Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > DF85 > S673 > S668 > DF97 > ZZ36 > FGC19851 > BY3346 > FGC19846 > FGC19840 > FGC19845 > FGC19852

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
205297
FGC-BigY
ZHGA5
13680735-A-T 11525059-A-T +
2651903-G-T 2783862-G-T Y***
22234335-T-C 20072449-T-C DYZ19 **
24518184-C-A 22372037-C-A **
4063917-C-T 4195876-C-T **
13941716-A-C 11821010-A-C **
10048846-A-G 10211237-A-G **
14785022-C-A 12673092-C-A **
13740609-T-A 11584933-T-A **
14815709-C-A 12703780-C-A **
14491212-G-A 12370481-G-A *****
17201762-CTTT-C 15089882-CTTT-C 16×T**
15397763-C-A 13285883-C-A **
13897029-C-A 11776323-C-A **
7090966-C-A 7222925-C-A **
6998204-C-A 7130163-C-A **
6978237-C-A 7110196-C-A **
10048858-C-T 10211249-C-T **
21297728-C-A 19135842-C-A **
27319730-T-C 25173583-T-C P1_g3 **
22234332-CT-C 20072446-CT-C DYZ19 **
13945606-A-T 11824900-A-T **
13838543-AATCAC-A 11717837-AATCAC-A *****
3100424-G-T 3232383-G-T **
21744398-T-C 19582512-T-C **
20390132-G-T 18228246-G-T P5_Dst **
7225683-G-A 7357642-G-A **
28688244-C-A 26542097-C-A **
28543163-C-A 26397016-C-A **
21672147-C-A 19510261-C-A **
3986035-C-A 4117994-C-A **
28101123-TG-T 25954976-TG-T P1_Y2 **
2684611-C-A 2816570-C-A **
14491213-G-A 12370482-G-A *****
20217930-C-A 18056044-C-A P5_Dst **
22077112-C-T 19915226-C-T **
13881553-G-T 11760847-G-T **
5937242-CTATATA-C 6069201-CTATATA-C 18×TA**
13890190-C-A 11769484-C-A **
14517673-C-A 12405874-C-A **
13740604-AATG-A 11584928-AATG-A **
58987557-T-C 56841410-T-C **
22504554-T-G 20342668-T-G DYZ19 **
7232992-T-C 7364951-T-C **
13894441-C-T 11773735-C-T **
10018233-A-G 10180624-A-G **
6830391-C-A 6962350-C-A **
58987280-T-C 56841133-T-C **
17135823-T-A 15023943-T-A **
16297287-C-A 14185407-C-A **
20809831-C-A 18647945-C-A P4_Gap **
9713326-GCA-G 9875717-GCA-G IR3_Prx 20×CA**
58848158-C-CCCATT 56742662-C-CAATGG 10×CCATT*****
6519314-C-T 6651273-C-T **
28101093-G-A 25954946-G-A P1_Y2 **
20995546-T-TCTTTC 18833660-T-TCTTTC P4_Dst 11×CTTTC**
13652130-G-GTGGAATGGAA 11496454-G-GTGGAATGGAA 11×TGGAA**
16030291-C-A 13918411-C-A **
5242502-GTA-G 5374461-GTA-G **
22765770-C-A 20603884-C-A **
16929821-C-A 14817941-C-A **
22767669-A-C 20605783-A-C **
3759043-CT-C 3891002-CT-C ****
23184460-C-G 21022574-C-G **
16702018-G-T 14590138-G-T **
16279376-C-T 14167496-C-T **
9921850-T-C 10084241-T-C PF6725 **
19562493-G-C 17450613-G-C **
13494346-C-A 11338670-C-A **
13858287-T-C 11737581-T-C **
17701749-C-A 15589869-C-A **
22435753-A-T 20273867-A-T DYZ19 **
19293769-TC-T 17181889-TC-T **
23807452-C-A 21645566-C-A **
18143700-G-T 16031820-G-T **
15863210-C-A 13751330-C-A **
13461364-T-A 11305688-T-A *****
58991580-C-T 56845433-C-T **
22435755-T-C 20273869-T-C DYZ19 **
19356390-G-T 17244510-G-T **
13459366-CTGTTG-C 11303690-CTGTTG-C **
20914457-C-A 18752571-C-A P4_Dst ***
21132671-A-T 18970785-A-T ***
21515781-T-G 19353895-T-G ***
21503170-T-G 19341284-T-G ***
21163096-C-A 19001210-C-A ***
20932604-G-T 18770718-G-T P4_Dst ***
21381604-C-A 19219718-C-A ***
20943352-C-T 18781466-C-T P4_Dst ***
21118830-C-A 18956944-C-A ***
20953622-C-A 18791736-C-A P4_Dst ***
20950886-C-T 18789000-C-T P4_Dst ***
21021584-A-T 18859698-A-T P4_Dst ***
20998050-G-A 18836164-G-A P4_Dst ***
20984183-T-C 18822297-T-C P4_Dst ***
20982336-T-A 18820450-T-A P4_Dst ***
13458327-C-A 11302651-C-A ***
22169193-C-A 20007307-C-A ***
21555488-C-A 19393602-C-A ***
22256902-A-T 20095016-A-T DYZ19 ***
22244991-A-C 20083105-A-C DYZ19 ***
22244992-G-A 20083106-G-A DYZ19 ***
22244993-A-T 20083107-A-T DYZ19 ***
22244994-G-T 20083108-G-T DYZ19 ***
22244995-T-C 20083109-T-C DYZ19 ***
22245001-C-G 20083115-C-G DYZ19 ***
22256899-G-A 20095013-G-A DYZ19 ***
22256901-T-G 20095015-T-G DYZ19 ***
22256903-C-A 20095017-C-A DYZ19 ***
22244989-C-A 20083103-C-A DYZ19 ***
22256904-A-T 20095018-A-T DYZ19 ***
22257962-C-T 20096076-C-T DYZ19 ***
22258386-C-T 20096500-C-T DYZ19 ***
22258575-G-A 20096689-G-A DYZ19 ***
22258577-G-T 20096691-G-T DYZ19 ***
22266197-T-A 20104311-T-A DYZ19 ***
22266199-T-G 20104313-T-G DYZ19 ***
22266346-A-T 20104460-A-T DYZ19 ***
22244990-C-T 20083104-C-T DYZ19 ***
22244988-T-C 20083102-T-C DYZ19 ***
21569953-G-A 19408067-G-A SK2225 ***
22171734-G-T 20009848-G-T ***
21629547-A-C 19467661-A-C ***
21671987-A-G 19510101-A-G ***
21700610-A-C 19538724-A-C ***
21700612-A-G 19538726-A-G ***
21747853-C-T 19585967-C-T ***
21852250-C-A 19690364-C-A ***
22056571-C-A 19894685-C-A ***
20886847-T-A 18724961-T-A P4_Dst ***
22219444-A-G 20057558-A-G DYZ19 ***
22244986-T-A 20083100-T-A DYZ19 ***
22227923-C-T 20066037-C-T DYZ19 ***
22234735-T-G 20072849-T-G DYZ19 ***
22234754-A-T 20072868-A-T DYZ19 ***
22236337-T-C 20074451-T-C DYZ19 ***
22237298-A-C 20075412-A-C DYZ19 ***
22237301-C-A 20075415-C-A DYZ19 ***
22237302-T-C 20075416-T-C DYZ19 ***
22237303-C-T 20075417-C-T DYZ19 ***
22237304-T-C 20075418-T-C DYZ19 ***
20913280-G-A 18751394-G-A P4_Dst ***
20654154-C-G 18492268-C-G P4_Prx ***
20886845-T-A 18724959-T-A P4_Dst ***
19709803-C-A 17597923-C-A P5_Prx ***
19577837-C-G 17465957-C-G P5_Prx ***
19577838-T-C 17465958-T-C P5_Prx ***
19695087-C-T 17583207-C-T P5_Prx ***
19695090-C-T 17583210-C-T P5_Prx ***
19700555-C-T 17588675-C-T P5_Prx ***
19709771-G-A 17597891-G-A P5_Prx ***
19709798-T-A 17597918-T-A P5_Prx ***
