197-A-T g1 ***
24420941-G-T 22274794-G-T ***
24420933-C-T 22274786-C-T ***
22341711-G-A 20179825-G-A DYZ19 ***
22802916-G-T 20641030-G-T ***
22602423-A-G 20440537-A-G ***
22739614-G-A 20577728-G-A ***
22802908-G-T 20641022-G-T ***
22802909-G-T 20641023-G-T ***
22802911-C-T 20641025-C-T ***
22802913-C-T 20641027-C-T ***
22802914-C-T 20641028-C-T ***
22802917-C-T 20641031-C-T ***
22520564-A-G 20358678-A-G ***
22802918-C-T 20641032-C-T ***
22802919-A-T 20641033-A-T ***
22802921-A-T 20641035-A-T ***
22802922-A-T 20641036-A-T ***
22802923-G-T 20641037-G-T ***
22802924-G-T 20641038-G-T ***
22802926-G-T 20641040-G-T ***
22520585-G-C 20358699-G-C ***
22520558-G-A 20358672-G-A ***
22802930-C-T 20641044-C-T ***
22435197-G-A 20273311-G-A DYZ19 ***
22345689-G-T 20183803-G-T DYZ19 ***
22358798-T-G 20196912-T-G DYZ19 ***
22359508-T-C 20197622-T-C DYZ19 ***
22431994-C-T 20270108-C-T DYZ19 ***
22431996-C-A 20270110-C-A DYZ19 ***
22435171-A-G 20273285-A-G DYZ19 ***
22435177-T-G 20273291-T-G DYZ19 ***
22435209-T-G 20273323-T-G DYZ19 ***
22520557-G-C 20358671-G-C ***
22456848-C-A 20294962-C-A DYZ19 ***
22481310-G-T 20319424-G-T DYZ19 ***
22485798-T-C 20323912-T-C DYZ19 ***
22498472-T-A 20336586-T-A DYZ19 ***
22502778-T-C 20340892-T-C A4404 DYZ19 ***
22508107-T-C 20346221-T-C DYZ19 ***
22520548-G-C 20358662-G-C ***
22520555-A-G 20358669-A-G ***
22802927-G-T 20641041-G-T ***
22816340-C-G 20654454-C-G ***
24353321-T-C 22207174-T-C P3_t1 ***
24084247-T-C 21938100-T-C P3_b1 ***
24046192-T-G 21900045-T-G ***
24060333-C-A 21914186-C-A P3_b1 ***
24084193-A-C 21938046-A-C P3_b1 ***
24084198-T-C 21938051-T-C P3_b1 ***
24084207-A-C 21938060-A-C P3_b1 ***
24084229-A-C 21938082-A-C P3_b1 ***
24084237-A-C 21938090-A-C P3_b1 ***
24084251-A-C 21938104-A-C P3_b1 ***
24044366-A-C 21898219-A-C ***
24116397-T-G 21970250-T-G P3_b1 ***
24192261-T-A 22046114-T-A P3_b1 ***
24216307-G-T 22070160-G-T P3_b1 ***
24341755-T-G 22195608-T-G P3_t1 ***
24353314-A-C 22207167-A-C P3_t1 ***
24353317-A-C 22207170-A-C P3_t1 ***
24353319-T-C 22207172-T-C P3_t1 ***
24044842-G-T 21898695-G-T ***
24042923-A-G 21896776-A-G ***
22816341-T-G 20654455-T-G ***
23807520-G-C 21645634-G-C ***
23181428-T-A 21019542-T-A ***
23223282-T-A 21061396-T-A ***
23488834-T-A 21326948-T-A 30×A***
23693647-G-A 21531761-G-A ***
23742316-C-A 21580430-C-A ***
23779785-A-T 21617899-A-T ***
23779795-G-A 21617909-G-A ***
23816070-C-A 21654184-C-A ***
24041125-T-G 21894978-T-G ***
23831286-A-G 21669400-A-G ***
24022644-A-C 21876497-A-C ***
24023811-T-A 21877664-T-A ***
24025025-T-G 21878878-T-G ***
24034018-A-G 21887871-A-G ***
24039543-A-C 21893396-A-C ***
24039589-A-C 21893442-A-C ***
24041089-T-G 21894942-T-G ***
28491360-T-A 26345213-T-A ***
28808695-A-T 26662548-A-T ***
28491362-A-G 26345215-A-G ***
24668845-AT-A 22522698-AT-A P3_b2 11×T***
24582515-CAAAA-C 22436368-CAAAA-C P3_t2 31×A***
24582837-CA-C 22436690-CA-C P3_t2 17×A***
24600670-C-CA 22454523-C-CA P3_t2 16×A***
24604697-AT-A 22458550-AT-A P3_t2 11×T***
24607321-C-CT 22461174-C-CT P3_t2 12×T***
24637476-TTGTG-T 22491329-TTGTG-T P3_t2 11×TG***
24665186-AT-A 22519039-AT-A P3_b2 ***
24675448-C-CT 22529301-C-CT P3_b2 12×T***
24582352-C-CT 22436205-C-CT P3_t2 17×T***
24684828-TAC-T 22538681-TAC-T P3_b2 15×AC***
24736119-CA-C 22589972-CA-C P3_b2 11×A***
24771309-TC-T 22625162-TC-T P3_b2 ***
24773126-T-TA 22626979-T-TA P3_b2 10×A***
24783187-AGAGT-A 22637040-AGAGT-A P3_b2 ***
24785778-C-CT 22639631-C-CT P3_b2 14×T***
24859445-CTTGAATAAAATACTATT-C 22713298-CTTGAATAAAATACTATT-C P3_b2 ***
24582504-ACCT-CCCC 22436357-ACCT-CCCC P3_t2 ***
24573423-CTT-C 22427276-CTT-C P3_t2 21×T***
24866990-A-AT 22720843-A-AT P3_b2 11×T***
22504216-TT-G 20342330-TT-G DYZ19 ***
22341511-TTTCG-GTTCT 20179625-TTTCG-GTTCT DYZ19 ***
22421369-ATG-TTC 20259483-ATG-TTC DYZ19 ***
22421423-GT-G 20259537-GT-G DYZ19 ***
22431987-GTC-TTA 20270101-GTC-TTA DYZ19 ***
22481328-TTTAG-GTTAT 20319442-TTTAG-GTTAT DYZ19 ***
22481343-TG-T 20319457-TG-T DYZ19 ***
22490746-GT-TC 20328860-GT-TC DYZ19 ***
22505199-TG-GT 20343313-TG-GT DYZ19 ***
24542299-CA-C 22396152-CA-C P3_t2 ***
22505253-GG-TC 20343367-GG-TC DYZ19 ***
22703626-G-AA 20541740-G-AA ***
24014304-AACAGTGATTAATATAAAG-A 21868157-AACAGTGATTAATATAAAG-A ***
24025840-GAA-G 21879693-GAA-G 9×A***
24044865-AT-A 21898718-AT-A ***
24278325-AGGGAGGGAAGGAAGGAAGG-GGAAGGAAGGGAAGGAAGGA 22132178-AGGGAGGGAAGGAAGGAAGG-GGAAGGAAGGGAAGGAAGGA P3_b1 ***
24525866-TA-T 22379719-TA-T P3_t2 9×A***
24860046-G-AA 22713899-G-AA P3_b2 ***
25177324-TAC-AAA 23031177-TAC-AAA g1 ***
22338103-ATG-GTC 20176217-ATG-GTC DYZ19 ***
25995492-GTATA-G 23849345-GTATA-G P1_Y1 24×TA***
25684273-G-GA 23538126-G-GA P1_b3 10×A***
25689061-C-CA 23542914-C-CA P1_b3 9×A***
25706148-CA-C 23560001-CA-C P1_b3 16×A***
25718213-G-GTT 23572066-G-GTT P1_b3 13×T***
25845045-TTC-AAA 23698898-TTC-AAA P1_b3 ***
25940445-C-CT 23794298-C-CT P1_Y1 17×T***
25990634-GTTTTT-G 23844487-GTTTTT-G P1_Y1 23×T***
26004895-G-GT 23858748-G-GT P1_Y1 10×T***
25675782-T-TA 23529635-T-TA P1_b3 12×A***
26120152-T-TCCTA 23974005-T-TCCTA P1_Y1 ***
26120162-C-CTTCT 23974015-C-CTTCT P1_Y1 ***
26228677-CTTTCTTTCTTTC-TTTTTTTTTT 24082530-CTTTCTTTCTTTC-TTTTTTTTTT P1_Y1 ***
26267693-TAC-AA 24121546-TAC-AA P1_Y1 ***
26277717-G-TT 24131570-G-TT P1_Y1 ***
26283209-C-CA 24137062-C-CA P1_Y1 21×A***
26284858-CA-C 24138711-CA-C P1_Y1 19×A***
25675939-T-TA 23529792-T-TA P1_b3 10×A***
25663035-CT-C 23516888-CT-C P1_b3 ***
25300414-CA-C 23154267-CA-C P2_r1 8×A***
25431153-C-CT 23285006-C-CT P2_r2 11×T***
25301996-CT-C 23155849-CT-C P2_r1 ***
25306677-CA-C 23160530-CA-C P2_r1 ***
25310157-AAG-A 23164010-AAG-A P2_r1 ***
25378984-GTCC-TT 23232837-GTCC-TT P2_r2 ***
25388480-CT-C 23242333-CT-C P2_r2 ***
25395700-TCC-T 23249553-TCC-T P2_r2 ***
25424574-C-CT 23278427-C-CT P2_r2 17×T***
25434990-TA-T 23288843-TA-T P2_r2 ***
25617175-TTG-T 23471028-TTG-T P1_gr1 19×TG***
25437894-T-TA 23291747-T-TA P2_r2 12×A***
25447269-GGTAGTA-G 23301122-GGTAGTA-G P2_r2 9×GTA***
25479931-TA-T 23333784-TA-T P2_r2 ***
25493225-CT-C 23347078-CT-C P2_r2 ***
25514627-CT-C 23368480-CT-C P1_gr1 13×T***
25537117-G-GT 23390970-G-GT P1_gr1 10×T***
25545770-C-CT 23399623-C-CT P1_gr1 13×T***
25567552-AT-A 23421405-AT-A P1_gr1 17×T***
22338124-GGGCT-TGGCA 20176238-GGGCT-TGGCA DYZ19 ***
22337983-TA-GT 20176097-TA-GT DYZ19 ***
26379434-G-AA 24233287-G-AA P1_Y1 ***
20300694-C-CA 18138808-C-CA P5_Dst ***
20230825-TCCC-ACCT 18068939-TCCC-ACCT P5_Dst ***
20231615-GG-A 18069729-GG-A P5_Dst ***
20242175-TA-T 18080289-TA-T P5_Dst 8×A***
20243015-GTTTGTTTT-TTTTTTTTA 18081129-GTTTGTTTT-TTTTTTTTA P5_Dst ***
20274242-CT-C 18112356-CT-C P5_Dst ***
20291027-T-TA 18129141-T-TA P5_Dst 11×A***
20295499-C-CT 18133613-C-CT P5_Dst 11×T***
20333189-C-CA 18171303-C-CA P5_Dst 17×A***
20230152-TAA-T 18068266-TAA-T P5_Dst 16×A***
20340720-T-TAA 18178834-T-TAA P5_Dst 15×A***
20348763-GT-G 18186877-GT-G P5_Dst 9×T***
20364225-CT-C 18202339-CT-C P5_Dst 11×T***
20391948-G-GA 18230062-G-GA P5_Dst 11×A***
20404445-CAAAA-C 18242559-CAAAA-C P5_Dst 29×A***
20413787-TA-T 18251901-TA-T P5_Dst 12×A***
20440392-T-TTTGTTG 18278506-T-TTTGTTG P5_Dst 13×TTG***
20230813-CAGACAGC-TAGATAGT 18068927-CAGACAGC-TAGATAGT P5_Dst ***
20229254-G-GT 18067368-G-GT P5_Dst 15×T***
20500941-GGA-G 18339055-GGA-G P5_Dst ***
19930469-GC-TT 17818589-GC-TT P5_Prx ***
19713183-CT-C 17601303-CT-C P5_Prx 17×T***
19726191-TA-T 17614311-TA-T P5_Prx 12×A***
19727387-TG-CC 17615507-TG-CC P5_Prx ***
19727393-TA-CC 17615513-TA-CC P5_Prx ***
19739351-A-ACAACAG 17627471-A-ACAACAG P5_Prx ***
19829290-GTTTACTTTC-TTTTTTTTTT 17717410-GTTTACTTTC-TTTTTTTTTT P5_Prx ***
19839643-G-AA 17727763-G-AA P5_Prx ***
19948161-CCCTCCCTCCCTCCCTCCCTC-T 17836281-CCCTCCCTCCCTCCCTCCCTC-T P5_Prx ***
20221481-G-GA 18059595-G-GA P5_Dst 10×A***
20084142-TAGAG-T 17972262-TAGAG-T P5_Dst 13×AG***
20087764-GAA-G 17975884-GAA-G P5_Dst 13×A***
20110156-AT-A 17998276-AT-A P5_Dst ***
20110561-G-GA 17998681-G-GA P5_Dst 20×A***
20130786-C-CA 18018906-C-CA P5_Dst 16×A***
20194619-AT-A 18032733-AT-A P5_Dst 8×T***
20217433-GCCT-CCCC 18055547-GCCT-CCCC P5_Dst ***
20217548-CT-C 18055662-CT-C P5_Dst ***
20497215-ACCCA-CCCCC 18335329-ACCCA-CCCCC P5_Dst ***
20587808-AAT-A 18425922-AAT-A P5_Dst 10×AT***
22337965-ACTTT-CCTTC 20176079-ACTTT-CCTTC DYZ19 ***
22245569-AGCTA-TGTTG 20083683-AGCTA-TGTTG DYZ19 ***
21132667-GTCTACATTTCTGTG-TTTTTTTTTTTTTTT 18970781-GTCTACATTTCTGTG-TTTTTTTTTTTTTTT ***
21170319-G-GTT 19008433-G-GTT 14×T***
21569953-GTC-G 19408067-GTC-G ***
21714802-T-AA 19552916-T-AA ***
21894633-CAAAAA-C 19732747-CAAAAA-C 15×A***
22234333-TAT-AC 20072447-TAT-AC DYZ19 ***
22244982-GTTATATCCAGAGTTTCTTC-CTGCAGCATCATTCTTGAAG 20083096-GTTATATCCAGAGTTTCTTC-CTGCAGCATCATTCTTGAAG DYZ19 ***
22245578-CATTTA-GCTTTG 20083692-CATTTA-GCTTTG DYZ19 ***
21022787-GA-G 18860901-GA-G P4_Dst 11×A***
22247019-AGTC-TCTA 20085133-AGTC-TCTA DYZ19 ***
22269595-TTCG-ATTA 20107709-TTCG-ATTA DYZ19 ***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
22273575-TTACA-GTTAC 20111689-TTACA-GTTAC DYZ19 ***
22300778-GGC-AGT 20138892-GGC-AGT DYZ19 ***
22300832-AGG-GGT 20138946-AGG-GGT DYZ19 ***
22337788-ACCTC-TCCTT 20175902-ACCTC-TCCTT DYZ19 ***
21030546-T-TA 18868660-T-TA P4_Dst 13×A***
21013084-A-AT 18851198-A-AT P4_Dst 14×T***
20598479-TA-T 18436593-TA-T P5_Dst ***
20917254-CA-C 18755368-CA-C P4_Dst 14×A***
20613609-CT-C 18451723-CT-C P4_Prx 13×T***
20655016-ATATATA-G 18493130-ATATATA-G P4_Prx ***
20717039-C-AA 18555153-C-AA P4_Prx 35×A***