19709800-G-A 17597920-G-A P5_Prx ***
19709801-G-A 17597921-G-A P5_Prx ***
19709807-C-A 17597927-C-A P5_Prx ***
19577834-C-A 17465954-C-A P5_Prx ***
19727384-T-C 17615504-T-C P5_Prx ***
19727387-T-C 17615507-T-C P5_Prx ***
19727388-G-C 17615508-G-C P5_Prx ***
19727423-T-C 17615543-T-C P5_Prx ***
19727536-A-C 17615656-A-C P5_Prx ***
19727554-A-C 17615674-A-C P5_Prx ***
19730964-A-C 17619084-A-C P5_Prx ***
19744955-G-T 17633075-G-T P5_Prx ***
19765775-C-T 17653895-C-T P5_Prx ***
19577835-T-A 17465955-T-A P5_Prx ***
19577833-A-G 17465953-A-G P5_Prx ***
19857942-T-G 17746062-T-G P5_Prx ***
19577815-T-A 17465935-T-A P5_Prx ***
19577801-T-A 17465921-T-A P5_Prx ***
19577804-A-T 17465924-A-T P5_Prx ***
19577805-A-G 17465925-A-G P5_Prx ***
19577806-G-T 17465926-G-T P5_Prx ***
19577808-A-C 17465928-A-C P5_Prx ***
19577811-T-G 17465931-T-G P5_Prx ***
19577812-C-T 17465932-C-T P5_Prx ***
19577813-T-G 17465933-T-G P5_Prx ***
19577814-A-G 17465934-A-G P5_Prx ***
19577818-A-G 17465938-A-G P5_Prx ***
19577832-G-T 17465952-G-T P5_Prx ***
19577819-G-T 17465939-G-T P5_Prx ***
19577820-T-C 17465940-T-C P5_Prx ***
19577822-G-A 17465942-G-A P5_Prx ***
19577823-A-G 17465943-A-G P5_Prx ***
19577824-C-T 17465944-C-T P5_Prx ***
19577825-C-A 17465945-C-A P5_Prx ***
19577826-T-C 17465946-T-C P5_Prx ***
19577828-C-G 17465948-C-G P5_Prx ***
19577830-G-A 17465950-G-A P5_Prx ***
19577831-G-T 17465951-G-T P5_Prx ***
19783687-C-A 17671807-C-A P5_Prx ***
19868136-A-T 17756256-A-T P5_Prx ***
20886837-G-A 18724951-G-A P4_Dst ***
20654176-A-C 18492290-A-C P4_Prx ***
20481135-G-A 18319249-G-A P5_Dst ***
20488019-G-T 18326133-G-T P5_Dst ***
20501116-A-T 18339230-A-T P5_Dst ***
20648947-T-C 18487061-T-C P4_Prx ***
20648948-G-T 18487062-G-T P4_Prx ***
20654151-A-G 18492265-A-G P4_Prx ***
20654155-T-G 18492269-T-G P4_Prx ***
20654157-A-G 18492271-A-G P4_Prx ***
20654173-T-G 18492287-T-G P4_Prx ***
20654183-A-G 18492297-A-G P4_Prx ***
20439934-C-T 18278048-C-T P5_Dst ***
20654186-C-G 18492300-C-G P4_Prx ***
20654189-A-G 18492303-A-G P4_Prx ***
20809663-G-T 18647777-G-T P4_Gap ***
20869021-G-T 18707135-G-T P4_Dst 21×T***
20869223-C-T 18707337-C-T P4_Dst ***
20869292-C-A 18707406-C-A P4_Dst ***
20869997-A-G 18708111-A-G P4_Dst ***
20873614-G-T 18711728-G-T P4_Dst ***
20886818-T-C 18724932-T-C P4_Dst ***
20886835-G-A 18724949-G-A P4_Dst ***
20470288-C-A 18308402-C-A P5_Dst ***
20428440-G-T 18266554-G-T P5_Dst ***
19868137-G-T 17756257-G-T P5_Prx ***
20107286-C-A 17995406-C-A P5_Dst ***
19919382-C-A 17807502-C-A P5_Prx ***
19939632-C-A 17827752-C-A P5_Prx ***
19992053-G-C 17880173-G-C P5_Prx ***
19992054-C-T 17880174-C-T P5_Prx ***
20084532-A-T 17972652-A-T P5_Dst ***
20084558-G-T 17972678-G-T P5_Dst ***
20084563-A-T 17972683-A-T P5_Dst ***
20096972-G-T 17985092-G-T P5_Dst ***
20097028-A-G 17985148-A-G P5_Dst ***
20243004-T-A 18081118-T-A P5_Dst ***
20415456-T-C 18253570-T-C P5_Dst ***
20243589-G-T 18081703-G-T P5_Dst ***
20306352-G-A 18144466-G-A P5_Dst ***
20312742-G-A 18150856-G-A P5_Dst ***
20340123-C-T 18178237-C-T P5_Dst ***
20340126-C-T 18178240-C-T P5_Dst ***
20340221-G-T 18178335-G-T P5_Dst ***
20340226-A-T 18178340-A-T P5_Dst ***
20340233-A-T 18178347-A-T P5_Dst ***
20348861-T-C 18186975-T-C P5_Dst ***
20390252-G-T 18228366-G-T P5_Dst ***
22286898-T-C 20125012-T-C DYZ19 ***
22317576-A-G 20155690-A-G DYZ19 ***
22286899-C-G 20125013-C-G DYZ19 ***
24157164-G-T 22011017-G-T P3_b1 ***
24133088-T-G 21986941-T-G P3_b1 ***
24143607-A-C 21997460-A-C P3_b1 ***
24154197-T-C 22008050-T-C P3_b1 ***
24154198-G-A 22008051-G-A P3_b1 ***
24154200-A-G 22008053-A-G P3_b1 ***
24154361-T-C 22008214-T-C P3_b1 ***
24157142-T-C 22010995-T-C P3_b1 ***
24157143-G-A 22010996-G-A P3_b1 ***
24157163-T-C 22011016-T-C P3_b1 ***
24157167-A-T 22011020-A-T P3_b1 ***
24084253-A-C 21938106-A-C P3_b1 ***
24235355-C-A 22089208-C-A P3_b1 ***
24235489-G-A 22089342-G-A P3_b1 ***
24242256-C-A 22096109-C-A P3_b1 ***
24389468-T-A 22243321-T-A ***
24404165-G-T 22258018-G-T ***
24420999-C-T 22274852-C-T ***
24421003-C-T 22274856-C-T ***
24535817-A-C 22389670-A-C P3_t2 ***
24571149-A-T 22425002-A-T P3_t2 ***
24575793-A-G 22429646-A-G P3_t2 ***
24084262-A-C 21938115-A-C P3_b1 ***
24083893-C-A 21937746-C-A P3_b1 ***
24582240-A-T 22436093-A-T P3_t2 ***
24024757-A-T 21878610-A-T ***
23901132-C-T 21739246-C-T ***
23901133-A-G 21739247-A-G ***
23901140-T-C 21739254-T-C ***
24021384-G-T 21875237-G-T ***
24021403-G-A 21875256-G-A ***
24021405-T-G 21875258-T-G ***
24023390-G-T 21877243-G-T ***
24023429-C-T 21877282-C-T ***
24023430-A-G 21877283-A-G ***
24023431-G-A 21877284-G-A ***
24027977-G-C 21881830-G-C ***
24074107-A-T 21927960-A-T P3_b1 ***
24032472-T-A 21886325-T-A ***
24034873-G-A 21888726-G-A ***
24036051-C-G 21889904-C-G ***
24040663-T-C 21894516-T-C ***
24043784-T-G 21897637-T-G ***
24043790-C-T 21897643-C-T ***
24043800-T-G 21897653-T-G ***
24067327-G-T 21921180-G-T P3_b1 ***
24067360-A-C 21921213-A-C P3_b1 ***
24067362-G-A 21921215-G-A P3_b1 ***
24579084-T-C 22432937-T-C P3_t2 ***
24595520-C-T 22449373-C-T P3_t2 ***
23822663-T-A 21660777-T-A ***
24794424-T-G 22648277-T-G P3_b2 ***
24762565-A-C 22616418-A-C P3_b2 ***
24762576-A-C 22616429-A-C P3_b2 ***
24762687-G-T 22616540-G-T P3_b2 ***
24771280-G-T 22625133-G-T P3_b2 ***
24775669-A-C 22629522-A-C P3_b2 ***
24792912-G-T 22646765-G-T P3_b2 ***
24792917-G-A 22646770-G-A P3_b2 ***
24792932-C-G 22646785-C-G P3_b2 ***
24794415-C-G 22648268-C-G P3_b2 ***
24794431-A-G 22648284-A-G P3_b2 ***
24762211-A-G 22616064-A-G P3_b2 ***
24794458-A-G 22648311-A-G P3_b2 ***
24794487-C-G 22648340-C-G P3_b2 ***
24794780-G-T 22648633-G-T P3_b2 ***
24850014-T-G 22703867-T-G P3_b2 ***
24850046-G-T 22703899-G-T P3_b2 ***
24895738-A-G 22749591-A-G g1 ***
24940894-C-G 22794747-C-G g1 ***
25011070-G-T 22864923-G-T g1 ***
25137073-G-T 22990926-G-T g1 ***
25165697-G-A 23019550-G-A g1 ***
24762215-C-A 22616068-C-A P3_b2 ***
24762196-A-C 22616049-A-C P3_b2 ***
24602185-G-T 22456038-G-T P3_t2 ***
24664972-T-C 22518825-T-C P3_b2 ***
24602200-C-T 22456053-C-T P3_t2 ***
24602203-G-T 22456056-G-T P3_t2 ***
24602207-C-T 22456060-C-T P3_t2 ***
24604260-C-A 22458113-C-A P3_t2 ***
24636335-G-T 22490188-G-T P3_t2 ***
24643226-C-G 22497079-C-G P3_t2 ***
24643276-T-C 22497129-T-C P3_t2 ***
24650780-C-T 22504633-C-T P3_b2 ***
24654603-C-A 22508456-C-A P3_b2 ***
24659990-C-T 22513843-C-T P3_b2 ***
24670676-G-T 22524529-G-T P3_b2 ***
24762195-G-T 22616048-G-T P3_b2 ***
24673122-G-T 22526975-G-T P3_b2 ***
24720891-A-T 22574744-A-T P3_b2 ***
24720971-A-C 22574824-A-C P3_b2 ***
24728349-A-T 22582202-A-T P3_b2 ***
24728605-T-A 22582458-T-A P3_b2 ***
24750785-G-A 22604638-G-A P3_b2 ***
24754852-T-A 22608705-T-A P3_b2 ***
24759894-G-A 22613747-G-A P3_b2 ***
24762178-A-C 22616031-A-C P3_b2 ***
24762187-A-T 22616040-A-T P3_b2 ***
23848581-G-T 21686695-G-T ***
23696313-A-C 21534427-A-C ***
22286900-C-G 20125014-C-G DYZ19 ***
22356965-A-T 20195079-A-T DYZ19 ***
22341253-T-A 20179367-T-A DYZ19 ***
22341259-C-A 20179373-C-A DYZ19 ***
22344460-T-A 20182574-T-A DYZ19 ***
22344581-T-A 20182695-T-A DYZ19 ***
22352224-A-G 20190338-A-G DYZ19 ***
22352453-G-T 20190567-G-T DYZ19 ***
22352624-G-T 20190738-G-T DYZ19 ***
22354410-A-G 20192524-A-G DYZ19 ***
22356008-T-C 20194122-T-C DYZ19 ***
22357332-G-C 20195446-G-C DYZ19 ***
22338481-C-G 20176595-C-G DYZ19 ***
22357336-A-T 20195450-A-T DYZ19 ***
22357341-A-T 20195455-A-T DYZ19 ***
22357342-C-A 20195456-C-A DYZ19 ***
22357357-G-A 20195471-G-A DYZ19 ***
22358189-A-G 20196303-A-G DYZ19 ***
22360393-A-C 20198507-A-C DYZ19 ***
22367360-T-C 20205474-T-C DYZ19 ***
22367400-C-T 20205514-C-T DYZ19 ***
22367425-T-G 20205539-T-G DYZ19 ***
22426019-A-T 20264133-A-T DYZ19 ***
22338762-A-T 20176876-A-T DYZ19 ***
22337751-G-C 20175865-G-C DYZ19 ***
22435982-A-G 20274096-A-G DYZ19 ***
22301142-T-C 20139256-T-C DYZ19 ***
22286901-A-T 20125015-A-T DYZ19 ***
22286904-T-G 20125018-T-G DYZ19 ***
22286906-C-T 20125020-C-T DYZ19 ***
22286907-A-C 20125021-A-C DYZ19 ***
22286908-T-G 20125022-T-G DYZ19 ***
22286909-G-T 20125023-G-T DYZ19 ***
22286911-T-G 20125025-T-G DYZ19 ***
22286912-C-T 20125026-C-T DYZ19 ***
22293403-C-T 20131517-C-T DYZ19 ***
22301139-A-C 20139253-A-C DYZ19 ***
22315989-C-T 20154103-C-T DYZ19 ***
22334893-A-G 20173007-A-G DYZ19 ***
22316743-T-G 20154857-T-G DYZ19 ***
22316747-A-T 20154861-A-T DYZ19 ***
19577798-A-T 17465918-A-T P5_Prx ***
22317581-T-C 20155695-T-C DYZ19 ***
22319293-C-T 20157407-C-T DYZ19 ***
22321197-A-C 20159311-A-C DYZ19 ***
22321201-A-T 20159315-A-T DYZ19 ***
22330477-C-A 20168591-C-A DYZ19 ***
22330539-G-T 20168653-G-T DYZ19 ***
22330562-A-G 20168676-A-G DYZ19 ***
22429804-T-G 20267918-T-G DYZ19 ***
22446990-G-T 20285104-G-T DYZ19 ***
23514293-C-T 21352407-C-T ***
23415300-G-C 21253414-G-C ***
22962059-C-T 20800173-C-T ***
22995222-A-G 20833336-A-G ***
23007487-G-T 20845601-G-T ***
23034416-A-C 20872530-A-C ***
23066481-C-A 20904595-C-A ***
23100061-C-A 20938175-C-A ***
23181518-T-A 21019632-T-A ***
23204609-C-G 21042723-C-G ***
23360729-C-A 21198843-C-A ***
23415301-T-A 21253415-T-A ***
22644673-C-A 20482787-C-A ***
23415302-A-T 21253416-A-T ***
23415303-T-G 21253417-T-G ***
23415305-T-A 21253419-T-A ***
23415308-G-T 21253422-G-T ***
23415309-T-A 21253423-T-A ***
23415311-T-C 21253425-T-C ***
23415312-G-C 21253426-G-C 15×TA***
23439948-C-G 21278062-C-G ***
23475644-T-C 21313758-T-C ***
23514124-A-G 21352238-A-G ***
22816365-T-G 20654479-T-G ***
22511612-A-G 20349726-A-G DYZ19 ***
22446999-A-C 20285113-A-C DYZ19 ***
22498994-T-G 20337108-T-G DYZ19 ***
22460219-C-G 20298333-C-G DYZ19 ***
22460222-T-A 20298336-T-A DYZ19 ***
22460223-A-G 20298337-A-G DYZ19 ***
22460224-C-T 20298338-C-T DYZ19 ***
22482716-G-T 20320830-G-T DYZ19 ***
22488722-G-C 20326836-G-C DYZ19 ***
22492932-G-C 20331046-G-C DYZ19 ***
22493065-G-A 20331179-G-A DYZ19 ***
22496236-T-G 20334350-T-G DYZ19 ***
22498856-T-A 20336970-T-A DYZ19 ***
22499006-T-G 20337120-T-G DYZ19 ***
22508729-G-A 20346843-G-A DYZ19 ***
22502517-G-C 20340631-G-C DYZ19 ***
22502551-G-T 20340665-G-T DYZ19 ***
22503960-C-G 20342074-C-G A4409 DYZ19 ***
22508720-T-A 20346834-T-A DYZ19 ***
22508721-C-A 20346835-C-A DYZ19 ***
22508722-T-A 20346836-T-A DYZ19 ***
22508723-T-G 20346837-T-G DYZ19 ***
22508724-C-T 20346838-C-T DYZ19 ***
22508725-A-T 20346839-A-T DYZ19 ***
22508727-A-T 20346841-A-T DYZ19 ***
19577799-T-C 17465919-T-C P5_Prx ***
19389745-G-A 17277865-G-A ***
19577797-C-T 17465917-C-T P5_Prx ***
14491246-A-T ***
14491235-C-T ***
14491236-A-C ***
14491237-G-T ***
14491238-G-T ***
14491239-A-C ***
14491240-G-A ***
14491242-C-T ***