20848244-A-AT 18686358-A-AT P4_Dst 19×T***
20859789-G-GA 18697903-G-GA P4_Dst 13×A***
20868938-CAACATGTG-AAAAATATT 18707052-CAACATGTG-AAAAATATT P4_Dst ***
20914498-C-CAAA 18752612-C-CAAA P4_Dst 12×A***
20949797-GGAAAG-AGGCAC 18787911-GGAAAG-AGGCAC P4_Dst ***
21008949-TTTTG-T 18847063-TTTTG-T P4_Dst 4×TTTG***
20949887-AAGC-CAGT 18788001-AAGC-CAGT P4_Dst ***
20949903-TCC-CCT 18788017-TCC-CCT P4_Dst ***
20951141-GAAAG-AAAAA 18789255-GAAAG-AAAAA P4_Dst ***
20951557-TTCA-T 18789671-TTCA-T P4_Dst ***
20963889-T-TA 18802003-T-TA P4_Dst ***
20970352-C-CA 18808466-C-CA P4_Dst 12×A***
20989154-CATATAT-C 18827268-CATATAT-C P4_Dst 19×AT***
20989908-C-CT 18828022-C-CT P4_Dst 11×T***
26320658-TA-T 24174511-TA-T P1_Y1 14×A***
26383340-CTT-C 24237193-CTT-C P1_Y1 16×T***
19513143-CTTTTTT-C 17401263-CTTTTTT-C 20×T***
58823679-TCCATTTGATGCCATC-T 56767172-CATGGGATGGCATCAA-C ***
58820173-GAGTCCTTTCCAGTA-CTTTCCATTCGAGTG 56770684-TACTGGAAAGGACTC-CACTCGAATGGAAAG ***
58820199-AATCCCATCCAATCCCATCTACTCC-GTTCCATTTCTTTCCGTTCTGTACG 56770648-GGAGTAGATGGGATTGGATGGGATT-CGTACAGAACGGAAAGAAATGGAAC ***
58820228-AATTCCTTTCCATTC-CTACCGTTCGATTT 56770629-GAATGGAAAGGAATT-AAATCGAACGGTAG ***
58820505-CGTTCT-TATTCC 56770361-AGAACG-GGAATA ***
58820551-ATTCGTGTTGAT-GGTCCATTACAG 56770309-ATCAACACGAAT-CTGTAATGGACC ***
58820956-GAGTCC-CATTTG 56769910-GGACTC-CAAATG ***
58822019-GTCCATTAGTTTCGACTCCATTGCATTCGAGTGCATTCCATTCCGTGGCTGTC-ATTCAATTCCGTTCTATCCGATTCCATTCCATTCTATTCCTTTCCTTTCAATT 56768800-GACAGCCACGGAATGGAATGCACTCGAATGCAATGGAGTCGAAACTAATGGAC-AATTGAAAGGAAAGGAATAGAATGGAATGGAATCGGATAGAACGGAATTGAAT ***
58823840-TG-AT 56767030-CA-AT ***
58819399-CTTG-ATTC 56771469-CAAG-GAAT ***
58831196-TT-CC 56759674-AA-GG ***
58831878-A-ATTGCC 56758988-T-TGCAAG ***
58831921-AA-TC 56758949-TT-GA ***
58843055-CTTTGG-C 56747810-TCCAAA-T ***
58858827-CA-C 56732042-GT-G ***
58858972-GATTTTATTGCATTAGATTCTATTC-TGTGACACAAGCTGGAGTGCAGTAG 56731875-GAATAGAATCTAATGCAATAAAATC-CTACTGCACTCCAGCTTGTGTCACA ***
58866021-C-CCCATTCCATTCCATT 56724789-C-CAATGGAATGGAATGG 12×CCATT***
58819805-GTCGA-TTCGG 56771062-TCGAC-CCGAA ***
28819013-TAAG-GAAA 26672866-TAAG-GAAA ***
58912765-ATG-TTC 56678104-CAT-GAA ***
28245714-AT-A 26099567-AT-A P1_b4 15×T***
28065155-CT-C 25919008-CT-C P1_Y2 15×T***
28102968-C-CT 25956821-C-CT P1_Y2 8×T***
28142037-AT-A 25995890-AT-A P1_b4 9×T***
28170992-GA-G 26024845-GA-G P1_b4 ***
28180701-CA-C 26034554-CA-C P1_b4 16×A***
28185939-G-GT 26039792-G-GT P1_b4 12×T***
28226238-C-CT 26080091-C-CT P1_b4 13×T***
28253555-TGAAGCT-AAAAAAA 26107408-TGAAGCT-AAAAAAA P1_b4 ***
28802816-ATGGGT-GAGTAA 26656669-ATGGGT-GAGTAA ***
28260208-CT-C 26114061-CT-C P1_b4 13×T***
28360492-T-TA 26214345-T-TA P1_gr2 13×A***
28384225-T-TA 26238078-T-TA P1_gr2 13×A***
28406839-CAA-C 26260692-CAA-C P1_gr2 16×A***
28588050-CATC-T 26441903-CATC-T ***
28588302-TGA-CGG 26442155-TGA-CGG ***
28802650-GGTGAAT-CGTGGAG 26656503-GGTGAAT-CGTGGAG ***
58890988-TC-AT 56699882-GA-AT ***
58912818-GATG-CATT 56678050-CATC-AATG ***
28030763-T-TCTTG 25884616-T-TCTTG P1_Y2 ***
19775300-GTCTT-G 17663420-GTCTT-G P5_Prx ***
59030571-TT-AA 56884424-TT-AA ***
59031759-TCT-ACC 56885612-TCT-ACC ***
13141938-T-TTCCAC 10631424-T-TTCCAC 4×TCCAC***
13545349-AAAGAAAG-A 11389673-AAAGAAAG-A ***
14324892-TTC-T 12204186-TTC-T ***
14937846-T-TTCTTTTCTGA 12825921-T-TTCTTTTCTGA ***
14937853-C-CTTTTCTTTTA 12825928-C-CTTTTCTTTTA ***
19868141-GCTT-G 17756261-GCTT-G P5_Prx ***
58987988-AAACC-TAACG 56841841-AAACC-TAACG ***
21477779-AAG-A 19315893-AAG-A ***
24296169-GC-G 22150022-GC-G P3_t1 ***
25176848-TTC-T 23030701-TTC-T g1 ***
25323010-ACT-A 23176863-ACT-A P2_r1 ***
25333855-AC-A 23187708-AC-A P2_r1 ***
26463094-TTTC-T 24316947-TTTC-T P1_Y1 ***
26810593-TTC-T 24664446-TTC-T P1_g2 ***
59008112-GTTC-TTTT 56861965-GTTC-TTTT ***
58987979-TAC-AAG 56841832-TAC-AAG ***
58912831-TTGATG-T 56678034-GCATCA-G ***
58977578-TTGCAT-CTCCAC 56831431-TTGCAT-CTCCAC ***
58912846-GA-TC 56678024-TC-GA ***
58974223-TTCG-ATCC 56828076-TTCG-ATCC ***
58974241-AAATCAAT-CCCTCCAC 56828094-AAATCAAT-CCCTCCAC ***
58976137-CTCCAG-ATCCGT 56829990-CTCCAG-ATCCGT ***
58976348-CACAT-TCCAC 56830201-CACAT-TCCAC ***
58977556-TG-CA 56831409-TG-CA ***
58977571-AT-CA 56831424-AT-CA ***
58977589-CCCAC-TCCAT 56831442-CCCAC-TCCAT ***
58987918-TG-CA 56841771-TG-CA ***
58977738-CATTG-AATTA 56831591-CATTG-AATTA ***
58977817-CC-GA 56831670-CC-GA ***
58979078-TTCCA-CTCCT 56832931-TTCCA-CTCCT ***
58980486-ACCA-GCCG 56834339-ACCA-GCCG ***
58981256-GG-CA 56835109-GG-CA ***
58982110-GCAC-CCAT 56835963-GCAC-CCAT ***
58985427-GGG-AGA 56839280-GGG-AGA ***
58985437-TCTGC-CCTGT 56839290-TCTGC-CCTGT ***
28052861-CT-C 25906714-CT-C P1_Y2 ***
27996899-GTTAT-G 25850752-GTTAT-G P1_Y2 ***
26400705-AT-A 24254558-AT-A P1_Y1 15×T***
27229875-GACTAA-G 25083728-GACTAA-G P1_g3 ***
27134689-TA-T 24988542-TA-T P1_g3 10×A***
27147072-AT-A 25000925-AT-A P1_g3 ***
27147441-A-AT 25001294-A-AT P1_g3 12×T***
27155035-CGT-C 25008888-CGT-C P1_g3 17×GT***
27165197-A-AT 25019050-A-AT P1_g3 11×T***
27166686-G-GA 25020539-G-GA P1_g3 11×A***
27186323-G-GA 25040176-G-GA P1_g3 19×A***
27232108-GTTTTTTCTTTCT-G 25085961-GTTTTTTCTTTCT-G P1_g3 ***
27125405-CAAAGCAGAG-C 24979258-CAAAGCAGAG-C P1_g3 ***
27235637-C-CT 25089490-C-CT P1_g3 8×T***
27248568-GTTT-G 25102421-GTTT-G P1_g3 18×T***
27295701-TA-T 25149554-TA-T P1_g3 ***
27299410-AT-A 25153263-AT-A P1_g3 9×T***
27301679-AT-A 25155532-AT-A P1_g3 9×T***
27311771-TA-T 25165624-TA-T P1_g3 9×A***
27320941-A-ATT 25174794-A-ATT P1_g3 11×T***
27129771-CAA-C 24983624-CAA-C P1_g3 25×A***
27062945-GGTAGTA-G 24916798-GGTAGTA-G P1_r4 11×GTA***
27398533-AG-A 25252386-AG-A P1_g3 ***
26907510-A-AT 24761363-A-AT P1_r3 22×T***
26495702-CTTTG-TTTTT 24349555-CTTTG-TTTTT P1_Y1 ***
26593442-CT-C 24447295-CT-C P1_g2 11×T***
26626273-AT-A 24480126-AT-A P1_g2 9×T***
26880198-CT-C 24734051-CT-C P1_r3 25×T***
26900719-GA-G 24754572-GA-G P1_r3 17×A***
26902316-AAAAAG-A 24756169-AAAAAG-A P1_r3 ***
26902325-TAG-AAA 24756178-TAG-AAA P1_r3 ***
26914241-ACTA-TCTT 24768094-ACTA-TCTT P1_r3 ***
27049850-AT-A 24903703-AT-A P1_r4 17×T***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
26953164-AAG-A 24807017-AAG-A P1_r3 ***
26991220-GAAAG-AAAAA 24845073-GAAAG-AAAAA P1_r4 ***
26991363-AAAAG-A 24845216-AAAAG-A P1_r4 ***
27001771-CTTT-C 24855624-CTTT-C P1_r4 24×T***
27004222-CTT-C 24858075-CTT-C P1_r4 25×T***
27037868-C-CT 24891721-C-CT P1_r4 13×T***
27046828-CT-C 24900681-CT-C P1_r4 10×T***
27346296-T-TTGC 25200149-T-TTGC P1_g3 ***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
27996127-G-GA 25849980-G-GA P1_Y2 14×A***
27880454-CA-C 25734307-CA-C P1_Y2 ***
27838277-AGCA-TGCT 25692130-AGCA-TGCT P1_Y2 ***
27844492-ATA-TTT 25698345-ATA-TTT P1_Y2 ***
27844515-ATTTATTTC-TTTTTTTTT 25698368-ATTTATTTC-TTTTTTTTT P1_Y2 ***
27844536-GTTA-TTT 25698389-GTTA-TTT P1_Y2 ***
27866070-C-CT 25719923-C-CT P1_Y2 10×T***
27868124-CA-C 25721977-CA-C P1_Y2 13×A***
27873284-CTCTTTC-TTTTTTT 25727137-CTCTTTC-TTTTTTT P1_Y2 ***
27896007-CA-C 25749860-CA-C P1_Y2 12×A***
27832305-A-AT 25686158-A-AT P1_Y2 17×T***
27909479-TA-T 25763332-TA-T P1_Y2 ***
27949379-C-CA 25803232-C-CA P1_Y2 13×A***
27971749-AAAAAC-A 25825602-AAAAAC-A P1_Y2 ***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAA 25825609-CACACACACACAAAG-AAAAAAAAAAAAAAA P1_Y2 ***
27978560-A-AT 25832413-A-AT P1_Y2 14×T***
27988706-AT-A 25842559-AT-A P1_Y2 ***
27991626-GGA-G 25845479-GGA-G P1_Y2 13×GA***
27838074-ACTACAAA-TCTTCAAT 25691927-ACTACAAA-TCTTCAAT P1_Y2 ***
27819786-AT-A 25673639-AT-A P1_Y2 13×T***
27398546-GAAG-AAAA 25252399-GAAG-AAAA P1_g3 ***
27721225-AT-A 25575078-AT-A P1_Y2 ***
27412214-CA-C 25266067-CA-C P1_g3 8×A***
27583214-G-GT 25437067-G-GT P1_Y2 11×T***
27585915-GTC-T 25439768-GTC-T P1_Y2 ***
27602764-CATTA-TATTT 25456617-CATTA-TATTT P1_Y2 ***
27602804-AGC-GGG 25456657-AGC-GGG P1_Y2 ***
27643245-CT-C 25497098-CT-C P1_Y2 ***
27694706-ATT-A 25548559-ATT-A P1_Y2 28×T***
27728064-CACCTTATATGACTTTTTCAAATAAA-C 25581917-CACCTTATATGACTTTTTCAAATAAA-C P1_Y2 ***
27796697-TA-T 25650550-TA-T P1_Y2 8×A***
27728377-CA-C 25582230-CA-C P1_Y2 ***
27762778-TACAC-T 25616631-TACAC-T P1_Y2 17×AC***
27777759-GA-G 25631612-GA-G P1_Y2 19×A***
27785823-G-GAA 25639676-G-GAA P1_Y2 8×A***
27789487-T-TG 25643340-T-TG P1_Y2 8×G***
27794110-CT-C 25647963-CT-C P1_Y2 ***
27794677-C-CAT 25648530-C-CAT P1_Y2 12×AT***
27795119-CTA-C 25648972-CTA-C P1_Y2 ***
19693687-A-AT 17581807-A-AT P5_Prx 10×T***
19187441-ATACAC-TTTTT 17075561-ATACAC-TTTTT ***
28491372-T-A 26345225-T-A ***
58987950-C-A 56841803-C-A ***
58980812-A-C 56834665-A-C ***
58987902-C-G 56841755-C-G ***
58987918-T-C 56841771-T-C ***
58987919-G-A 56841772-G-A ***
58987924-T-C 56841777-T-C ***
58987931-C-T 56841784-C-T ***
58987939-G-C 56841792-G-C ***
58987966-T-C 56841819-T-C ***
58980806-T-A 56834659-T-A ***
58987979-T-A 56841832-T-A ***
58987988-A-T 56841841-A-T ***
58987992-C-G 56841845-C-G ***
58996146-G-T 56849999-G-T ***
58996999-A-C 56850852-A-C ***
59022405-A-C 56876258-A-C ***
59022406-T-C 56876259-T-C ***
58980811-C-A 56834664-C-A ***
58977673-G-T 56831526-G-T ***
59031759-T-A 56885612-T-A ***
58858929-T-C 56731942-A-G ***
58834702-C-T 56756169-G-A ***
58834721-C-A 56756150-G-T ***
58844584-T-C 56746287-A-G ***
58848222-T-A 56742649-A-T ***
58858789-G-T 56732082-C-A ***
58858918-A-T 56731953-T-A ***
58858922-C-A 56731949-G-T ***
58858931-G-T 56731940-C-A ***
58977576-C-A 56831429-C-A ***
58858932-C-T 56731939-G-A S3129 ***
58858948-A-C 56731923-T-G ***