14491244-C-T ***
14491245-A-G ***
14491248-C-G ***
14491230-G-A ***
14491249-A-T ***
14491250-G-A ***
14491251-G-C ***
14491253-G-C ***
14491254-C-A ***
14491255-A-T ***
14491256-G-A ***
14491257-G-C ***
14491258-A-T ***
14491231-G-A ***
14491229-A-T ***
14491263-G-C ***
14483192-C-G 12362461-C-G ***
14118448-C-A 11997742-C-A ***
14128409-A-T 12007703-A-T ***
14161578-A-G 12040872-A-G ***
14228914-C-A 12108208-C-A ***
14283443-C-A 12162737-C-A ***
14295298-A-G 12174592-A-G ***
14295414-C-A 12174708-C-A ***
14391565-G-A 12270861-G-A ***
14391567-T-G 12270863-T-G ***
14491214-T-C 12370483-T-C ***
14491228-A-C ***
14491217-G-T ***
14491218-G-T ***
14491219-T-G ***
14491220-G-C ***
14491221-G-A ***
14491222-A-T ***
14491223-A-T ***
14491224-G-T ***
14491225-G-C ***
14491227-G-T ***
14491262-A-T ***
14491264-G-T ***
13908698-C-A 11787992-C-A ***
15749060-G-T 13637180-G-T ***
14959796-C-A 12847871-C-A ***
14990346-A-C 12878431-A-C ***
15049903-A-G 12937994-A-G ***
15169057-A-T 13057143-A-T ***
15280405-A-G 13168504-A-G ***
15363991-C-G 13252111-C-G ***
15363994-A-G 13252114-A-G ***
15364003-T-G 13252123-T-G ***
15475254-C-A 13363374-C-A ***
15764047-C-A 13652167-C-A ***
14667817-C-A 12555882-C-A 23×A***
15792856-C-A 13680976-C-A ***
15793427-T-A 13681547-T-A ***
15842861-T-C 13730981-T-C ***
15865984-G-T 13754104-G-T ***
15865986-A-T 13754106-A-T ***
15865987-A-T 13754107-A-T ***
15865989-A-T 13754109-A-T ***
15865990-A-T 13754110-A-T ***
15865993-A-T 13754113-A-T ***
15865994-G-T 13754114-G-T ***
14926455-T-C 12814520-T-C ***
14667816-T-A 12555881-T-A ***
14491265-A-G ***
14491279-A-C ***
14491266-G-T ***
14491267-G-T ***
14491268-G-T ***
14491269-G-T ***
14491272-G-T ***
14491273-A-G ***
14491274-G-A ***
14491275-C-A ***
14491276-C-A ***
14491280-C-T ***
14667815-C-A 12555880-C-A ***
14491281-A-G ***
14491282-C-T ***
14491284-T-C ***
14491287-A-C ***
14491289-A-T ***
14491290-C-G ***
14491291-A-T ***
14491292-A-T ***
14607525-G-T 12495727-G-T ***
14607632-G-T 12495834-G-T ***
14065508-C-A 11944802-C-A ***
13859039-C-T 11738333-C-T ***
15865996-A-T 13754116-A-T ***
13702759-G-A 11547083-G-A ***
13543294-A-G 11387618-A-G ***
13552588-T-G 11396912-T-G ***
13571646-A-C 11415970-A-C ***
13585082-G-A 11429406-G-A ***
13597057-C-A 11441381-C-A ***
13689950-G-A 11534274-G-A ***
13692481-A-C 11536805-A-C ***
13692482-G-T 11536806-G-T ***
13692483-T-G 11536807-T-G ***
13703376-G-C 11547700-G-C ***
13523597-T-G 11367921-T-G ***
13703377-T-A 11547701-T-A ***
13703383-G-A 11547707-G-A ***
13720565-A-G 11564889-A-G ***
13720883-G-A 11565207-G-A ***
13720887-G-A 11565211-G-A ***
13720890-C-A 11565214-C-A ***
13720891-A-T 11565215-A-T ***
13720907-A-G 11565231-A-G ***
13720933-A-C 11565257-A-C ***
13524079-G-T 11368403-G-T ***
13523596-C-A 11367920-C-A ***
13725394-T-G 11569718-T-G ***
13460907-A-T 11305231-A-T ***
13460632-A-T 11304956-A-T ***
13460727-C-G 11305051-C-G ***
13460731-T-A 11305055-T-A ***
13460732-C-G 11305056-C-G ***
13460748-T-A 11305072-T-A ***
13460760-T-A 11305084-T-A ***
13460762-A-T 11305086-A-T ***
13460783-G-A 11305107-G-A ***
13460885-C-T 11305209-C-T ***
13460908-T-C 11305232-T-C ***
13496731-G-C 11341055-G-C ***
13461342-G-A 11305666-G-A ***
13461369-G-A 11305693-G-A ***
13478182-C-G 11322506-C-G ***
13478190-C-T 11322514-C-T ***
13478263-C-T 11322587-C-T ***
13480547-G-A 11324871-G-A ***
13486758-T-G 11331082-T-G ***
13489194-G-A 11333518-G-A ***
13489211-A-T 11333535-A-T ***
13496712-C-A 11341036-C-A ***
13725393-A-T 11569717-A-T ***
13725395-A-T 11569719-A-T ***
13858825-T-A 11738119-T-A ***
13725464-A-C 11569788-A-C ***
13725441-A-C 11569765-A-C ***
13725442-A-T 11569766-A-T ***
13725443-T-G 11569767-T-G ***
13725446-A-T 11569770-A-T ***
13725447-A-G 11569771-A-G ***
13725453-T-A 11569777-T-A ***
13725459-G-T 11569783-G-T ***
13725460-C-G 11569784-C-G ***
13725462-A-C 11569786-A-C ***
13725465-G-C 11569789-G-C ***
13725439-A-G 11569763-A-G ***
13729992-G-A 11574316-G-A ***
13732155-C-T 11576479-C-T ***
13732171-C-G 11576495-C-G ***
13737205-T-A 11581529-T-A ***
13739753-T-G 11584077-T-G ***
13744820-C-G 11589144-C-G ***
13745216-A-G 11589540-A-G ***
13746428-G-T 11590752-G-T ***
13854738-A-G 11734032-A-G ***
13856849-G-A 11736143-G-A ***
13725440-C-G 11569764-C-G ***
13725438-T-A 11569762-T-A ***
13725396-G-A 11569720-G-A ***
13725414-A-G 11569738-A-G ***
13725398-A-T 11569722-A-T ***
13725399-C-G 11569723-C-G ***
13725401-G-A 11569725-G-A ***
13725403-A-T 11569727-A-T ***
13725404-T-G 11569728-T-G ***
13725406-G-A 11569730-G-A ***
13725410-G-A 11569734-G-A ***
13725411-G-A 11569735-G-A ***
13725413-A-T 11569737-A-T ***
13725416-G-A 11569740-G-A ***
13725435-C-G 11569759-C-G ***
13725419-T-C 11569743-T-C ***
13725421-A-G 11569745-A-G ***
13725424-T-A 11569748-T-A ***
13725425-G-T 11569749-G-T ***
13725426-G-C 11569750-G-C ***
13725428-A-T 11569752-A-T ***
13725430-T-G 11569754-T-G ***
13725431-T-A 11569755-T-A ***
13725432-A-C 11569756-A-C ***
13725434-T-G 11569758-T-G ***
15865995-A-T 13754115-A-T ***
15865997-G-T 13754117-G-T ***
19577796-A-T 17465916-A-T P5_Prx ***
18353714-T-G 16241834-T-G P6_Prx ***
18353703-C-G 16241823-C-G P6_Prx ***
18353704-T-A 16241824-T-A P6_Prx ***
18353705-C-T 16241825-C-T P6_Prx ***
18353706-T-A 16241826-T-A P6_Prx ***