58858999-T-C 56731872-A-G ***
58905230-T-G 56685641-A-C ***
58905347-A-T 56685524-T-A ***
58912803-G-T 56678068-C-A ***
58976464-C-G 56830317-C-G ***
59031692-C-T 56885545-C-T ***
24115164-CCACA-C 21969017-CCACA-C P3_b1 23×CA***
58831908-A-G 56758963-T-C ***
20428140-AT-A 18266254-AT-A P5_Dst 17×T***
9577017-C-CAA 9739408-C-CAA IR3_Prx 15×A***
24754928-TA-T 22608781-TA-T P3_b2 15×A***
13405369-TG-T 11249693-TG-T ***
9753975-CT-C 9916366-CT-C 20×T***
27760220-G-GT 25614073-G-GT P1_Y2 14×T***
24618868-C-CT 22472721-C-CT P3_t2 12×T***
4388469-C-CA 4520428-C-CA 14×A***
2806195-ATTTTT-A 2938154-ATTTTT-A 36×T***
28033129-CA-C 25886982-CA-C P1_Y2 17×A***
2861533-TCA-T 2993492-TCA-T ***
4031513-CAA-C 4163472-CAA-C 16×A***
4973668-C-CAA 5105627-C-CAA 19×A***
5937242-C-CTA 6069201-C-CTA 18×TA***
5945467-CTTTTTT-C 6077426-CTTTTTT-C 25×T***
6134454-CTTGGGCAGGGAAGGC-GGGGGGGGGGGGGGGG 6266413-CTTGGGCAGGGAAGGC-GGGGGGGGGGGGGGGG ***
6149994-TATGTGGGTGTG-CACACACATATA 6281953-TATGTGGGTGTG-CACACACATATA IR3_Dst ***
13859887-ATCGAA-CTGGAG 11739181-ATCGAA-CTGGAG ***
9559580-C-CT 9721971-C-CT IR3_Prx 11×T***
13488715-CA-GG 11333039-CA-GG ***
21182397-C-CT 19020511-C-CT 20×T***
28588259-ATG-TTA 26442112-ATG-TTA ***
16165136-GGA-G 14053256-GGA-G P8_Dst 13×GA***
15832207-TC-T 13720327-TC-T ***
24458760-C-CA 22312613-C-CA 18×A***
25542210-GCT-G 23396063-GCT-G P1_gr1 11×CT***
13488681-AGG-GGC 11333005-AGG-GGC ***
13488987-CAGGGT-TGGGGC 11333311-CAGGGT-TGGGGC ***
16150948-TA-T 14039068-TA-T P8_Dst 22×A***
5066020-T-TA 5197979-T-TA 10×A***
7032333-ATTTTTTT-A 7164292-ATTTTTTT-A 22×T***
20428495-AT-A 18266609-AT-A P5_Dst 15×T***
24562514-AGT-A 22416367-AGT-A P3_t2 ***
10014645-C-CTAAT 10177036-C-CTAAT 4×TAAT***
24290749-G-GCA 22144602-G-GCA P3_t1 20×CA***
19517906-TTTTG-T 17406026-TTTTG-T 6×TTTG***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
28017356-C-CA 25871209-C-CA P1_Y2 16×A***
58831972-T-C 56758899-A-G ***
58831893-A-G 56758978-T-C ***
6323750-C-CA 6455709-C-CA IR3_Dst 12×A***
28808696-A-G 26662549-A-G ***
28802536-G-A 26656389-G-A ***
28802541-T-A 26656394-T-A ***
28802543-G-T 26656396-G-T ***
28802561-A-G 26656414-A-G ***
28802562-T-A 26656415-T-A ***
28808694-G-A 26662547-G-A ***
20025443-C-T 17913563-C-T P5_Prx ***
28808697-A-G 26662550-A-G ***
28802529-A-G 26656382-A-G ***
28808698-T-A 26662551-T-A ***
28808699-T-A 26662552-T-A ***
28808700-G-T 26662553-G-T ***
28808701-A-G 26662554-A-G ***
28808702-A-G 26662555-A-G ***
28808703-T-A 26662556-T-A ***
28808704-G-A 26662557-G-A ***
28802532-T-A 26656385-T-A ***
28797875-T-A 26651728-T-A ***
28808706-A-G 26662559-A-G ***
28588314-A-G 26442167-A-G ***
28491374-T-A 26345227-T-A ***
28491380-G-A 26345233-G-A ***
28491381-A-G 26345234-A-G ***
28491385-C-A 26345238-C-A ***
28587961-C-A 26441814-C-A ***
28588302-T-C 26442155-T-C ***
28588304-A-G 26442157-A-G ***
28610336-G-A 26464189-G-A ***
28797872-G-T 26651725-G-T ***
28725917-C-A 26579770-C-A ***
28728418-C-A 26582271-C-A ***
28797860-G-T 26651713-G-T ***
28797862-G-T 26651715-G-T ***
28797865-G-A 26651718-G-A ***
28797868-A-G 26651721-A-G ***
28797869-A-C 26651722-A-C ***
28797870-G-A 26651723-G-A ***
28808705-G-T 26662558-G-T ***
28808710-A-T 26662563-A-T ***
58831870-G-T 56759001-C-A ***
58821720-T-A 56769151-A-T ***
58820492-G-T 56770379-C-A ***
58820496-A-T 56770375-T-A ***
58820499-C-A 56770372-G-T ***
58820535-T-G 56770336-A-C ***
58821675-C-T 56769196-G-A ***
58821687-A-T 56769184-T-A ***
58821706-G-C 56769165-C-G ***
58821721-C-T 56769150-G-A ***
28808740-A-C 26662593-A-C ***
58823347-C-A 56767524-G-T ***
58823348-A-T 56767523-T-A ***
58824853-C-G 56766018-G-C ***
58824854-C-T 56766017-G-A ***
58824863-C-A 56766008-G-T ***
58825403-T-A 56765468-A-T ***
58831858-A-C 56759013-T-G ***
58820192-T-C 56770679-A-G ***
28808739-G-T 26662592-G-T ***
28808711-A-C 26662564-A-C ***
28808724-G-A 26662577-G-A ***
28808712-T-A 26662565-T-A ***
28808713-G-T 26662566-G-T ***
28808714-G-C 26662567-G-C ***
28808716-A-T 26662569-A-T ***
28808717-T-C 26662570-T-C ***
28808721-A-T 26662574-A-T ***
28808722-T-G 26662575-T-G ***
28808725-A-C 26662578-A-C ***
28808737-T-A 26662590-T-A ***
28808726-A-T 26662579-A-T ***
28808727-T-C 26662580-T-C ***
28808728-C-A 26662581-C-A ***
28808731-A-T 26662584-A-T ***
28808732-T-G 26662585-T-G ***
28808733-C-G 26662586-C-G ***
28808734-G-A 26662587-G-A ***
28808736-A-T 26662589-A-T ***
6150007-GT-AC 6281966-GT-AC IR3_Dst ***
7100969-TT-G 7232928-TT-G ***
19126462-T-AAAAAAAAA 17014582-T-AAAAAAAAA ***
13856777-AAAT-GAATGGAGG 11736071-AAAT-GAATGGAGG ***
13855157-AA-TT 11734451-AA-TT ***
13856266-GGGAA-TGGAT 11735560-GGGAA-TGGAT ***
13856296-TC-CG 11735590-TC-CG ***
13856382-CT-GG 11735676-CT-GG ***
13856428-AAATC-GAATG 11735722-AAATC-GAATG ***
13856621-TG-CA 11735915-TG-CA ***
13856627-TA-GG 11735921-TA-GG ***
13858287-TT-CA 11737581-TT-CA ***
13847028-TCGAAAAGAACGGGATA-CTGAATTGAATGGAACG 11726322-TCGAAAAGAACGGGATA-CTGAATTGAATGGAACG ***
13858399-GGATTCG-AGAAACA 11737693-GGATTCG-AGAAACA ***
13858425-GAATGGCATCAAATAT-CAAAGGAATAGAAAGG 11737719-GAATGGCATCAAATAT-CAAAGGAATAGAAAGG ***
13860431-CATCGAAA-AATGGAAT 11739725-CATCGAAA-AATGGAAT ***
13860446-CATC-AATG 11739740-CATC-AATG ***
13860553-TC-GG 11739847-TC-GG ***
13860567-ATGGT-CTGGA 11739861-ATGGT-CTGGA ***
13866202-ATAT-CTAC 11745496-ATAT-CTAC ***
13847060-AACTC-GAATG 11726354-AACTC-GAATG ***
13843713-A-AGGAATGGAATGGAAT 11723007-A-AGGAATGGAATGGAAT 10×GGAAT***
13869501-CCCGGAG-ACTGGAA 11748795-CCCGGAG-ACTGGAA ***
13801228-AT-GG 11680522-AT-GG ***
13735026-GAACTC-CGAACG 11579350-GAACTC-CGAACG ***
13735044-CTGG-ATGA 11579368-CTGG-ATGA ***
13740632-GAACTC-CGAACG 11584956-GAACTC-CGAACG ***
13740761-GGA-CGG 11585085-GGA-CGG ***
13745775-TGTCA-CCTCG 11590099-TGTCA-CCTCG ***
13748577-TCNNN-GGAAC ***
13801012-TGCAATG-AGGAATA 11680306-TGCAATG-AGGAATA ***
13801234-AAG-GAA 11680528-AAG-GAA ***
13839837-GG-AA 11719131-GG-AA ***
13801267-CCAAATA-TCATATT 11680561-CCAAATA-TCATATT ***
13804029-TG-CA 11683323-TG-CA ***
13804146-CAATAGAA-GAATGGAC 11683440-CAATAGAA-GAATGGAC ***
13809598-GCAATTGG-CCAATTGA 11688892-GCAATTGG-CCAATTGA ***
13809611-ATGGAATGA-GTTGTATGG 11688905-ATGGAATGA-GTTGTATGG ***
13809728-ATAAA-GGAAT 11689022-ATAAA-GGAAT ***
13809826-CTT-ATG 11689120-CTT-ATG ***
13833115-CGGATTCG-TGGAATCC 11712409-CGGATTCG-TGGAATCC ***
13866899-TTAC-GGAA 11746193-TTAC-GGAA ***
13869517-CTCGAGT-TTGAAC 11748811-CTCGAGT-TTGAAC ***
13731874-AC-GT 11576198-AC-GT ***
18439255-G-GT 16327375-G-GT P6_Dst 25×T***
18008640-CAGATC-TTTTTT 15896760-CAGATC-TTTTTT P7_Dst ***
18011005-C-CT 15899125-C-CT P7_Dst 20×T***
18325701-AT-A 16213821-AT-A P6_Prx 27×T***
18369645-TAC-AAA 16257765-TAC-AAA P6_Prx ***
18371082-TTGCGG-CTGCAA 16259202-TTGCGG-CTGCAA P6_Prx ***
18398153-GTGTGTGTGTGT-ATATATACACAA 16286273-GTGTGTGTGTGT-ATATATACACAA P6_Gap ***
18429196-C-CA 16317316-C-CA P6_Dst 17×A***
18447620-AG-TTT 16335740-AG-TTT P6_Dst ***
17723768-GA-G 15611888-GA-G ***
18454903-T-TTCTC 16343023-T-TTCTC P6_Dst ***
18490252-C-CT 16378372-C-CT P6_Dst 11×T***
18501374-A-AT 16389494-A-AT P6_Dst 10×T***
18533107-CT-AA 16421227-CT-AA P6_Dst ***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGT 16421255-CTTTGTTTCTTGC-TTTTTTTTTTTGT P6_Dst ***
18615932-C-CT 16504052-C-CT 27×T***
18928753-GA-G 16816873-GA-G 9×A***
17994874-C-AA 15882994-C-AA P7_Prx 39×A***
17713845-ATCTTC-TTTTT 15601965-ATCTTC-TTTTT ***
13869556-TATGGACTG-AAAGGAAAC 11748850-TATGGACTG-AAAGGAAAC ***
15832213-CTTC-TTTT 13720333-CTTC-TTTT ***
14286784-CTTTTTT-C 12166078-CTTTTTT-C 22×T***
14698482-CAACAACAAC-AAAAAAAAAA 12586548-CAACAACAAC-AAAAAAAAAA ***
14867088-CTTTC-TTTTT 12755158-CTTTC-TTTTT ***
15157860-CAAAAAAA-C 13045947-CAAAAAA-C 21×A***
15358788-G-AA 13246908-G-AA ***
15410629-ATC-A 13298749-ATC-A ***
15477291-CAAAAAA-C 13365411-CAAAAAA-C 18×A***
15928370-GC-T 13816490-GC-T ***
17143891-AT-A 15032011-AT-A 35×T***
16099087-CTG-C 13987207-CTG-C P8_Prx 23×TG***
16150095-CTT-C 14038215-CTT-C P8_Dst 22×T***
16157692-CTTCAAAATAAAT-AAAAGAAAAGAAA 14045812-CTTCAAAATAAAT-AAAAGAAAAGAAA P8_Dst ***
16157793-ACTTTCCAATGACGTTCTTAGAGCAACTGACTAAGTCTTCTCATT-GGGTGTTGGACTTTGTTCTTGGGATCAGCTTGAACCTTTCAAGAC 14045913-ACTTTCCAATGACGTTCTTAGAGCAACTGACTAAGTCTTCTCATT-GGGTGTTGGACTTTGTTCTTGGGATCAGCTTGAACCTTTCAAGAC P8_Dst ***
16162095-CA-C 14050215-CA-C P8_Dst 19×A***
16250653-A-TT 14138773-A-TT ***
16301002-GAAAA-G 14189122-GAAAA-G 18×A***
16913422-CAAAAAAAAA-C 14801542-CAAAAAAAAA-C 21×A***
13734989-GTGTAATTGAATGATATCGAAAGGAAGGGAA-ATGGAATGGATCAAAATGGATTTGAACAGAT 11579313-GTGTAATTGAATGATATCGAAAGGAAGGGAA-ATGGAATGGATCAAAATGGATTTGAACAGAT ***
13729845-CCATT-GTATA 11574169-CCATT-GTATA ***
7165286-GTTGTTGTTG-TTTTTTTTTT 7297245-GTTGTTGTTG-TTTTTTTTTT ***
9629451-CA-C 9791842-CA-C IR3_Prx 12×A***
9571868-TTG-T 9734259-TTG-T IR3_Prx 10×TG***
9589965-GAC-G 9752356-GAC-G IR3_Prx ***
9591034-GA-G 9753425-GA-G IR3_Prx 12×A***
9602735-TTG-T 9765126-TTG-T IR3_Prx 8×TG***
9605871-T-TA 9768262-T-TA IR3_Prx 16×A***
9620171-C-CA 9782562-C-CA IR3_Prx 11×A***
9622506-CTTTA-TTTTT 9784897-CTTTA-TTTTT IR3_Prx ***
9631674-TGTGTCTGTGACATG-T 9794065-TGTGTCTGTGACATG-T IR3_Prx ***
9539555-CT-C 9701946-CT-C IR3_Prx ***
9634219-CT-C 9796610-CT-C IR3_Prx 9×T***
9666957-GA-G 9829348-GA-G IR3_Prx 10×A***
9745894-T-TC 9908285-T-TC ***
9745897-AG-CC 9908288-AG-CC ***
9930165-AGCGG-CGCGT 10092556-AGCGG-CGCGT ***
9931363-GTT-G 10093754-GTT-G 9×T***
9935902-CAAAGAG-ATAGGAC 10098293-CAAAGAG-ATAGGAC ***
9556485-CT-C 9718876-CT-C IR3_Prx 9×T***