18353707-T-A 16241827-T-A P6_Prx ***
18353708-G-A 16241828-G-A P6_Prx ***
18353709-A-C 16241829-A-C P6_Prx ***
18353710-C-A 16241830-C-A P6_Prx ***
18353711-C-A 16241831-C-A P6_Prx ***
18353716-T-G 16241836-T-G P6_Prx ***
18353701-A-T 16241821-A-T P6_Prx ***
18353717-T-G 16241837-T-G P6_Prx ***
18353719-T-G 16241839-T-G P6_Prx ***
18353721-T-A 16241841-T-A P6_Prx ***
18353722-C-T 16241842-C-T P6_Prx ***
18353723-T-C 16241843-T-C P6_Prx ***
18353724-G-T 16241844-G-T P6_Prx ***
18353725-G-A 16241845-G-A P6_Prx ***
18361316-T-A 16249436-T-A P6_Prx ***
18361485-C-A 16249605-C-A P6_Prx ***
18353702-T-G 16241822-T-G P6_Prx ***
18353699-C-A 16241819-C-A P6_Prx ***
18462334-A-C 16350454-A-C P6_Dst ***
18353683-A-T 16241803-A-T P6_Prx ***
18008800-C-T 15896920-C-T P7_Dst ***
18008801-C-T 15896921-C-T P7_Dst ***
18158321-C-A 16046441-C-A ***
18184564-G-T 16072684-G-T ***
18186136-C-A 16074256-C-A ***
18297946-G-T 16186066-G-T P6_Prx ***
18353677-T-C 16241797-T-C P6_Prx ***
18353679-A-C 16241799-A-C P6_Prx ***
18353681-T-A 16241801-T-A P6_Prx ***
18353685-A-C 16241805-A-C P6_Prx ***
18353698-G-A 16241818-G-A P6_Prx ***
18353686-A-C 16241806-A-C P6_Prx ***
18353687-G-C 16241807-G-C P6_Prx ***
18353688-T-A 16241808-T-A P6_Prx ***
18353689-C-T 16241809-C-T P6_Prx ***
18353690-A-C 16241810-A-C P6_Prx ***
18353691-G-A 16241811-G-A P6_Prx ***
18353693-A-C 16241813-A-C P6_Prx ***
18353695-A-G 16241815-A-G P6_Prx ***
18353696-C-G 16241816-C-G P6_Prx ***
18353697-G-T 16241817-G-T P6_Prx ***
18369623-G-A 16257743-G-A P6_Prx ***
18467065-G-T 16355185-G-T P6_Dst ***
18008787-C-A 15896907-C-A P7_Dst ***
19577759-C-T 17465879-C-T P5_Prx ***
25207780-G-A 23061633-G-A P2_r1 ***
19389746-T-A 17277866-T-A ***
19509947-C-A 17398067-C-A ***
19577686-T-C 17465806-T-C P5_Prx ***
19577696-C-T 17465816-C-T P5_Prx ***
19577706-A-T 17465826-A-T P5_Prx ***
19577708-A-T 17465828-A-T P5_Prx ***
19577718-A-C 17465838-A-C P5_Prx ***
19577757-T-C 17465877-T-C P5_Prx ***
19577761-C-T 17465881-C-T P5_Prx ***
19319862-A-C 17207982-A-C ***
19577764-T-A 17465884-T-A P5_Prx ***
19577774-A-G 17465894-A-G P5_Prx ***
19577780-G-T 17465900-G-T P5_Prx ***
19577784-G-A 17465904-G-A P5_Prx ***
19577786-G-A 17465906-G-A P5_Prx ***
19577788-G-A 17465908-G-A P5_Prx ***
19577790-A-T 17465910-A-T P5_Prx ***
19577791-A-T 17465911-A-T P5_Prx ***
19577792-A-T 17465912-A-T P5_Prx ***
19577794-A-C 17465914-A-C P5_Prx ***
19319863-T-A 17207983-T-A ***
19319861-T-A 17207981-T-A ***
18490226-C-A 16378346-C-A P6_Dst ***
18856983-A-G 16745103-A-G ***
18511138-T-A 16399258-T-A P6_Dst ***
18524640-A-T 16412760-A-T P6_Dst ***
18530741-G-A 16418861-G-A P6_Dst ***
18533071-C-A 16421191-C-A P6_Dst ***
18627476-C-A 16515596-C-A ***
18653325-C-A 16541445-C-A ***
18747146-T-A 16635266-T-A ***
18780360-C-A 16668480-C-A ***
18856982-C-T 16745102-C-T ***
18959207-T-C 16847327-T-C ***
19206740-G-A 17094860-G-A ***
19031323-C-T 16919443-C-T ***
19189466-G-T 17077586-G-T ***
19189467-A-T 17077587-A-T ***
19189512-A-C 17077632-A-C ***
19189531-T-C 17077651-T-C ***
19189534-G-C 17077654-G-C ***
19189545-T-C 17077665-T-C ***
19189547-A-C 17077667-A-C ***
19206732-C-T 17094852-C-T ***
19206734-C-A 17094854-C-A ***
18008790-C-T 15896910-C-T P7_Dst ***
18008785-C-T 15896905-C-T P7_Dst ***
15865998-G-T 13754118-G-T ***
17843182-C-T 15731302-C-T ***
17260415-C-A 15148535-C-A ***
17349339-T-A 15237459-T-A ***
17385378-C-A 15273498-C-A ***
17475193-C-T 15363313-C-T ***
17475195-C-T 15363315-C-T ***
17475198-C-T 15363318-C-T ***
17475209-G-C 15363329-G-C ***
17629653-C-A 15517773-C-A ***
17802162-T-C 15690282-T-C ***
17843200-T-C 15731320-T-C ***
17006374-C-A 14894494-C-A ***
17843204-G-T 15731324-G-T ***
17843207-T-C 15731327-T-C ***
17843223-C-G 15731343-C-G ***
17843227-G-A 15731347-G-A ***
17859103-C-A 15747223-C-A ***
17860031-T-G 15748151-T-G ***
17929813-G-T 15817933-G-T ***
17944931-A-C 15833051-A-C ***
17994798-G-A 15882918-G-A P7_Prx ***
17994806-A-C 15882926-A-C P7_Prx ***
17244630-G-T 15132750-G-T ***
16993533-G-T 14881653-G-T ***
17994809-G-A 15882929-G-A P7_Prx ***
16148322-A-T 14036442-A-T P8_Dst ***
15865999-A-T 13754119-A-T ***
15866000-A-T 13754120-A-T ***
15928726-G-T 13816846-G-T ***
16015686-C-A 13903806-C-A ***
16016446-C-A 13904566-C-A ***
16044457-C-A 13932577-C-A ***
16054042-C-A 13942162-C-A ***
16073050-C-A 13961170-C-A ***
16147434-C-A 14035554-C-A P8_Dst ***
16150031-C-A 14038151-C-A P8_Dst ***
16897642-T-A 14785762-T-A ***
16150060-G-T 14038180-G-T P8_Dst ***
16181300-C-A 14069420-C-A ***
16205774-C-A 14093894-C-A ***
16292639-C-T 14180759-C-T ***
16480952-T-G 14369072-T-G ***
16562830-T-C 14450950-T-C ***
16677596-C-A 14565716-C-A ***
16704877-C-A 14592997-C-A ***
16720239-C-A 14608359-C-A ***
16816364-C-A 14704484-C-A ***
17994807-T-A 15882927-T-A P7_Prx ***
17994810-C-A 15882930-C-A P7_Prx ***
18008780-G-A 15896900-G-A P7_Dst ***
18008749-A-T 15896869-A-T P7_Dst ***
18008730-G-T 15896850-G-T P7_Dst ***
18008731-G-T 15896851-G-T P7_Dst ***
18008732-C-T 15896852-C-T P7_Dst ***
18008734-G-T 15896854-G-T P7_Dst ***
18008735-G-T 15896855-G-T P7_Dst ***
18008736-A-T 15896856-A-T P7_Dst ***
18008737-G-T 15896857-G-T P7_Dst ***
18008742-G-T 15896862-G-T P7_Dst ***
18008747-G-T 15896867-G-T P7_Dst ***
18008750-A-T 15896870-A-T P7_Dst ***