9535155-A-AT 9697546-A-AT IR3_Prx 17×T***
10023660-GCCTATTTC-CCATCTCTG 10186051-GCCTATTTC-CCATCTCTG ***
8216406-CTTTTT-C 8348365-CTTTTT-C 16×T***
7235824-CTTTCTTG-TTTTTTTT 7367783-CTTTCTTG-TTTTTTTT ***
7270276-CTTTTTTTT-C 7402235-CTTTTTTTT-C 25×T***
7414304-AG-A 7546263-AG-A ***
7470726-G-AA 7602685-G-AA IR1_L ***
7984040-TAAAA-T 8115999-TAAAA-T 21×A***
7988099-CTTTT-C 8120058-CTTTT-C 14×T***
8182205-CAAAA-C 8314164-CAAAA-C 18×A***
8314146-CT-C 8446105-CT-C 24×T***
9345055-CT-GG 9507446-CT-GG ***
8422869-CAAAAA-C 8554828-CAAAAA-C 17×A***
8481967-TAA-T 8613926-TAA-T 15×A***
8555560-T-TTTGTTC 8687519-T-TTTGTTC ***
8568465-GTTTTTTTT-G 8700424-GTTTTTTTT-G 22×T***
8631383-CTT-C 8763342-CTT-C 26×T***
9304429-CTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGG 9466820-CTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGG ***
9307402-GTGTGTG-TTGAGTT 9469793-GTGTGTG-TTGAGTT ***
9336652-AC-CT 9499043-AC-CT ***
10004786-TATATACACAG-CATAAAGCAT 10167177-TATATACACAG-CATAAAGCAT ***
10032525-GC-AA 10194916-GC-AA ***
13723314-ATGGAATGGAAAGGAGGC-CTCACATAGAACAGCCTT 11567638-ATGGAATGGAAAGGAGGC-CTCACATAGAACAGCCTT ***
13485676-GTCAC-ATCAA 11330000-GTCAC-ATCAA ***
13467778-GGCAGAA-CGAATAT 11312102-GGCAGAA-CGAATAT ***
13467946-GG-AT 11312270-GG-AT ***
13469049-ATGTG-CTGTC 11313373-ATGTG-CTGTC ***
13472093-ACAG-GCAT 11316417-ACAG-GCAT ***
13472117-GCGCA-CCGCC 11316441-GCGCA-CCGCC ***
13480701-GCC-TCT 11325025-GCC-TCT ***
13484457-AT-CC 11328781-AT-CC ***
13488959-GCC-TCA 11333283-GCC-TCA ***
13466299-TGGTTGATCA-CTGATCCCTC 11310623-TGGTTGATCA-CTGATCCCTC ***
13544968-TTTGA-ATTGG 11389292-TTTGA-ATTGG ***
13681005-GA-CG 11525329-GA-CG ***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA 11543717-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA ***
13699416-GAAACGAATTC-TACACAAATGG 11543740-GAAACGAATTC-TACACAAATGG ***
13700766-GGCGAAA-ATGGAAT 11545090-GGCGAAA-ATGGAAT ***
13702191-GTG-CTC 11546515-GTG-CTC ***
13466377-CT-GG 11310701-CT-GG ***
13461724-TTA-ATG 11306048-TTA-ATG ***
13120632-TA-T 10610118-TA-T 8×A***
13143628-CATTGCAC-TATTCCAT 10633114-CATTGCAC-TATTCCAT ***
13140111-AATCCATTAAACTCGC-CATTCAACTCCATTGA 10629597-AATCCATTAAACTCGC-CATTCAACTCCATTGA ***
13140532-TC-GT 10630018-TC-GT ***
13140566-CCCT-TCCA 10630052-CCCT-TCCA ***
13140585-TTAA-CACC 10630071-TTAA-CACC ***
13140589-ACTCCAC-TTTGCAT 10630075-ACTCCAC-TTTGCAT ***
13143428-CATTTT-C 10632914-CATTTT-C ***
13143617-CC-AT 10633103-CC-AT ***
13143655-AACATCTCACTA-TGGATCAAACTT 10633141-AACATCTCACTA-TGGATCAAACTT ***
13461146-AAAGA-CAACT 11305470-AAAGA-CAACT ***
13194777-ATTGATA-CTCCATT 11039101-ATTGATA-CTCCATT ***
13203910-CGGCGATGATGACGGCATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-ATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT 11048234-CGGCGATGATGACGGCATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-ATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT ***
13275922-C-CA 11120246-C-CA ***
13393449-A-ATT 11237773-A-ATT 12×T***
13422404-AAGTT-TATAA 11266728-AAGTT-TATAA ***
13446403-CA-TG 11290727-CA-TG ***
13447257-AATTT-CATTC 11291581-AATTT-CATTC ***
13461135-TAG-CAA 11305459-TAG-CAA ***
20025454-T-C 17913574-T-C P5_Prx ***
6149999-G-A 6281958-G-A IR3_Dst ***
20025441-C-T 17913561-C-T P5_Prx ***
8439220-G-GTTT 8571179-G-GTTT 14×T***
27585917-C-CT 25439770-C-CT P1_Y2 19×T***
2888870-CAAAAAAAAAAAAAAAAAA-C 3020829-CAAAAAAAAAAAAAAAAAA-C 32×A***
2957323-CT-C 3089282-CT-C 15×T***
4118470-TG-CA 4250429-TG-CA ***
5512875-CA-C 5644834-CA-C 22×A***
7277048-G-GA 7409007-G-GA 12×A***
7636010-TAAAA-T 7767969-TAAAA-T 15×A***
8462064-C-CA 8594023-C-CA 26×A***
3873186-C-CA 4005145-C-CA 15×A***
8740675-G-TTTTTTTTT 8872634-G-TTTTTTTTT 17×T***
8740664-G-GTTTTTTTT 8872623-G-GTTTTTTTT 10×T***
9345037-AGGC-GGGG 9507428-AGGC-GGGG ***
9403521-G-GTTTTTTTTTTTTTTTTTTTT 9565912-G-GTTTTTTTTTTTTTTTTTTTT 21×T***
9700780-C-CAAATAA 9863171-C-CAAATAA IR3_Prx 23×A***
10013122-GTTT-TTGG 10175513-GTTT-TTGG ***
13122131-CT-TG 10611617-CT-TG ***
10033141-AG-A 10195532-AG-A ***
19272142-C-CA 17160262-C-CA 18×A***
13255410-G-GT 11099734-G-GT 11×T***
58903580-A-T 56687291-T-A ***
58863537-G-C 56727334-C-G ***
58863541-C-A 56727330-G-T ***
58863553-A-T 56727318-T-A ***
58866940-G-C 56723931-C-G ***
58870123-T-C 56720748-A-G ***
58882798-G-C 56708073-C-G ***
58892080-G-A 56698791-C-T ***
58903597-T-C 56687274-A-G ***
58911339-A-G 56679532-T-C ***
58904226-C-A 56686645-G-T ***
58904246-A-C 56686625-T-G ***
58905732-A-G 56685139-T-C ***
58907225-C-G 56683646-G-C ***
58907403-T-A 56683468-A-T ***
58908592-C-T 56682279-G-A ***
58909842-A-G 56681029-T-C ***
13140112-ATCCATTAAAC-A 10629598-ATCCATTAAAC-A ***
13484392-TGCCCTCTG-CGCACTCCT 11328716-TGCCCTCTG-CGCACTCCT ***
58859265-G-T 56731606-C-A ***
27422266-TG-AGCA 25276119-TG-AGCA P1_g3 ***
22568321-C-CTG 20406435-C-CTG ***
23801733-C-CAAAAAA 21639847-C-CAAAAAA 31×A***
24314080-TCTC-CCTCA 22167933-TCTC-CCTCA P3_t1 ***
24420879-A-ATT 22274732-A-ATT 43×T***
25590627-TG-CA 23444480-TG-CA P1_gr1 ***
25819576-ATTC-CTCT 23673429-ATTC-CTCT P1_b3 ***
25998253-GC-TT 23852106-GC-TT P1_Y1 ***
27483928-A-AT 25337781-A-AT P1_Y2 10×T***
22360129-AGTT-GGA 20198243-AGTT-GGA DYZ19 ***
27484015-ATC-GCT 25337868-ATC-GCT P1_Y2 ***
27581657-TGT-GAA 25435510-TGT-GAA P1_Y2 ***
27751236-CATTG-TATCA 25605089-CATTG-TATCA P1_Y2 ***
27751261-CA-GT 25605114-CA-GT P1_Y2 ***
27751270-GTC-ATT 25605123-GTC-ATT P1_Y2 ***
27751290-AG-CA 25605143-AG-CA P1_Y2 ***
27752131-CTCTG-TTCCA 25605984-CTCTG-TTCCA P1_Y2 ***
22502012-GGTG-AGTC 20340126-GGTG-AGTC DYZ19 ***
22245707-ACTC-CATT 20083821-ACTC-CATT DYZ19 ***
13488959-GCCCAG-TCGCCT 11333283-GCCCAG-TCGCCT ***
16292546-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 14180666-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 48×T***
13488988-AGGGTAGCTCCACCTCG-GGGGCATCTGCACATCA 11333312-AGGGTAGCTCCACCTCG-GGGGCATCTGCACATCA ***
13556425-GTAG-CTAT 11400749-GTAG-CTAT ***
13716447-CGC-GGA 11560771-CGC-GGA ***
13923535-AA-TT 11802829-AA-TT ***
14698458-C-CAAAAAAAAAAA 12586524-C-CAAAAAAAAAAA 19×A***
15015255-C-CT 12903343-C-. 24×T***
16147493-AGAGAGAG-GGAGGGAGGGA 14035613-AGAGAGAG-GGAGGGAGGGA P8_Dst ***
16301002-G-GAAAAAAA 14189122-G-GAAAAAAA 18×A***
22236465-CCACC-ACAGT 20074579-CCACC-ACAGT DYZ19 ***
17006505-C-CT 14894625-C-CT 13×T***
17030992-CAAAAA-C 14919112-CAAAAA-C 19×A***
17474936-TTTTTTTTTCTT-CTTTCTTTCCTTC 15363056-TTTTTTTTTCTT-CTTTCTTTCCTTC ***
19777758-TGT-AGA 17665878-TGT-AGA P5_Prx ***
20226089-AAT-TGTTC 18064203-AAT-TGTTC P5_Dst ***
20252796-C-CAAAAAAAA 18090910-C-CAAAAAAAA P5_Dst 24×A***
21402181-C-CTTTTTTT 19240295-C-CTTTTTTT 34×T***
58863533-G-A 56727338-C-T ***
58859261-T-C 56731610-A-G ***
27752314-TG-CA 25606167-TG-CA P1_Y2 ***
26208101-A-T 24061954-A-T P1_Y1 ***
22366818-C-T 20204932-C-T DYZ19 ***
22498507-T-A 20336621-T-A DYZ19 ***
23838845-G-T 21676959-G-T ***
24047841-A-C 21901694-A-C ***
25588251-C-T 23442104-C-T P1_gr1 ***
25590618-T-C 23444471-T-C P1_gr1 ***
25819593-T-G 23673446-T-G P1_b3 ***
26208103-A-T 24061956-A-T P1_Y1 ***
22364698-A-C 20202812-A-C DYZ19 ***
26214887-G-A 24068740-G-A P1_Y1 ***
26362237-G-A 24216090-G-A P1_Y1 ***
26362246-C-T 24216099-C-T P1_Y1 ***
26374299-G-A 24228152-G-A P1_Y1 ***
26374302-G-A 24228155-G-A P1_Y1 ***
26374306-T-G 24228159-T-G P1_Y1 ***
26427500-C-T 24281353-C-T P1_Y1 ***
22364710-C-G 20202824-C-G DYZ19 ***
22359469-G-T 20197583-G-T DYZ19 ***
27406364-C-T 25260217-C-T P1_g3 ***
21477779-A-G 19315893-A-G ***
20956082-T-C 18794196-T-C P4_Dst ***
20956086-G-T 18794200-G-T P4_Dst ***
20956088-A-T 18794202-A-T P4_Dst ***
20958441-T-G 18796555-T-G P4_Dst ***
21013240-T-C 18851354-T-C P4_Dst ***
21013243-C-T 18851357-C-T P4_Dst ***
21028666-A-G 18866780-A-G P4_Dst ***
22226576-A-C 20064690-A-C DYZ19 ***
22354854-T-G 20192968-T-G DYZ19 ***
22248600-T-C 20086714-T-C DYZ19 ***
22263783-T-C 20101897-T-C DYZ19 ***
22336093-C-A 20174207-C-A DYZ19 ***
22336099-T-A 20174213-T-A DYZ19 ***
22343307-A-T 20181421-A-T DYZ19 ***
22354830-T-G 20192944-T-G DYZ19 ***
22354838-G-T 20192952-G-T DYZ19 ***
26637224-G-A 24491077-G-A P1_g2 ***
27419693-T-A 25273546-T-A P1_g3 ***
58856201-T-A 56734670-A-T ***
58828009-A-T 56762862-T-A ***
27971753-A-C 25825606-A-C P1_Y2 ***
28013865-T-C 25867718-T-C P1_Y2 ***
28162257-A-G 26016110-A-G P1_b4 ***
28162263-T-C 26016116-T-C P1_b4 ***
28395793-G-A 26249646-G-A P1_gr2 ***
28491189-C-T 26345042-C-T ***
58827249-A-T 56763622-T-A ***
58830797-G-A 56760074-C-T ***
27866313-A-G 25720166-A-G P1_Y2 ***
58832643-C-T 56758228-G-A ***
58832653-G-C 56758218-C-G ***
58842234-T-C 56748637-A-G ***
58842238-G-C 56748633-C-G ***
58842241-G-T 56748630-C-A ***
58842256-G-T 56748615-C-A ***
58847960-T-C 56742911-A-G ***
27866323-A-T 25720176-A-T P1_Y2 ***
27752347-A-G 25606200-A-G P1_Y2 ***
27422259-C-T 25276112-C-T P1_g3 ***
27752143-C-T 25605996-C-T P1_Y2 ***
27422275-A-G 25276128-A-G P1_g3 ***
27484022-G-T 25337875-G-T P1_Y2 ***
27508725-G-A 25362578-G-A P1_Y2 ***
27581652-T-G 25435505-T-G P1_Y2 ***
27751230-T-C 25605083-T-C P1_Y2 ***
27751254-G-C 25605107-G-C P1_Y2 ***
27751277-T-A 25605130-T-A P1_Y2 ***
27752157-G-A 25606010-G-A P1_Y2 ***
27752295-G-A 25606148-G-A P1_Y2 ***
27752162-G-A 25606015-G-A P1_Y2 ***
27752165-C-T 25606018-C-T P1_Y2 ***
27752168-T-C 25606021-T-C P1_Y2 ***
27752169-T-A 25606022-T-A P1_Y2 ***
27752172-T-G 25606025-T-G P1_Y2 ***
27752176-G-T 25606029-G-T P1_Y2 ***
27752272-G-T 25606125-G-T P1_Y2 ***
27752148-ATCCC-TTCCT 25606001-ATCCC-TTCCT P1_Y2 ***