18008725-G-T 15896845-G-T P7_Dst ***
18008755-G-A 15896875-G-A P7_Dst ***
18008759-C-G 15896879-C-G P7_Dst ***
18008760-A-T 15896880-A-T P7_Dst ***
18008761-C-T 15896881-C-T P7_Dst ***
18008763-G-T 15896883-G-T P7_Dst ***
18008767-G-A 15896887-G-A P7_Dst ***
18008770-C-T 15896890-C-T P7_Dst ***
18008775-C-A 15896895-C-A P7_Dst ***
18008776-C-A 15896896-C-A P7_Dst ***
18008777-C-A 15896897-C-A P7_Dst ***
18008729-A-T 15896849-A-T P7_Dst ***
18008724-C-T 15896844-C-T P7_Dst ***
17994815-C-G 15882935-C-G P7_Prx ***
17994832-C-A 15882952-C-A P7_Prx ***
17994818-C-A 15882938-C-A P7_Prx ***
17994820-C-A 15882940-C-A P7_Prx ***
17994821-T-A 15882941-T-A P7_Prx ***
17994822-C-A 15882942-C-A P7_Prx ***
17994826-C-A 15882946-C-A P7_Prx ***
17994827-C-A 15882947-C-A P7_Prx ***
17994828-T-A 15882948-T-A P7_Prx ***
17994829-G-A 15882949-G-A P7_Prx ***
17994830-G-A 15882950-G-A P7_Prx ***
17994833-G-A 15882953-G-A P7_Prx ***
18008722-G-A 15896842-G-A P7_Dst ***
17994835-C-A 15882955-C-A P7_Prx ***
17994837-G-A 15882957-G-A P7_Prx ***
17994839-G-A 15882959-G-A P7_Prx ***
17994841-G-A 15882961-G-A P7_Prx ***
18008707-A-T 15896827-A-T P7_Dst ***
18008708-G-T 15896828-G-T P7_Dst ***
18008710-C-T 15896830-C-T P7_Dst ***
18008712-G-T 15896832-G-T P7_Dst ***
18008718-C-T 15896838-C-T P7_Dst ***
18008719-G-T 15896839-G-T P7_Dst ***
25207776-T-A 23061629-T-A P2_r1 ***
25366481-A-C 23220334-A-C P2_r2 ***
25231927-C-G 23085780-C-G P2_r1 ***
17474932-ATT-A 15363052-ATT-A 12×T***
15866310-AAG-A 13754430-AAG-A ***
16147477-TA-T 14035597-TA-T P8_Dst 14×A***
16148997-TA-T 14037117-TA-T P8_Dst 10×A***
16157792-AACTTTCCAATGACGTTCTTAGAGCAACT-GAAGGAAAGAAAGAAAGAAAAGGGTGTTG 14045912-AACTTTCCAATGACGTTCTTAGAGCAACT-GAAGGAAAGAAAGAAAGAAAAGGGTGTTG P8_Dst ***
16250624-G-TT 14138744-G-TT 28×T***
16297330-GTT-G 14185450-GTT-G 26×T***
16595919-CTTTTTT-C 14484039-CTTTTTT-C 17×T***
16860774-G-AA 14748894-G-AA 9×A***
17459485-CAAAAA-C 15347605-CAAAAA-C 25×A***
17564912-GAAAAA-G 15453032-GAAAAA-G 16×A***
14875586-CTTTGTG-TTTTTT 12763656-CTTTGTG-TTTTTT ***
17872639-CTTTTT-C 15760759-CTTTTT-C 17×T***
17994869-C-AAA 15882989-C-AAA P7_Prx ***
18017150-TAT-C 15905270-TAT-C ***
18035663-GAC-TTTT 15923783-GAC-TTTT ***
18430094-CA-C 16318214-CA-C P6_Dst 28×A***
18447621-G-TTT 16335741-G-TTT P6_Dst 18×T***
18448945-GT-G 16337065-GT-G P6_Dst ***
18465467-CAG-AAAA 16353587-CAG-AAAA P6_Dst ***
18487808-TAA-T 16375928-TAA-T P6_Dst 19×A***
18615932-C-CTT 16504052-C-CTT 27×T***
15252823-C-AAA 13140909-C-AAA ***
14743154-CAAAAAA-C 12631222-CAAAAAA-C 19×A***
19647571-CTTTT-C 17535691-CTTTT-C P5_Prx 16×T***
13801174-AACTCGAATGG-GAATTGAACCA 11680468-AACTCGAATGG-GAATTGAACCA ***
13729781-TG-AC 11574105-TG-AC ***
13729958-TCAAGTGGAA-AGGAGCAGAG 11574282-TCAAGTGGAA-AGGAGCAGAG ***
13731966-CCAA-TGAC 11576290-CCAA-TGAC ***
13732202-T-AATGGA 11576526-T-AATGGA ***
13732202-T-TATGGA 11576526-T-TATGGA ***
13732560-TC-AG 11576884-TC-AG ***
13734783-TTC-CTG 11579107-TTC-CTG ***
13740606-TGATATCGAAAGGAAGGGAA-AATGGATTTGAACAGAT 11584930-TGATATCGAAAGGAAGGGAA-AATGGATTTGAACAGAT ***
13801113-C-CGAATGGAATGGACTCGAATGGAATGTGCTCGAATG 11680407-C-CGAATGGAATGGACTCGAATGGAATGTGCTCGAATG 12×GAATG***
13801189-GATTCGAATG-TAATGGACTT 11680483-GATTCGAATG-TAATGGACTT ***
14559665-GA-G 12447866-GA-G 10×A***
13856642-AA-GG 11735936-AA-GG ***
13859837-ATCGAAAGG-GTGGACACA 11739131-ATCGAAAGG-GTGGACACA ***
13885857-CTTTT-C 11765151-CTTTT-C 19×T***
13919208-CAA-C 11798502-CAA-C 17×A***
13962037-CTTTCC-TTTTTT 11841331-CTTTCC-TTTTTT ***
14324894-CT-C 12204188-CT-C 26×T***
14339089-GTTTC-TTTTT 12218384-GTTTC-TTTTT ***
14491211-T-TGGTA 12370480-T-TGGTA ***
14491261-AA-GT ***
14491276-CGCACACTTTTAAACAA-AGCCTGTTCTTCATGTT ***
19206769-AAG-A 17094889-AAG-A ***
19668814-AAT-A 17556934-AAT-A P5_Prx ***
13729613-GGG-TGC 11573937-GGG-TGC ***
20970352-C-CAA 18808466-C-CAA P4_Dst 12×A***
20530282-CA-C 18368396-CA-C P5_Dst ***
20755571-CTT-C 18593685-CTT-C P4_Prx 15×T***
20757350-CCTGTGATTTACA-TTTTTTTTTTT 18595464-CCTGTGATTTACA-TTTTTTTTTTT P4_Prx ***
20881862-C-CA 18719976-C-CA P4_Dst 16×A***
20886819-CACAGGCT-AAAAAAAA 18724933-CACAGGCT-AAAAAAAA P4_Dst ***
20920178-C-CAA 18758292-C-CAA P4_Dst 14×A***
20932612-GAA-G 18770726-GAA-G P4_Dst 17×A***
20949799-AAAG-GCAC 18787913-AAAG-GCAC P4_Dst ***
20949941-TTGATG-CTGACA 18788055-TTGATG-CTGACA P4_Dst ***
21015059-AAG-A 18853173-AAG-A P4_Dst 9×AG***
20481197-A-AT 18319311-A-AT P5_Dst 9×T***
21022787-G-GA 18860901-G-GA P4_Dst 11×A***
21025133-TA-T 18863247-TA-T P4_Dst ***
21149582-G-TT 18987696-G-TT 27×T***
21306618-G-AA 19144732-G-AA ***
21306622-GAAAG-AAAAA 19144736-GAAAG-AAAAA ***
21402212-TTTTA-T 19240326-TTTTA-T ***
22235088-TA-AC 20073202-TA-AC DYZ19 ***
22235090-CAAG-AAGC 20073204-CAAG-AAGC DYZ19 ***
22237286-TATA-CATC 20075400-TATA-CATC DYZ19 ***
22256889-TACGG-GTTCC 20095003-TACGG-GTTCC DYZ19 ***
20492878-T-TC 18330992-T-TC P5_Dst 9×C***
20479819-AT-A 18317933-AT-A P5_Dst 14×T***
19695161-C-CT 17583281-C-CT P5_Prx 18×T***
20116698-T-TC 18004818-T-TC P5_Dst 10×C***
19713343-G-GT 17601463-G-GT P5_Prx 11×T***
19721757-ACCGA-CCCGC 17609877-ACCGA-CCCGC P5_Prx ***
19775301-TC-T 17663421-TC-T P5_Prx ***
19809172-AT-A 17697292-AT-A P5_Prx 10×T***
19829294-ACTTTC-TTTTTT 17717414-ACTTTC-TTTTTT P5_Prx ***
19892868-G-TT 17780988-G-TT P5_Prx 31×T***
19930476-CTT-C 17818596-CTT-C P5_Prx 22×T***
20063941-TAAAAA-T 17952061-TAAAAA-T P5_Gap 18×A***
20086349-T-TA 17974469-T-TA P5_Dst 10×A***
20107299-G-AA 17995419-G-AA P5_Dst 24×A***
20203507-A-ATGTTGT 18041621-A-ATGTTGT P5_Dst 10×TGT***
20439958-G-GT 18278072-G-GT P5_Dst 16×T***
20245100-TA-T 18083214-TA-T P5_Dst 9×A***
20247747-C-CA 18085861-C-CA P5_Dst 10×A***
20256948-TA-T 18095062-TA-T P5_Dst 12×A***
20280154-TCTTC-T 18118268-TCTTC-T P5_Dst 8×CTTC***
20326007-C-TT 18164121-C-TT P5_Dst 29×T***
20366225-AT-A 18204339-AT-A P5_Dst 8×T***
20386768-G-GAAA 18224882-G-GAAA P5_Dst 15×A***
20390195-GA-G 18228309-GA-G P5_Dst ***
20430442-CAA-C 18268556-CAA-C P5_Dst 22×A***
20438758-AT-A 18276872-AT-A P5_Dst 23×T***
13729753-ACC-TCG 11574077-ACC-TCG ***
13729318-TAA-GG 11573642-TAA-GG ***
22273589-GAT-AGA 20111703-GAT-AGA DYZ19 ***
26556114-C-CA 24409967-C-CA P1_g2 10×A***
10067427-AC-CA 10229818-AC-CA ***
20950918-G-GA 18789032-G-GA P4_Dst 9×A***
10048872-CA-TG 10211263-CA-TG ***
28065155-C-CT 25919008-C-CT P1_Y2 15×T***
20723982-AT-A 18562096-AT-A P4_Prx 14×T***
16340170-C-AA 14228290-C-AA ***
9531231-GGT-G 9693622-GGT-G IR3_Prx 10×GT***
27761295-GA-G 25615148-GA-G P1_Y2 15×A***
24601759-G-GT 22455612-G-GT P3_t2 11×T***
3544896-G-GA 3676855-G-GA ***
9557583-C-CA 9719974-C-CA IR3_Prx 11×A***
3790878-GTATATA-G 3922837-GTATATA-G 21×TA***
4358621-TTCTAACTTGAACATACACACTCCCACATAC-CCCCGAAACCCATCTCACTCACATACATACAT 4490580-TTCTAACTTGAACATACACACTCCCACATAC-CCCCGAAACCCATCTCACTCACATACATACAT ***
4358656-CTGTGCATGCACACAC-ACGTACATACATAGAT 4490615-CTGTGCATGCACACAC-ACGTACATACATAGAT ***
4358676-CACACAC-ACACACA 4490635-CACACAC-ACACACA ***
4521612-TAA-T 4653571-TAA-T 17×A***
5109180-AT-A 5241139-AT-A 11×T***
6210549-C-CT 6342508-C-CT IR3_Dst 14×T***
6226043-T-TCTTC 6358002-T-TCTTC IR3_Dst ***
6226088-T-TTTCC 6358047-T-TTTCC IR3_Dst ***
6323750-CA-C 6455709-CA-C IR3_Dst 12×A***
27222206-GA-G 25076059-GA-G P1_g3 16×A***
27311977-C-CA 25165830-C-CA P1_g3 16×A***
6403210-CTTAG-GTTTT 6535169-CTTAG-GTTTT ***
27072229-G-GAT 24926082-G-GAT P1_r4 21×AT***
58994612-T-C 56848465-T-C ***
58995897-G-T 56849750-G-T ***
59007980-A-C 56861833-A-C ***
59022265-T-A 56876118-T-A ***
59022271-C-A 56876124-C-A 50×A***
13851695-ACAAATG-TCGAATT 11730989-ACAAATG-TCGAATT ***
13460876-AGG-GAT 11305200-AGG-GAT ***
20815408-CATAT-C 18653522-CATAT-C P4_Gap 22×AT***
22263725-AT-TC 20101839-AT-TC DYZ19 ***
26890135-GAT-G 24743988-GAT-G P1_r3 20×AT***
9622370-TTG-T 9784761-TTG-T IR3_Prx ***
27881475-C-CT 25735328-C-CT P1_Y2 12×T***
27692068-GA-G 25545921-GA-G P1_Y2 15×A***
18492480-GA-G 16380600-GA-G P6_Dst 17×A***
19790172-GA-G 17678292-GA-G P5_Prx 15×A***
23807600-G-AA 21645714-G-AA ***
14061366-AT-A 11940660-AT-A 17×T***
22341286-GATGAAGCTGCA-AAAGAATGAAGC 20179400-GATGAAGCTGCA-AAAGAATGAAGC DYZ19 ***
15749575-C-CT 13637695-C-CT 15×T***
27509349-G-GA 25363202-G-GA P1_Y2 12×A***
26713801-CA-C 24567654-CA-C P1_g2 18×A***
9636618-TTG-T 9799009-TTG-T IR3_Prx 13×TG***
6403097-GTA-ATC 6535056-GTA-ATC ***
6734680-CTTTTT-C 6866639-CTTTTT-C 21×T***
13489616-C-CCCCGT 11333940-C-CCCCGT ***
13301284-CA-TG 11145608-CA-TG ***
10086339-TAT-AAA 10248730-TAT-AAA ***
10102809-AG-A 10265200-AG-A ***
13140098-AGA-TCC 10629584-AGA-TCC ***
13140601-AA-TC 10630087-AA-TC ***
13143462-TAAT-CCAC 10632948-TAAT-CCAC ***
13143473-AAT-CAC 10632959-AAT-CAC ***
13193995-TCCCAT-CTCCAC 11038319-TCCCAT-CTCCAC ***
13287377-TT-CG 11131701-TT-CG ***
13301231-TAA-CAG 11145555-TAA-CAG ***
13320303-TAAAA-GAAAG 11164627-TAAAA-GAAAG ***
10067434-ACCA-GCCG 10229825-ACCA-GCCG ***
13329549-ACT-GCA 11173873-ACT-GCA ***
13423948-AGT-GGG 11268272-AGT-GGG ***
13452873-GCATTCCATTCCATTCCATTCCATTC-G 11297197-GCATTCCATTCCATTCCATTCCATTC-G 14×CATTC***
13460808-AAGC-GAGT 11305132-AAGC-GAGT ***
13460851-TTCCC-ATCCG 11305175-TTCCC-ATCCG ***
13461010-AAGT-GAGA 11305334-AAGT-GAGA ***
13461127-ACTA-CCTG 11305451-ACTA-CCTG ***
13461325-CAAG-TAAAT 11305649-CAAG-TAAAT ***
13461354-GAG-CTT 11305678-GAG-CTT ***
13486740-CATT-TATC 11331064-CATT-TATC ***
10086310-TC-GA 10248701-TC-GA ***
10067405-AAGT-GTGC 10229796-AAGT-GTGC ***
7165273-CTG-TTT 7297232-CTG-TTT ***
9623645-T-TA 9786036-T-TA IR3_Prx 11×A***
7405015-AGAT-A 7536974-AGAT-A ***
7867929-A-AAAG 7999888-A-AAAG ***
8786746-ACCA-CCCC 8918705-ACCA-CCCC ***
9215556-CAGGGAAGGC-GGGGGGGGGG 9377947-CAGGGAAGGC-GGGGGGGGGG ***
9304418-CTCGGAGGAGGCTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGGGGGGGGGGGGGG 9466809-CTCGGAGGAGGCTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGGGGGGGGGGGGGG ***
9307398-TTGTGTGTG-T 9469789-TTGTGTGTG-T 15×TG***
9345025-CTTGGGCA-GGGGGGGGGG 9507416-CTTGGGCA-GGGGGGGGGG ***
9345036-AAGGC-GGGGG 9507427-AAGGC-GGGGG ***
9529142-CTT-C 9691533-CTT-C IR3_Prx 15×T***
9589945-C-CT 9752336-C-CT IR3_Prx 10×T***
9654389-A-AGAAG 9816780-A-AGAAG IR3_Prx ***
10014734-AATGT-TATGC 10177125-AATGT-TATGC ***
9930134-GCCCGCCCCTT-G 10092525-GCCCGCCCCTT-G ***
9930171-GCTAG-TCTTA 10092562-GCTAG-TCTTA ***
9930212-TGAAGACACCTGCGACCTCAGGAACG-ACACCCCGGGACGGCAGGAAACCTAC 10092603-TGAAGACACCTGCGACCTCAGGAACG-ACACCCCGGGACGGCAGGAAACCTAC ***
9943801-ATCCT-CTCCC 10106192-ATCCT-CTCCC ***
9943885-ATTA-TTTT 10106276-ATTA-TTTT ***
9945110-G-GA 10107501-G-GA ***
9945412-CAC-AAT 10107803-CAC-AAT ***
9951900-GAATA-CAATG 10114291-GAATA-CAATG ***
9952707-GTCTC-ATCTG 10115098-GTCTC-ATCTG ***