27752331-ATTG-TTCA 25606184-ATTG-TTCA P1_Y2 ***
20950309-C-T 18788423-C-T P4_Dst ***
6145073-G-A 6277032-G-A IR3_Dst ***
6145063-T-C 6277022-T-C IR3_Dst ***
6145064-G-A 6277023-G-A IR3_Dst ***
6145066-G-C 6277025-G-C IR3_Dst ***
6145069-A-C 6277028-A-C IR3_Dst ***
6145070-G-A 6277029-G-A IR3_Dst ***
6145071-G-A 6277030-G-A IR3_Dst ***
6145072-T-C 6277031-T-C IR3_Dst ***
6145075-A-C 6277034-A-C IR3_Dst ***
6145060-C-T 6277019-C-T IR3_Dst ***
6145076-T-A 6277035-T-A IR3_Dst ***
6145078-G-C 6277037-G-C IR3_Dst ***
6145084-A-C 6277043-A-C IR3_Dst ***
6145087-A-C 6277046-A-C IR3_Dst ***
6145088-C-A 6277047-C-A IR3_Dst ***
6145090-A-C 6277049-A-C IR3_Dst ***
6145091-T-A 6277050-T-A IR3_Dst ***
6145062-A-T 6277021-A-T IR3_Dst ***
6145059-C-A 6277018-C-A IR3_Dst ***
6145093-A-C 6277052-A-C IR3_Dst ***
6135376-T-G 6267335-T-G ***
6135363-G-A 6267322-G-A ***
6135366-T-C 6267325-T-C ***
6135367-A-G 6267326-A-G ***
6135368-C-T 6267327-C-T ***
6135369-G-A 6267328-G-A ***
6135373-T-C 6267332-T-C ***
6135375-C-G 6267334-C-G ***
6145041-G-C 6277000-G-C IR3_Dst ***
6145057-A-C 6277016-A-C IR3_Dst ***
6145042-C-G 6277001-C-G IR3_Dst ***
6145043-T-G 6277002-T-G IR3_Dst ***
6145045-C-G 6277004-C-G IR3_Dst ***
6145046-A-G 6277005-A-G IR3_Dst ***
6145053-G-T 6277012-G-T IR3_Dst ***
6145054-A-G 6277013-A-G IR3_Dst ***
6145055-G-C 6277014-G-C IR3_Dst ***
6145092-T-A 6277051-T-A IR3_Dst ***
6145094-G-A 6277053-G-A IR3_Dst ***
5904609-A-T 6036568-A-T ***
6948541-A-G 7080500-A-G ***
6830606-T-C 6962565-T-C ***
6833330-C-T 6965289-C-T ***
6911388-C-A 7043347-C-A ***
6918506-G-C 7050465-G-C ***
6918513-C-A 7050472-C-A ***
6918535-C-A 7050494-C-A 31×A***
6948125-G-T 7080084-G-T ***
7043561-G-T 7175520-G-T ***
6285676-C-A 6417635-C-A IR3_Dst ***
7047991-A-C 7179950-A-C ***
7048014-A-C 7179973-A-C ***
7048030-A-C 7179989-A-C ***
7086640-C-A 7218599-C-A ***
7086829-T-C 7218788-T-C ***
7139141-T-A 7271100-T-A ***
7197239-C-A 7329198-C-A ***
6305880-C-T 6437839-C-T IR3_Dst ***
6250586-T-C 6382545-T-C IR3_Dst ***
6145096-A-C 6277055-A-C IR3_Dst ***
6149997-G-A 6281956-G-A IR3_Dst ***
6145099-A-C 6277058-A-C IR3_Dst ***
6145100-T-A 6277059-T-A IR3_Dst ***
6145103-T-G 6277062-T-G IR3_Dst ***
6145105-C-G 6277064-C-G IR3_Dst ***
6145106-C-A 6277065-C-A IR3_Dst ***
6149994-T-C 6281953-T-C IR3_Dst ***
6149996-T-C 6281955-T-C IR3_Dst ***
6149998-T-C 6281957-T-C IR3_Dst ***
6179592-A-T 6311551-A-T IR3_Dst 22×T***
22309919-A-C 20148033-A-C DYZ19 ***
6150000-G-C 6281959-G-C IR3_Dst ***
6150001-G-A 6281960-G-A IR3_Dst ***
6150003-G-A 6281962-G-A IR3_Dst ***
6150005-G-A 6281964-G-A IR3_Dst ***
6150007-G-A 6281966-G-A IR3_Dst ***
6150008-T-C 6281967-T-C IR3_Dst ***
6134451-A-G 6266410-A-G ***
5785845-T-A 5917804-T-A ***
28030783-CCTTC-TCTTT 25884636-CCTTC-TCTTT P1_Y2 ***
10023478-C-T 10185869-C-T ***
13861574-G-A 11740868-G-A ***
13866892-A-G 11746186-A-G ***
13868849-T-A 11748143-T-A ***
22275665-C-A 20113779-C-A DYZ19 ***
58978014-CCTTTCCATTG-C 56831867-CCTTTCCATTG-C ***
58980531-A-T 56834384-A-T ***
10032441-A-G 10194832-A-G ***
28802553-T-G 26656406-T-G ***
13857929-T-C 11737223-T-C ***
7164509-T-G 7296468-T-G ***
7201552-T-C 7333511-T-C ***
28802556-A-G 26656409-A-G ***
59031721-A-G 56885574-A-G ***
58997004-A-T 56850857-A-T ***
58974236-C-T 56828089-C-T ***
13691816-C-G 11536140-C-G ***
13857956-G-A 11737250-G-A ***
13745573-T-A 11589897-T-A ***
13472071-A-T 11316395-A-T ***
58842266-ATCCC-TTCCT 56748601-GGGAT-AGGAA ***
28253524-C-CAAAAA 26107377-C-CAAAAA P1_b4 ***
28491336-A-AAAACCCCCC 26345189-A-AAAACCCCCC ***
28491337-A-AAAAAACACCCCC 26345190-A-AAAAAACACCCCC ***
28500822-TTTG-GGAC 26354675-TTTG-GGAC ***
58819347-N-NC ***
58831380-AT-CC 56759490-AT-GG ***
58832622-GCAGTCTT-CCATTCAA 56758242-AAGACTGC-TTGAATGG ***
58847167-GTCTCTT-TTC 56743698-AAGAGAC-GAA ***
13194849-C-G 11039173-C-G ***
58848549-TGATGT-CCATTC 56742317-ACATCA-GAATGG ***
58911349-GAC-CAT 56679520-GTC-ATG ***
7461754-G-GTT 7593713-G-GTT IR1_L 23×T***
13138484-G-T 10627970-G-T ***
13138571-A-C 10628057-A-C ***
13138574-C-T 10628060-C-T ***
13138577-T-C 10628063-T-C ***
13691814-G-A 11536138-G-A ***
13866912-G-A 11746206-G-A ***
5669623-C-A 5801582-C-A ***
5065980-C-A 5197939-C-A ***
3632858-C-A 3764817-C-A ***
3965171-C-A 4097130-C-A ***
3994857-T-A 4126816-T-A ***
4138851-G-T 4270810-G-T ***
4144009-C-A 4275968-C-A ***
4179086-T-A 4311045-T-A ***
4951415-G-T 5083374-G-T ***
5117700-A-G 5249659-A-G ***
3286442-C-A 3418401-C-A ***
5204381-G-A 5336340-G-A ***
5261746-A-C 5393705-A-C ***
5261749-C-A 5393708-C-A ***
5261761-A-G 5393720-A-G ***
5261767-C-G 5393726-C-G ***
5393343-C-A 5525302-C-A ***
5572448-A-T 5704407-A-T ***
3622308-C-A 3754267-C-A ***
3092956-C-A 3224915-C-A ***
58987895-T-C 56841748-T-C ***
14550735-G-A 12438936-G-A ZS814 ***
59031761-T-C 56885614-T-C ***
59031714-G-T 56885567-G-T ***
22352474-G-A 20190588-G-A DYZ19 ***
28808718-C-G 26662571-C-G ***
13691815-G-T 11536139-G-T ***
9925222-T-A 10087613-T-A ***
58996150-A-T 56850003-A-T ***
58996149-T-C 56850002-T-C ***
2980680-C-A 3112639-C-A ***
13833409-T-A 11712703-T-A ***
13691820-A-T 11536144-A-T ***
13472096-G-T 11316420-G-T ***
13833434-A-T 11712728-A-T ***
58987981-C-G 56841834-C-G ***
2649782-G-A 2781741-G-A ***
2649798-G-C 2781757-G-C ***
20956073-G-A 18794187-G-A P4_Dst ***
20746996-T-C 18585110-T-C P4_Prx ***
7201542-T-C 7333501-T-C ***
13203960-T-A 11048284-T-A ***
7483663-T-G 7615622-T-G IR1_L ***
9215993-A-G 9378384-A-G ***
9304875-A-G 9467266-A-G ***
9325208-C-G 9487599-C-G ***
13140109-C-T 10629595-C-T ***
13203958-C-T 11048282-C-T ***
13203959-A-G 11048283-A-G ***
13203963-T-A 11048287-T-A ***
13203974-C-G 11048298-C-G ***
13275918-C-T 11120242-C-T ***
16148183-C-T 14036303-C-T P8_Dst 27×T***
20230681-A-G 18068795-A-G P5_Dst ***
20886818-T-A 18724932-T-A P4_Dst ***
25312613-T-A 23166466-T-A P2_r1 ***
26902340-G-A 24756193-G-A P1_r3 ***
27971780-G-A 25825633-G-A P1_Y2 ***
13445937-C-T 11290261-C-T ***
13203973-C-T 11048297-C-T ***
28253570-T-A 26107423-T-A P1_b4 ***
13801118-G-A 11680412-G-A ***
58820540-T-C 56770331-A-G ***
25657077-A-AT 23510930-A-AT P1_b3 12×T***
13866925-A-G 11746219-A-G ***
24060374-GT-G 21914227-GT-G P3_b1 ***
13748541-A-T 11592865-A-T ***
18443454-G-GA 16331574-G-GA P6_Dst 11×A***
25458706-G-GA 23312559-G-GA P2_r2 9×A***
25207887-G-A 23061740-G-A P2_r1 ***
13203975-C-A 11048299-C-A ***
22232192-G-T 20070306-G-T DYZ19 ***
22232196-T-A 20070310-T-A DYZ19 ***
22265856-G-T 20103970-G-T DYZ19 ***
58914180-T-G 56676691-A-C ***
22232055-ACAC-GCAT 20070169-ACAC-GCAT DYZ19 ***
58971887-CATATATATAT-C 56825740-CATATATATAT-C 12×AT***
13203979-C-T 11048303-C-T ***
27971785-G-A 25825638-G-A P1_Y2 ***
28253572-G-A 26107425-G-A P1_b4 ***
13868431-G-A 11747725-G-A ***
24035198-T-TA 21889051-T-TA 14×A***
20255094-TA-T 18093208-TA-T P5_Dst 20×A***
20347544-ATTAT-A 18185658-ATTAT-A P5_Dst 5×TTAT***
20432863-TAC-T 18270977-TAC-T P5_Dst 13×AC***
20478953-C-CA 18317067-C-CA P5_Dst 15×A***
20993598-CA-C 18831712-CA-C P4_Dst 17×A***
22256872-ATGAAGC-TGTTATG 20094986-ATGAAGC-TGTTATG DYZ19 ***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
24096349-CA-C 21950202-CA-C P3_b1 16×A***
20230695-GTATG-CTATA 18068809-GTATG-CTATA P5_Dst ***
24295863-CT-C 22149716-CT-C P3_t1 17×T***
24336793-C-TT 22190646-C-TT P3_t1 20×T***
24739651-CT-C 22593504-CT-C P3_b2 13×T***
24771003-CT-C 22624856-CT-C P3_b2 17×T***
24796652-GT-G 22650505-GT-G P3_b2 8×T***
24826348-CT-C 22680201-CT-C P3_b2 14×T***
24830466-CAACAAC-AAAAAAA 22684319-CAACAAC-AAAAAAA P3_b2 ***
20230740-AAT-GAC 18068854-AAT-GAC P5_Dst ***
20230667-TTT-CTG 18068781-TTT-CTG P5_Dst ***
28253574-G-A 26107427-G-A P1_b4 ***
25662111-TA-T 23515964-TA-T P1_b3 14×A***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
27861040-GT-G 25714893-GT-G P1_Y2 17×T***
15132065-AT-A 13020152-AT-A 14×T***
27644230-C-CA 25498083-C-CA P1_Y2 12×A***
20078758-C-CA 17966878-C-CA P5_Dst 16×A***
25273788-AT-A 23127641-AT-A P2_r1 21×T***
6308050-GCACA-G 6440009-GCACA-G IR3_Dst 9×CA***
9529142-CT-C 9691533-CT-C IR3_Prx 15×T***
20213749-ATT-A 18051863-ATT-A P5_Dst 14×T***
13801031-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA 11680325-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA ***
13801053-TGGATAGAACGG-GGAATGGAGATT 11680347-TGGATAGAACGG-GGAATGGAGATT ***
16040802-CTTTTT-C 13928922-CTTTTT-C 16×T***
16146467-T-TA 14034587-T-TA P8_Dst 10×A***
18984946-CTTTC-TTTTT 16873066-CTTTC-TTTTT ***
20129006-CA-C 18017126-CA-C P5_Dst 11×A***
20197205-G-GA 18035319-G-GA P5_Dst 14×A***
13868435-G-A 11747729-G-A ***
13868428-A-C 11747722-A-C ***
25289249-GA-G 23143102-GA-G P2_r1 ***
13447668-G-GCATTCCATTC 11291992-G-GCATTCCATTC 4×CATTC***
13735162-A-G 11579486-A-G 4×AATGG***
13140580-C-T 10630066-C-T ***
13803178-G-A 11682472-G-A ***
13817643-A-C 11696937-A-C ***
20196323-C-CA 18034437-C-CA P5_Dst 10×A***
7269610-CTT-C 7401569-CTT-C 22×T***
6948124-G-T 7080083-G-T ***
13447687-T-A 11292011-T-A ***
13847069-T-G 11726363-T-G ***
13804706-T-G 11684000-T-G ***
16108594-T-C 13996714-T-C P8_Prx ***
24033715-GTTTA-G 21887568-GTTTA-G 4×TTTA***
20230710-T-G 18068824-T-G P5_Dst ***
13723348-T-A 11567672-T-A ***
13723350-A-T 11567674-A-T ***
13469059-G-T 11313383-G-T ***
13850311-G-A 11729605-G-A ***
58858969-G-C 56731902-C-G ***
27815070-CT-C 25668923-CT-C P1_Y2 10×T***
13465331-A-G 11309655-A-G ***
13833416-C-G 11712710-C-G ***
22256898-T-G 20095012-T-G DYZ19 ***
20045274-AAAAG-A 17933394-AAAAG-A P5_Prx 14×AAAG***
28132475-C-CT 25986328-C-CT P1_b4 15×T***
13866859-C-G,T 11746153-C-G,T ***
13869985-A-G 11749279-A-G ***
13870003-C-A 11749297-C-A ***
58819393-C-T 56771478-G-A ***
28142885-A-AT 25996738-A-AT P1_b4 11×T***
58985570-A-G 56839423-A-G ***
22498241-A-T 20336355-A-T DYZ19 ***
58912924-G-A 56677947-C-T ***
28253529-G-A 26107382-G-A P1_b4 ***
13839918-A-G 11719212-A-G ***
20214463-C-CA 18052577-C-CA P5_Dst 10×A***
24669478-CT-C 22523331-CT-C P3_b2 10×T***
13139533-T-C 10629019-T-C ***
26953179-G-A 24807032-G-A P1_r3 ***
22293405-T-C 20131519-T-C DYZ19 ***
28027982-A-AT 25881835-A-AT P1_Y2 17×T***
24629530-C-CT 22483383-C-CT P3_t2 11×T***
58983162-C-A 56837015-C-A ***
16108635-A-C 13996755-A-C P8_Prx ***
20902303-GA-G 18740417-GA-G P4_Dst 14×A***
28802531-G-A 26656384-G-A ***
20995546-TCTTTC-T 18833660-TCTTTC-T P4_Dst 11×CTTTC***
27808453-C-CT 25662306-C-CT P1_Y2 15×T***
58819717-A-C 56771154-T-G 4×CATTC***
27778164-C-CT 25632017-C-CT P1_Y2 12×T***
22802904-G-T 20641018-G-T ***
22802929-G-T 20641043-G-T ***
20872237-A-AT 18710351-A-AT P4_Dst 11×T***
27792527-AT-A 25646380-AT-A P1_Y2 10×T***
13140106-T-C 10629592-T-C ***
22250200-A-T 20088314-A-T DYZ19 ***
22490753-G-T 20328867-G-T DYZ19 ******
20416397-AT-A 18254511-AT-A P5_Dst 15×T***
13804711-A-C 11684005-A-C ***
13479211-G-C 11323535-G-C ***
28214049-C-CT 26067902-C-CT P1_b4 14×T***
24038488-T-TAC 21892341-T-TAC 24×AC***
26098023-AG-A 23951876-AG-A P1_Y1 ***
25207883-G-A 23061736-G-A P2_r1 ***
27936764-CA-C 25790617-CA-C P1_Y2 15×A***
13203980-T-A 11048304-T-A ***
20442453-G-GA 18280567-G-GA P5_Dst 11×A***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
25207886-T-A 23061739-T-A P2_r1 ***
22498176-G-T 20336290-G-T DYZ19 ***
25364735-A-AT 23218588-A-AT P2_r2 9×T***
27967336-G-A 25821189-G-A P1_Y2 10×TA***
9745927-A-C 9908318-A-C ***
9745928-G-C 9908319-G-C ***
9745931-T-C 9908322-T-C ***
13812792-A-G 11692086-A-G ***
13866923-A-T 11746217-A-T ***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
20464352-A-G 18302466-A-G P5_Dst ***
22354781-G-T 20192895-G-T DYZ19 ***
13556416-C-A 11400740-C-A ***
58982371-G-T 56836224-G-T ***
13110053-A-G 10599539-A-G ***
13416424-G-C 11260748-G-C ***
24023731-A-G 21877584-A-G ***
3321010-A-G 3452969-A-G ***
27752341-T-C 25606194-T-C P1_Y2 ***
3312978-T-G 3444937-T-G ***
13431018-A-G 11275342-A-G ***
4118471-G-A 4250430-G-A ***
4976819-G-A 5108778-G-A ***
5275891-C-A 5407850-C-A ***
5477704-G-C 5609663-G-C ***
6247429-C-A 6379388-C-A IR3_Dst ***
7026510-G-C 7158469-G-C ***
7122596-G-A 7254555-G-A ***
13431028-A-T 11275352-A-T ***
13399807-G-A 11244131-G-A ***
9983966-G-A 10146357-G-A ***
13437785-A-T 11282109-A-T ***
22802905-G-T 20641019-G-T ***
58889841-T-C 56701030-A-G ***
13485341-ACAAG-TCAATC 11329665-ACAAG-TCAATC ***
13398262-G-T 11242586-G-T ***
13398283-C-A 11242607-C-A ***
58851821-C-T 56739050-G-A ***
58863586-T-C 56727285-A-G ***
13856470-C-A 11735764-C-A ***
13241659-T-C 11085983-T-C ***
58866931-T-A 56723940-A-T ***
58866939-C-T 56723932-G-A ***
58907234-A-C 56683637-T-G ***
6247511-A-G 6379470-A-G IR3_Dst ***
22354749-G-T 20192863-G-T DYZ19 ***
58983541-C-A 56837394-C-A ***
13740650-CTGG-ATGA 11584974-CTGG-ATGA ***
9571096-C-A 9733487-C-A IR3_Prx ***
13109790-G-A 10599276-G-A ***
22367180-A-T 20205294-A-T DYZ19 ***
19777758-T-A 17665878-T-A P5_Prx ***
18459161-G-A 16347281-G-A P6_Dst ***
18459166-T-C 16347286-T-C P6_Dst ***
19746899-G-A 17635019-G-A P5_Prx ***
19754989-A-C 17643109-A-C P5_Prx ***
19759589-T-C 17647709-T-C P5_Prx ***
19777746-T-C 17665866-T-C P5_Prx ***
19777749-T-C 17665869-T-C P5_Prx ***
19777760-T-A 17665880-T-A P5_Prx ***
18331568-C-T 16219688-C-T P6_Prx ***
19810012-T-A 17698132-T-A P5_Prx ***
20226094-G-C 18064208-G-C P5_Dst ***
20228022-C-A 18066136-C-A P5_Dst ***
20248995-C-T 18087109-C-T P5_Dst ***
20248997-A-G 18087111-A-G P5_Dst ***
20248998-T-G 18087112-T-G P5_Dst ***
20462541-G-T 18300655-G-T P5_Dst ***
18331581-C-T 16219701-C-T P6_Prx ***
17633682-C-A 15521802-C-A ***
13109962-A-T 10599448-A-T ***
13530684-A-T 11375008-A-T ***
13110043-G-T 10599529-G-T ***
13115391-G-C 10604877-G-C ***
13115403-A-T 10604889-A-T ***
13115446-G-C 10604932-G-C ***
13122125-A-G 10611611-A-G ***
13487475-G-T 11331799-G-T ***
13487858-T-A 11332182-T-A ***
13636066-T-C 11480390-T-C ***
17543794-T-A 15431914-T-A ***
13697677-G-C 11542001-G-C ***
13697692-C-G 11542016-C-G ***
13748472-G-C 11592796-G-C ***
13923545-A-C 11802839-A-C ***
16129437-T-C 14017557-T-C P8_Prx ***
16351738-G-A 14239858-G-A ***
17474961-G-A 15363081-G-A ***
22421427-G-C 20259541-G-C DYZ19 ***
9936852-A-C 10099243-A-C ***
25301411-GA-G 23155264-GA-G P2_r1 ***
24314070-G-A 22167923-G-A P3_t1 ***
58985514-GATCACC-TATCTCG 56839367-GATCACC-TATCTCG ***
22309415-A-C 20147529-A-C DYZ19 ***
19646223-ACTATG-TCCATC 17534343-ACTATG-TCCATC P5_Prx ***
22367219-C-G 20205333-C-G DYZ19 ***
22127975-C-CTTTTTT 19966089-C-CTTTTTT 20×T***
13122138-C-G 10611624-C-G ***
22481786-A-T 20319900-A-T DYZ19 ***
58820437-A-C 56770434-T-G ***
28802831-ATTGAG-GTGGAC 26656684-ATTGAG-GTGGAC ***
18447621-G-GTTTTTTTTTTTT 16335741-G-GTTTTTTTTTTTT P6_Dst 18×T***
22355082-G-C 20193196-G-C DYZ19 ***
22355122-T-G 20193236-T-G DYZ19 ***
58848420-A-C 56742451-T-G ***
22337817-AG-GT 20175931-AG-GT DYZ19 ***
18378958-AC-A 16267078-AC-A P6_Prx ***
20645841-TTC-T 18483955-TTC-T P4_Prx ***
58983182-CTAC-GCAT 56837035-CTAC-GCAT ***
28008591-C-CA 25862444-C-CA P1_Y2 11×A***
58980802-T-C 56834655-T-C ***
25717471-CA-C 23571324-CA-C P1_b3 17×A***
25412653-CT-C 23266506-CT-C P2_r2 16×T***
25415037-C-CT 23268890-C-CT P2_r2 17×T***
25417422-CT-C 23271275-CT-C P2_r2 16×T***
25422190-CT-C 23276043-CT-C P2_r2 16×T***
25429198-CT-C 23283051-CT-C P2_r2 13×T***
25662890-CA-C 23516743-CA-C P1_b3 15×A***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25766541-C-CA 23620394-C-CA P1_b3 16×A***
27889296-AAT-A 25743149-AAT-A P1_Y2 ***
26117889-TAAC-AAAA 23971742-TAAC-AAAA P1_Y1 ***
26990934-CT-C 24844787-CT-C P1_r4 17×T***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
27035480-CT-C 24889333-CT-C P1_r4 16×T***
27149714-TA-T 25003567-TA-T P1_g3 16×A***
27427815-GA-G 25281668-GA-G P1_g3 14×A***
27780449-C-CA 25634302-C-CA P1_Y2 18×A***
22498283-C-G 20336397-C-G DYZ19 ***
2795555-ATTTG-TTTT 2927514-ATTTG-TTTT ***
58859215-AG-TC 56731655-CT-GA ***
22355162-T-G 20193276-T-G DYZ19 ***
22223298-CTTC-ATTT 20061412-CTTC-ATTT DYZ19 ***
9700780-C-CA 9863171-C-CA IR3_Prx 23×A***
13838038-C-A 11717332-C-A ***
58867486-TATTTTATTCCATGCC-T 56723365-CAAATGGCATGGAATA-C ***
13876403-T-C 11755697-T-C ***
58894609-C-G 56696262-G-C ***
13556376-G-C 11400700-G-C ***
13725096-GT-TA 11569420-GT-TA ***
28808738-G-A 26662591-G-A ***
22342821-TT-GG 20180935-TT-GG DYZ19 ***
16108634-A-T 13996754-A-T P8_Prx ***
13734088-C-A 11578412-C-A ***
58909939-G-A 56680932-C-T ***
58819351-N-NTT ***
58842288-ACAG-CCAT 56748580-CTGT-ATGG ***
58842299-CAATAG-C 56748565-ATCTAT-A ***
27751301-C-G 25605154-C-G P1_Y2 ***
15179010-C-CA 13067096-C-CA 25×A***
25207874-G-AAA 23061727-G-AAA P2_r1 ***
58913090-T-G 56677781-A-C ***
13485114-T-G 11329438-T-G ***
13474808-T-A 11319132-T-A ***
13474811-A-T 11319135-A-T ***
27585912-G-T 25439765-G-T P1_Y2 ***
22422828-TT-CA 20260942-TT-CA DYZ19 ***
13140069-CACTCGAGTGCGTGTG-C 10629555-CACTCGAGTGCGTGTG-C ***
58908515-A-C 56682356-T-G ***
22248578-CT-C 20086692-CT-C DYZ19 ***
22260679-G-C 20098793-G-C DYZ19 ***
13876452-G-A 11755746-G-A ***
17569252-C-A 15457372-C-A ***
20501022-T-G 18339136-T-G P5_Dst ***
22232063-AAGTGCTGT-CATTTCTGA 20070177-AAGTGCTGT-CATTTCTGA DYZ19 ***
13488819-C-A 11333143-C-A ***
3205858-C-CAAAAAAA 3337817-C-CAAAAAAA 15×A***
9962207-A-T 10124598-A-T ***
15912055-C-T 13800175-C-T M12014 21×T***
7197367-C-A 7329326-C-A ***
7201547-T-C 7333506-T-C ***
19943085-T-G 17831205-T-G P5_Prx ***
15495274-G-A 13383394-G-A ***
14992432-C-A 12880517-C-A ***
15115692-A-G 13003779-A-G ***
15168367-A-T 13056453-A-T ***
15221262-T-A 13109348-T-A ***
15299563-C-T 13187662-C-T ***
15336018-T-A 13224136-T-A ***
15365057-A-G 13253177-A-G ***
15497952-A-T 13386072-A-T ***
14700988-T-G 12589054-T-G ***
15497953-A-T 13386073-A-T ***
15497954-T-A 13386074-T-A ***
15566817-G-A 13454937-G-A 22×A***
15570172-C-A 13458292-C-A ***
15763723-G-T 13651843-G-T ***
15775986-G-T 13664106-G-T ***
15803582-C-A 13691702-C-A ***
14990146-T-C 12878231-T-C ***
14632952-G-T 12521021-G-T ***
15871635-C-A 13759755-C-A ***
14212559-T-A 12091853-T-A ***
14184518-T-G 12063812-T-G ***
14184519-G-A 12063813-G-A ***
14184520-G-T 12063814-G-T ***
14184523-A-T 12063817-A-T ***
14184525-A-G 12063819-A-G ***
14184526-G-T 12063820-G-T ***
14191814-C-T 12071108-C-T ***
14224207-C-A 12103501-C-A ***
14606454-C-A 12494656-C-A ***
14227622-C-A 12106916-C-A ***
14258539-C-T 12137833-C-T ***
14390751-A-G 12270047-A-G ***
14422643-C-A 12301918-C-A ***
14445631-C-A 12324904-C-A ***
14518401-C-A 12406602-C-A ***
14550636-C-T 12438837-C-T ***
15815250-T-A 13703370-T-A ***
15881981-T-A 13770101-T-A ***
14184516-T-G 12063810-T-G ***
16108625-A-C 13996745-A-C P8_Prx ***
16108609-A-T 13996729-A-T P8_Prx ***
16108610-A-G 13996730-A-G P8_Prx ***
16108612-A-C 13996732-A-C P8_Prx ***
16108614-A-C 13996734-A-C P8_Prx ***
16108616-A-C 13996736-A-C P8_Prx ***
16108617-T-A 13996737-T-A P8_Prx ***
16108624-G-T 13996744-G-T P8_Prx ***
16108627-C-G 13996747-C-G P8_Prx ***
16108607-A-T 13996727-A-T P8_Prx ***
16108628-T-C 13996748-T-C P8_Prx ***
16108629-T-A 13996749-T-A P8_Prx ***
16108630-G-C 13996750-G-C P8_Prx ***
16108631-G-A 13996751-G-A P8_Prx ***
16108632-A-G 13996752-A-G P8_Prx ***
16108636-A-T 13996756-A-T P8_Prx ***
16108637-A-T 13996757-A-T P8_Prx ***
16108608-C-T 13996728-C-T P8_Prx ***
16108606-T-A 13996726-T-A P8_Prx ***
15881984-C-G 13770104-C-G ***
16108590-A-G 13996710-A-G P8_Prx ***
15881999-C-G 13770119-C-G ***
16033631-T-C 13921751-T-C ***
16090297-C-A 13978417-C-A ***
16090323-C-A 13978443-C-A ***
16096684-G-T 13984804-G-T ***
16108587-A-G 13996707-A-G P8_Prx ***
16108588-A-G 13996708-A-G P8_Prx ***
16108591-C-T 13996711-C-T P8_Prx ***
16108605-C-G 13996725-C-G P8_Prx ***
16108595-T-G 13996715-T-G P8_Prx ***
16108596-G-A 13996716-G-A P8_Prx ***
16108597-T-G 13996717-T-G P8_Prx ***
16108598-G-T 13996718-G-T P8_Prx ***
16108599-C-A 13996719-C-A P8_Prx ***
16108602-G-C 13996722-G-C P8_Prx ***
16108604-T-A 13996724-T-A P8_Prx ***
14184517-C-T 12063811-C-T ***
14184515-G-T 12063809-G-T ***
16108641-C-A 13996761-C-A P8_Prx ***
13748558-T-G 11592882-T-G ***
13734824-A-T 11579148-A-T ***
13734986-C-G 11579310-C-G ***
13740309-T-G 11584633-T-G ***
13740633-A-G 11584957-A-G ***
13740636-T-C 11584960-T-C ***
13748510-A-C 11592834-A-C ***
13748524-T-A 11592848-T-A ***
13748577-T-G 11592901-T-G ***
13734814-T-C 11579138-T-C ***
13748578-C-G 11592902-C-G ***
13801373-A-G 11680667-A-G ***
13801378-A-C 11680672-A-C ***
13809588-G-A 11688882-G-A ***
13833408-A-T 11712702-A-T ***
13833410-T-G 11712704-T-G ***
13833412-G-A 11712706-G-A ***
13734815-G-T 11579139-G-T ***
13734813-A-C 11579137-A-C ***
13833415-T-C 11712709-T-C ***
13718537-A-T 11562861-A-T ***
13718520-G-T 11562844-G-T ***
13718524-C-T 11562848-C-T ***
13718528-A-C 11562852-A-C ***
13718530-G-C 11562854-G-C ***
13718531-G-A 11562855-G-A ***
13718534-C-T 11562858-C-T ***
13718536-G-T 11562860-G-T ***
13718540-C-G 11562864-C-G ***
13734796-G-T 11579120-G-T ***
13721746-A-G 11566070-A-G ***
13721861-A-T 11566185-A-T ***
13723345-T-G 11567669-T-G ***
13723346-G-A 11567670-G-A ***
13723347-T-C 11567671-T-C ***
13731459-T-A 11575783-T-A ***
13731470-C-T 11575794-C-T ***
13833414-A-T 11712708-A-T ***
13833417-G-T 11712711-G-T ***
14184514-G-T 12063808-G-T ***
14183418-A-G 12062712-A-G ***
13858402-T-A 11737696-T-A ***
13860545-C-G 11739839-C-G ***
13860620-G-C 11739914-G-C ***
14051714-C-A 11931008-C-A ***
14051930-C-A 11931224-C-A ***
14065611-A-G 11944905-A-G ***
14175056-A-T 12054350-A-T ***
14184505-G-T 12063799-G-T ***
13856662-G-T 11735956-G-T ***
14184506-G-C 12063800-G-C ***
14184507-C-T 12063801-C-T ***
14184508-T-C 12063802-T-C ***
14184509-C-A 12063803-C-A ***
14184510-A-G 12063804-A-G ***
14184511-C-T 12063805-C-T ***
14184513-A-T 12063807-A-T ***
13858351-G-A 11737645-G-A ***
13856579-T-A 11735873-T-A ***
13833419-A-C 11712713-A-C ***
13856462-G-C 11735756-G-C ***
13833427-G-A 11712721-G-A ***
13833431-G-A 11712725-G-A ***
13833435-T-G 11712729-T-G ***
13833437-G-A 11712731-G-A ***
13833449-C-T 11712743-C-T ***
13833457-C-A 11712751-C-A ***
13833459-G-T 11712753-G-T ***
13856468-G-A 11735762-G-A ***
13856577-A-G 11735871-A-G ***
13856471-C-T 11735765-C-T ***
13856472-C-G 11735766-C-G ***
13856474-A-C 11735768-A-C ***
13856478-T-G 11735772-T-G ***
13856495-G-T 11735789-G-T ***
13856569-A-T 11735863-A-T ***
13856573-C-G 11735867-C-G ***
16108640-C-A 13996760-C-A P8_Prx ***
16108645-G-T 13996765-G-T P8_Prx ***
13718509-T-A 11562833-T-A ***
18492523-C-T 16380643-C-T P6_Dst ***
18369620-G-A 16257740-G-A P6_Prx ***
18369668-T-G 16257788-T-G P6_Prx ***
18369716-T-A 16257836-T-A P6_Prx ***
18369734-C-G 16257854-C-G P6_Prx ***
18430054-T-A 16318174-T-A P6_Dst ***
18443528-C-T 16331648-C-T P6_Dst ***
18466985-C-A 16355105-C-A P6_Dst ***
18520375-G-T 16408495-G-T P6_Dst ***
18186264-C-G 16074384-C-G ***
18527814-G-T 16415934-G-T P6_Dst ***
18533120-C-A 16421240-C-A P6_Dst ***
18533123-A-T 16421243-A-T P6_Dst ***
18630750-C-A 16518870-C-A ***
18688528-C-T 16576648-C-T ***
18789597-G-A 16677717-G-A ***
18789820-C-A 16677940-C-A ***
18316557-G-A 16204677-G-A P6_Prx ***
18156336-C-A 16044456-C-A ***
10023676-C-T 10186067-C-T ***
18008788-G-T 15896908-G-T P7_Dst ***
18008774-C-T 15896894-C-T P7_Dst ***
18008777-C-T 15896897-C-T P7_Dst ***
18008780-G-T 15896900-G-T P7_Dst ***
18008781-G-T 15896901-G-T P7_Dst ***
18008782-G-T 15896902-G-T P7_Dst ***
18008786-A-T 15896906-A-T P7_Dst ***
18008787-C-T 15896907-C-T P7_Dst ***
18008789-C-T 15896909-C-T P7_Dst ***
18015934-A-T 15904054-A-T P7_Dst ***
18008791-A-T 15896911-A-T P7_Dst ***
18008794-C-T 15896914-C-T P7_Dst ***
18008796-C-T 15896916-C-T P7_Dst ***
18008797-C-T 15896917-C-T P7_Dst ***
18008799-G-T 15896919-G-T P7_Dst ***
18008803-C-T 15896923-C-T P7_Dst ***
18008809-C-T 15896929-C-T P7_Dst ***
18879921-G-A 16768041-G-A ***
18901174-T-A 16789294-T-A ***
18008767-G-T 15896887-G-T P7_Dst ***
19727382-A-C 17615502-A-C P5_Prx ***
19423682-A-C 17311802-A-C ***
19547641-C-A 17435761-C-A ***
19682090-T-A 17570210-T-A P5_Prx ***
19693569-C-A 17581689-C-A P5_Prx ***
19709815-G-T 17597935-G-T P5_Prx ***
19727375-T-C 17615495-T-C P5_Prx ***
19727376-A-C 17615496-A-C P5_Prx ***
19730970-T-C 17619090-T-C P5_Prx ***
19244754-T-C 17132874-T-C ***
19731007-A-C 17619127-A-C P5_Prx ***
19758694-C-A 17646814-C-A P5_Prx ***
19930451-G-T 17818571-G-T P5_Prx ***
19930452-C-T 17818572-C-T P5_Prx ***
19930462-C-T 17818582-C-T P5_Prx ***
19930466-C-T 17818586-C-T P5_Prx ***
19938933-G-A 17827053-G-A P5_Prx ***
19325311-T-C 17213431-T-C ***
19189524-T-C 17077644-T-C ***
18902863-C-A 16790983-C-A ***
18959213-T-C 16847333-T-C ***
18937531-T-G 16825651-T-G ***
18937547-T-C 16825667-T-C ***
18937548-G-A 16825668-G-A ***
18937557-T-C 16825677-T-C ***
18937558-G-A 16825678-G-A ***
18937570-G-T 16825690-G-T ***
18951540-C-A 16839660-C-A ***
18987248-C-A 16875368-C-A ***
19189522-A-C 17077642-A-C ***
19071345-C-G 16959465-C-G ***
19100499-T-C 16988619-T-C ***
19187525-C-T 17075645-C-T ***
19187534-C-T 17075654-C-T ***
19187577-C-T 17075697-C-T ***
19187583-C-T 17075703-C-T ***
19189484-G-T 17077604-G-T ***
18008773-C-T 15896893-C-T P7_Dst ***
18008766-G-T 15896886-G-T P7_Dst ***
16108651-A-T 13996771-A-T P8_Prx ***
16583335-A-T 14471455-A-T ***
16113327-A-T 14001447-A-T P8_Prx ***
16148097-C-A 14036217-C-A P8_Dst ***
16165106-G-A 14053226-G-A P8_Dst ***
16277843-C-A 14165963-C-A ***
16305850-G-A 14193970-G-A ***
16336864-T-C 14224984-T-C ***
16522342-G-C 14410462-G-C ***
16583339-C-T 14471459-C-T ***
16113321-A-C 14001441-A-C P8_Prx ***
16583342-G-A 14471462-G-A ***
16583344-C-G 14471464-C-G ***
16599010-G-A 14487130-G-A ***
16621789-G-A 14509909-G-A ***
16689902-C-A 14578022-C-A ***
16719851-A-G 14607971-A-G ***
16720752-T-C 14608872-T-C ***
16113324-C-A 14001444-C-A P8_Prx ***
16113320-C-G 14001440-C-G P8_Prx ***
16843068-C-A 14731188-C-A ***
16108670-A-C 13996790-A-C P8_Prx ***
16108654-A-T 13996774-A-T P8_Prx ***
16108655-T-C 13996775-T-C P8_Prx ***
16108656-G-C 13996776-G-C P8_Prx ***
16108657-A-C 13996777-A-C P8_Prx ***
16108658-G-A 13996778-G-A P8_Prx ***
16108660-A-G 13996780-A-G P8_Prx ***
16108661-G-A 13996781-G-A P8_Prx ***
16108671-G-A 13996791-G-A P8_Prx ***
16113318-T-C 14001438-T-C P8_Prx ***
16108672-T-A 13996792-T-A P8_Prx ***
16108673-T-C 13996793-T-C P8_Prx ***
16108674-G-A 13996794-G-A P8_Prx ***
16108797-A-T 13996917-A-T P8_Prx ***
16108798-G-C 13996918-G-C P8_Prx ***
16113310-C-G 14001430-C-G P8_Prx ***
16113312-C-G 14001432-C-G P8_Prx ***
16834746-C-A 14722866-C-A 45×A***
16988848-C-A 14876968-C-A ***
18008765-A-T 15896885-A-T P7_Dst ***
18008746-C-T 15896866-C-T P7_Dst ***
17994794-C-A 15882914-C-A P7_Prx ***
17994919-G-A 15883039-G-A P7_Prx ***
18008632-C-T 15896752-C-T P7_Dst ***
18008739-G-T 15896859-G-T P7_Dst ***
18008740-C-T 15896860-C-T P7_Dst ***
18008744-G-T 15896864-G-T P7_Dst ***
18008745-G-T 15896865-G-T P7_Dst ***
18008748-C-T 15896868-C-T P7_Dst ***
17994753-T-A 15882873-T-A P7_Prx ***
18008752-C-T 15896872-C-T P7_Dst ***
18008754-C-T 15896874-C-T P7_Dst ***
18008755-G-T 15896875-G-T P7_Dst ***
18008756-G-T 15896876-G-T P7_Dst ***
18008757-C-T 15896877-C-T P7_Dst ***
18008759-C-T 15896879-C-T P7_Dst ***
18008764-C-T 15896884-C-T P7_Dst ***
17994793-G-A 15882913-G-A P7_Prx ***
17994752-C-A 15882872-C-A P7_Prx ***
17042813-C-A 14930933-C-A ***
17374709-C-A 15262829-C-A ***
17084013-A-G 14972133-A-G ***
17090871-T-G 14978991-T-G ***
17098777-C-A 14986897-C-A ***
17127350-C-A 15015470-C-A ***
17227855-C-A 15115975-C-A ***
17246596-A-T 15134716-A-T ***
17370909-C-A 15259029-C-A ***
17548554-C-A 15436674-C-A ***
17994750-G-A 15882870-G-A P7_Prx ***
17580090-C-A 15468210-C-A ***
17622770-C-A 15510890-C-A ***
17716915-C-A 15605035-C-A ***
17770268-C-T 15658388-C-T ***
17994731-T-A 15882851-T-A P7_Prx ***
17994744-T-A 15882864-T-A P7_Prx ***
17994748-G-A 15882868-G-A P7_Prx ***
13718511-A-G 11562835-A-G ***
13718504-T-A 11562828-T-A ***
7217316-T-C 7349275-T-C ***
9539473-G-T 9701864-G-T IR3_Prx ***
9325211-A-C 9487602-A-C ***
9343762-G-T 9506153-G-T ***
9344040-T-C 9506431-T-C ***
9354929-G-A 9517320-G-A ***
9365385-C-G 9527776-C-G ***
9372450-T-G 9534841-T-G ***
9533756-G-T 9696147-G-T IR3_Prx ***
9540304-G-T 9702695-G-T IR3_Prx ***
9311531-T-G 9473922-T-G ***
9540305-C-T 9702696-C-T IR3_Prx ***
9589884-G-T 9752275-G-T IR3_Prx ***
9605852-G-T 9768243-G-T IR3_Prx ***
9622530-T-C 9784921-T-C IR3_Prx ***
9622549-T-G 9784940-T-G IR3_Prx ***
9626093-A-C 9788484-A-C IR3_Prx ***
9634139-T-C 9796530-T-C IR3_Prx ***
9325205-A-G 9487596-A-G ***
9311515-A-G 9473906-A-G ***
9666931-G-T 9829322-G-T IR3_Prx ***
9234288-T-G 9396679-T-G ***
9234278-C-G 9396669-C-G ***
9234280-C-A 9396671-C-A ***
9234281-C-G 9396672-C-G ***
9234283-T-C 9396674-T-C ***
9234284-C-T 9396675-C-T ***
9234285-A-C 9396676-A-C ***
9234286-G-T 9396677-G-T ***
9234291-T-G 9396682-T-G ***
9304878-C-G 9467269-C-G ***
9234293-G-C 9396684-G-C ***
9234294-G-C 9396685-G-C ***
9234295-C-G 9396686-C-G ***
9234296-A-C 9396687-A-C ***
9238563-T-G 9400954-T-G ***
9304113-A-C 9466504-A-C ***
9304678-T-G 9467069-T-G ***
9637383-G-T 9799774-G-T IR3_Prx ***
9740070-G-T 9902461-G-T IR3_Prx ***
9234274-T-A 9396665-T-A ***
9951835-C-A 10114226-C-A ***
9940741-G-A 10103132-G-A ***
9940753-T-C 10103144-T-C ***
9940799-C-G 10103190-C-G ***
9940850-A-G 10103241-A-G ***
9941270-T-C 10103661-T-C ***
9941271-G-A 10103662-G-A ***
9941272-T-G 10103663-T-G ***
9952089-A-G 10114480-A-G ***
9934778-A-G 10097169-A-G ***
9952621-T-A 10115012-T-A ***
9952636-G-A 10115027-G-A ***
9952652-T-C 10115043-T-C ***
9983343-C-A 10145734-C-A ***
10023484-C-T 10185875-C-T ***
10032496-C-G 10194887-C-G ***
10032547-C-T 10194938-C-T ***
9937535-A-G 10099926-A-G ***
9930211-C-G 10092602-C-G ***
9745934-T-C 9908325-T-C ***
9826113-A-G 9988504-A-G ***
9745937-G-C 9908328-G-C ***
9745938-A-C 9908329-A-C ***
9745939-G-C 9908330-G-C ***
9745942-G-C 9908333-G-C ***
9745946-T-C 9908337-T-C ***
9745947-T-C 9908338-T-C ***
9756772-G-T 9919163-G-T ***
9832407-G-T 9994798-G-T ***
9930207-A-G 10092598-A-G ***
9900236-A-G 10062627-A-G ***
9929952-G-A 10092343-G-A ***
9929958-G-A 10092349-G-A ***
9929998-G-T 10092389-G-T ***
9930013-C-G 10092404-C-G ***
9930200-G-A 10092591-G-A ***
9930204-A-G 10092595-A-G ***
9234275-G-C 9396666-G-C ***
9234273-G-C 9396664-G-C ***
10041614-G-T 10204005-G-T ***
7535894-T-A 7667853-T-A ***
7242056-C-G 7374015-C-G ***
7242061-T-A 7374020-T-A ***
7320490-C-T 7452449-C-T ***
7424424-C-A 7556383-C-A ***
7489285-G-T 7621244-G-T IR1_L ***
7501232-T-G 7633191-T-G IR1_L ***
7535885-T-A 7667844-T-A ***
7939380-G-A 8071339-G-A ***
7217343-A-C 7349302-A-C ***
8076172-T-C 8208131-T-C ***
8159012-C-A 8290971-C-A ***
8172711-A-T 8304670-A-T ***
8181341-A-T 8313300-A-T ***
8214942-C-A 8346901-C-A ***
8276323-C-A 8408282-C-A ***
8288839-G-A 8420798-G-A ***
7242041-C-T 7374000-C-T ***
7217342-T-C 7349301-T-C ***
8786833-C-G 8918792-C-G ***
7217330-A-T 7349289-A-T ***
7217318-A-G 7349277-A-G ***
7217322-A-T 7349281-A-T ***
7217323-T-G 7349282-T-G ***
7217324-T-G 7349283-T-G ***
7217326-T-G 7349285-T-G ***
7217327-T-G 7349286-T-G ***
7217329-A-G 7349288-A-G ***
7217331-A-G 7349290-A-G ***
7217341-G-T 7349300-G-T ***
7217332-A-T 7349291-A-T ***
7217333-A-G 7349292-A-G ***
7217334-T-C 7349293-T-C ***
7217335-T-C 7349294-T-C ***
7217337-T-G 7349296-T-G ***
7217339-T-C 7349298-T-C ***
7217340-T-A 7349299-T-A ***
8291034-C-A 8422993-C-A ***
9127449-G-T 9289840-G-T ***
9234271-T-C 9396662-T-C ***
9234258-G-C 9396649-G-C ***
9234249-G-A 9396640-G-A ***
9234250-A-G 9396641-A-G ***
9234251-T-A 9396642-T-A ***
9234252-G-C 9396643-G-C ***
9234253-A-C 9396644-A-C ***
9234255-T-G 9396646-T-G ***
9234256-G-C 9396647-G-C ***
9234259-C-A 9396650-C-A ***
9234247-T-C 9396638-T-C ***
9234260-A-G 9396651-A-G ***
9234261-T-C 9396652-T-C ***
9234263-T-C 9396654-T-C ***
9234264-G-A 9396655-G-A ***
9234266-G-T 9396657-G-T ***
9234268-A-C 9396659-A-C ***
9234269-G-C 9396660-G-C ***
9234248-G-C 9396639-G-C ***
9234246-T-C 9396637-T-C ***
9156688-T-C 9319079-T-C ***
9234230-A-C 9396621-A-C ***
9215996-A-G 9378387-A-G ***
9215999-C-G 9378390-C-G ***
9216002-A-C 9378393-A-C ***
9216008-C-G 9378399-C-G ***
9216009-A-C 9378400-A-C ***
9216018-T-G 9378409-T-G ***
9223864-G-C 9386255-G-C ***
9234231-G-C 9396622-G-C ***
9234241-T-C 9396632-T-C ***
9234232-T-C 9396623-T-C ***
9234233-G-T 9396624-G-T ***
9234234-C-G 9396625-C-G ***
9234235-A-G 9396626-A-G ***
9234238-G-C 9396629-G-C ***
9234239-C-T 9396630-C-T ***
9234240-C-G 9396631-C-G ***
10040743-A-C 10203134-A-C ***
10041627-A-G 10204018-A-G ***
13718502-C-A 11562826-C-A ***
13488733-G-T 11333057-G-T ***
13480568-C-T 11324892-C-T ***
13480675-T-A 11324999-T-A ***
13482066-A-G 11326390-A-G ***
13482080-C-T 11326404-C-T ***
13482122-G-C 11326446-G-C ***
13484436-T-G 11328760-T-G ***
13486740-C-T 11331064-C-T ***
13488886-C-G 11333210-C-G ***
13472196-G-T 11316520-G-T ***
13488995-C-A 11333319-C-A ***
13489003-C-T 11333327-C-T ***
13501902-C-A 11346226-C-A ***
13504880-A-G 11349204-A-G ***
13505435-C-T 11349759-C-T ***
13554245-C-A 11398569-C-A ***
13558171-G-C 11402495-G-C ***
13474810-G-T 11319134-G-T ***
13472187-C-G 11316511-C-G ***
13610952-C-A 11455276-C-A ***
13465350-T-C 11309674-T-C ***
13433172-T-C 11277496-T-C ***
13433173-A-C 11277497-A-C ***
13433174-T-A 11277498-T-A ***
13433175-G-A 11277499-G-A ***
13437877-T-G 11282201-T-G ***
13447255-T-C 11291579-T-C ***
13460967-G-A 11305291-G-A ***
13467914-A-T 11312238-A-T ***
13472121-A-C 11316445-A-C ***
13468133-T-C 11312457-T-C ***
13472038-G-T 11316362-G-T ***
13472055-T-C 11316379-T-C ***
13472081-G-C 11316405-G-C ***
13472103-C-T 11316427-C-T ***
13472113-G-A 11316437-G-A ***
13472117-G-C 11316441-G-C ***
13596552-C-A 11440876-C-A ***
13628693-C-A 11473017-C-A ***
13433170-C-T 11277494-C-T ***
13705631-G-C 11549955-G-C ***
13703400-G-C 11547724-G-C ***
13703405-C-G 11547729-C-G ***
13703407-A-C 11547731-A-C ***
13703410-G-C 11547734-G-C ***
13705626-T-G 11549950-T-G ***
13705629-G-T 11549953-G-T ***
13705630-C-G 11549954-C-G ***
13705635-G-A 11549959-G-A ***
13703393-G-T 11547717-G-T ***
13705639-T-A 11549963-T-A ***
13705643-C-T 11549967-C-T ***
13705645-G-C 11549969-G-C ***
13705656-G-A 11549980-G-A ***
13705659-T-A 11549983-T-A ***
13705660-G-A 11549984-G-A ***
13705661-A-G 11549985-A-G ***
13703396-T-G 11547720-T-G ***
13703391-G-T 11547715-G-T ***
13691825-A-T 11536149-A-T ***
13697979-A-G 11542303-A-G ***
13691826-A-G 11536150-A-G ***
13691834-T-A 11536158-T-A ***
13692799-G-T 11537123-G-T ***
13697975-A-G 11542299-A-G ***
13697976-T-A 11542300-T-A ***
13697977-G-T 11542301-G-T ***
13697978-A-C 11542302-A-C ***
13697980-C-A 11542304-C-A ***
13698012-C-T 11542336-C-T ***
13697981-T-G 11542305-T-G ***
13697982-C-T 11542306-C-T ***
13697983-G-C 11542307-G-C ***
13697984-A-C 11542308-A-C ***
13697987-G-T 11542311-G-T ***
13697988-G-C 11542312-G-C ***
13697989-A-C 11542313-A-C ***
13433171-T-G 11277495-T-G ***
13421415-T-C 11265739-T-C ***
10041636-G-A 10204027-G-A ***
13203914-G-T 11048238-G-T ***
13140623-C-A 10630109-C-A ***
13143050-A-T 10632536-A-T ***
13143055-A-C 10632541-A-C ***
13143060-A-T 10632546-A-T ***
13143610-T-C 10633096-T-C ***
13193972-C-A 11038296-C-A ***
13203913-C-G 11048237-C-G ***
13203915-A-G 11048239-A-G ***
13140618-C-A 10630104-C-A ***
13203916-T-A 11048240-T-A ***
13203917-G-T 11048241-G-T ***
13203919-T-A 11048243-T-A ***
13203920-G-T 11048244-G-T ***
13203921-A-G 11048245-A-G ***
13203922-C-A 11048246-C-A ***
13203923-G-T 11048247-G-T ***
13140619-A-T 10630105-A-T ***
13140617-C-T 10630103-C-T ***
13203926-A-T 11048250-A-T ***
13140104-C-T 10629590-C-T ***
10041649-A-C 10204040-A-C ***
10041691-T-G 10204082-T-G ***
10041698-T-A 10204089-T-A ***
10041741-G-T 10204132-G-T ***
13140101-A-C 10629587-A-C ***
13140102-T-A 10629588-T-A ***
13140103-T-C 10629589-T-C ***
13140107-T-A 10629593-T-A ***
13140615-C-A 10630101-C-A ***
13140600-C-T 10630086-C-T ***
13140601-A-T 10630087-A-T ***
13140604-A-T 10630090-A-T ***
13140605-C-T 10630091-C-T ***
13140608-C-T 10630094-C-T ***
13140612-T-G 10630098-T-G ***
13140613-C-A 10630099-C-A ***
13203925-C-G 11048249-C-G ***
13203927-T-A 11048251-T-A ***
13417505-A-T 11261829-A-T ***
13239439-C-T 11083763-C-T ***
13203955-C-T 11048279-C-T ***
13203956-A-G 11048280-A-G ***
13203957-T-A 11048281-T-A ***
13214106-G-A 11058430-G-A ***
13218953-C-A 11063277-C-A ***
13218966-C-A 11063290-C-A 21×A***
13223746-G-A 11068070-G-A ***
13239448-C-T 11083772-C-T ***
13203952-G-T 11048276-G-T ***
13253224-T-C 11097548-T-C ***
13275934-A-G 11120258-A-G ***
13304213-A-G 11148537-A-G ***
13325983-A-T 11170307-A-T ***
13365794-G-T 11210118-G-T ***
13372168-A-G 11216492-A-G ***
13393360-T-A 11237684-T-A ***
13203954-T-G 11048278-T-G ***
13203951-T-A 11048275-T-A ***
13203929-G-T 11048253-G-T ***
13203937-G-T 11048261-G-T ***
13203930-T-A 11048254-T-A ***
13203931-G-T 11048255-G-T ***
13203932-A-G 11048256-A-G ***
13203933-T-A 11048257-T-A ***
13203934-A-T 11048258-A-T ***
13203935-G-A 11048259-G-A ***
13203936-A-G 11048260-A-G ***
13203938-A-G 11048262-A-G ***
13203950-A-G 11048274-A-G ***
13203939-T-A 11048263-T-A ***
13203940-G-T 11048264-G-T ***
13203941-A-G 11048265-A-G ***
13203942-T-A 11048266-T-A ***
13203945-A-G 11048269-A-G ***
13203946-G-T 11048270-G-T ***
13203948-T-G 11048272-T-G ***
13203949-G-T 11048273-G-T ***
13861586-G-A,C 11740880-G-A,C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
Soucek1324151111-14121211131329189-1011112415173215-15-17-18101119-231515201836-39121211915-1781010810101223-23161012121481222201312111311111212341591611262619111113121091213101111311213241381022151913241712152412241810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: KK2P9*16000000100000008300000
Kit: 1953641076241277963507880331
Used in age calculations16000000100000008300000
Counts of SNPs87
Variant counts last updated 2017-11-05 23:05:52.

* BED data not available. Using default values.


Big Tree Main Page