9952735-AGTTA-GGGCG 10115126-AGTTA-GGGCG ***
22273575-TTACAATCCTTA-GTTACAGCACTT 20111689-TTACAATCCTTA-GTTACAGCACTT DYZ19 ***
22281897-CT-TC 20120011-CT-TC DYZ19 ***
58990413-A-T 56844266-A-T ***
58830157-CCCATTCCATTCAATT-C 56760673-AAATGGAATGGAATTG-A ***
58820557-GTTG-TTCC 56770311-CAAC-GGAA ***
58821900-ACCT-TCAA 56768968-AGGT-TTGA ***
58821911-GCAGTCTT-CCATTACA 56768953-AAGACTGC-TGTAATGG ***
58821923-CTTCGAG-AATCCAT 56768942-CTCGAAG-ATGGATT ***
58821938-GTTCG-ATTCC 56768929-CGAAC-GGAAT ***
58821948-ATTCCG-TTTCCA 56768918-CGGAAT-TGGAAA ***
58822051-G-GCATTCCATTCCGTGGGTGTC 56768804-G-GCCACGGAATGGAATGGACAC ***
58824560-CTTC-ATTA 56766308-GAAG-TAAT ***
58824882-TC-T 56765986-AG-A ***
58830540-ATTCCATTGGATTACT-A 56760308-GAATGGAAAGTAATCC-G ***
58820494-GCATTCGTGTCCGTTCTATTCGAG-CCACTCGAATCCACTCCATTACAC 56770354-CTCGAATAGAACGGACACGAATGC-GTGTAATGGAGTGGATTCGAGTGG ***
58834672-TA-T 56756197-AT-A ***
58835237-AT-A 56755631-GA-G ***
58835765-GGCATTCCATTCCATTCCA-TGCATTCCATTCCT 56755088-TGGAATGGAATGGAATGCC-AGGAATGGAATGCA ***
58837915-TCCATTTGATGCCATC-T 56752936-CATGGGATGGCATCAA-C ***
58838641-ATTCGAATCCTTTCT-TTTCAAGTCCATTCC 56752216-AGAAAGGATTCGAAT-GGAATGGACTTGAAA ***
58838687-ATCCCT-TTTCAG 56752179-AGGGAT-CTGAAA ***
58838705-CATTACAG-GATTCGAT 56752159-CTGTAATG-ATCGAATC ***
58838722-ATAG-TTCC 56752146-CTAT-GGAA ***
58838736-TTTGCC-ATTCCA 56752130-GGCAAA-TGGAAT ***
58840730-GCATACAATTTCACTCCATTCGTTCCC-TGCATTTTTTCCGTTCAATTACATTCG 56750115-GGGAACGAATGGAGTGAAATTGTATGC-CGAATGTAATTGAACGGAAAAAATGCA ***
58820525-CATTACAGTCT-C 56770332-GAATAGACTGT-G ***
58819449-TTC-ATTCCATT 56771420-GAA-AATGGAAT ***
58842149-CTTTCT-C 56748716-TAGAAA-T ***
27996127-G-GAA 25849980-G-GAA P1_Y2 14×A***
27862535-TGA-T 25716388-TGA-T P1_Y2 22×GA***
27873319-CTTTCC-TTTTTTT 25727172-CTTTCC-TTTTTTT P1_Y2 ***
27889318-AAC-A 25743171-AAC-A P1_Y2 14×AC***
27918818-GA-G 25772671-GA-G P1_Y2 11×A***
27943970-CCA-C 25797823-CCA-C P1_Y2 14×CA***
27947646-C-CA 25801499-C-CA P1_Y2 8×A***
27960966-TAA-T 25814819-TAA-T P1_Y2 18×A***
27963480-CA-C 25817333-CA-C P1_Y2 11×A***
27968354-C-CTT 25822207-C-CTT P1_Y2 14×T***
27971754-C-AA 25825607-C-AA P1_Y2 ***
28027423-AT-A 25881276-AT-A P1_Y2 10×T***
28802672-TGGAT-AGGAG 26656525-TGGAT-AGGAG ***
28030733-T-TTTCG 25884586-T-TTTCG P1_Y2 ***
28033129-C-CA 25886982-C-CA P1_Y2 17×A***
28044809-CA-C 25898662-CA-C P1_Y2 ***
28203963-ACCTA-CCCTT 26057816-ACCTA-CCCTT P1_b4 ***
28242000-GT-G 26095853-GT-G P1_b4 9×T***
28253556-GAAGCT-AAAAAA 26107409-GAAGCT-AAAAAA P1_b4 ***
28257584-C-GAG 26111437-C-GAG P1_b4 18×AG***
28406839-C-CA 26260692-C-CA P1_gr2 16×A***
28438188-CAAAA-C 26292041-CAAAA-C P1_gr2 31×A***
28542416-CAA-C 26396269-CAA-C 17×A***
58841874-CTTCCATTCGATTCCT-C 56748967-TGGAATCGAATGGAAA-T ***
58842174-GATTT-AATTC 56748693-AAATC-GAATT ***
27844422-ACCCA-CCCCC 25698275-ACCCA-CCCCC P1_Y2 ***
18039365-AAT-A 15927485-AAT-A ***
58983167-C-CCACTA 56837020-C-CCACTA ***
58984994-TACC-CACT 56838847-TACC-CACT ***
58985078-GGGGC-AGGGA 56838931-GGGGC-AGGGA ***
58989444-GGTGCTTTGTGACATATCCCTGCAATGATCACCCAGATGATGT-TGGCGTTTTGACATAGCTCTGCACAGATCACCTAGGTTATGTA 56843297-GGTGCTTTGTGACATATCCCTGCAATGATCACCCAGATGATGT-TGGCGTTTTGACATAGCTCTGCACAGATCACCTAGGTTATGTA ***
58990390-GA-TT 56844243-GA-TT ***
58990399-CATTTTAACT-TATTGTGAGA 56844252-CATTTTAACT-TATTGTGAGA ***
58994544-ACGG-GCGA 56848397-ACGG-GCGA ***
58994573-GGG-TGA 56848426-GGG-TGA ***
58994624-ATAAG-GTAAC 56848477-ATAAG-GTAAC ***
19979863-GCT-G 17867983-GCT-G P5_Prx ***
58914155-CTG-TTC 56676714-CAG-GAA ***
20510960-GAT-G 18349074-GAT-G P5_Dst ***
24686426-TAC-T 22540279-TAC-T P3_b2 ***
27412863-ATATG-A 25266716-ATATG-A P1_g3 ***
58908838-TCCATC-T 56682023-AATGGG-A ***
13464359-T-A,G 11308683-T-A,G ***
28799250-GA-A,G 26653103-GA-A,G ***
9181072-CATAT-C,CAT 9343463-CATAT-C,CAT 14×AT***
13457663-A-G,T 11301987-A-G,T ***
13680706-A-G,T 11525030-A-G,T ***
13680891-T-A,G 11525215-T-A,G ***
58979305-CTCCAT-C 56833158-CTCCAT-C ***
58912415-TACCATTCCAT-CTCCACTCCTC 56678446-ATGGAATGGTA-GAGGAGTGGAG ***
58842185-ATTCTGTTCT-TTTCCATGCC 56748677-AGAACAGAAT-GGCATGGAAA ***
58883875-TTCCAT-C 56706991-ATGGAA-G ***
58844535-TCAC-CCAT 56746333-GTGA-ATGG ***
58846063-G-ACATTC 56744808-C-GAATGT ***
58846098-AT-CC 56744772-AT-GG ***
58848262-CTCTATC-TTCCATT 56742603-GATAGAG-AATGGAA ***
58857035-CTCCACA-TTCAATC 56733830-TGTGGAG-GATTGAA ***
58865958-GAG-CAT 56724911-CTC-ATG ***
58865999-TA-AT 56724871-TA-AT ***
58866431-TCCATTTGATGCCATC-T 56724420-CATGGGATGGCATCAA-C ***
58873268-CTCTATC-TTCCATT 56717597-GATAGAG-AATGGAA ***
58874918-CTCC-TTCA 56715950-GGAG-TGAA ***
58885021-TGTTCT-CATTCC 56705845-AGAACA-GGAATG ***
58912402-ACTA-CAAT 56678466-TAGT-ATTG ***
58886881-GGAGTCA-CGATTCC 56703984-TGACTCC-GGAATCG ***
58886893-TTT-ATA 56703976-AAA-TAT ***
58890943-GTCCATTTCACACCAG-CTACAGTCCACTCCTC 56699913-CTGGTGTGAAATGGAC-GAGGAGTGGACTGTAG ***
58890964-TACTA-AACAC 56699903-TAGTA-GTGTT ***
58890973-TTCCATA-CTCCACT 56699892-TATGGAA-AGTGGAG ***
58890983-TTCCATCCCAC-CTCTAA 56699878-GTGGGATGGAA-TTAGAG ***
58908829-CCATACCAT-TGGGTTGAA 56682034-ATGGTATGG-TTCAACCCA ***
58908924-GCACTCC-AGGATTG 56681941-GGAGTGC-CAATCCT ***
58908939-ACATTCTACTCTA-CCGTTCCATTAGT 56681920-TAGAGTAGAATGT-ACTAATGGAACGG ***
58908953-CTG-TCC 56681916-CAG-GGA ***
27847931-GT-G 25701784-GT-G P1_Y2 11×T***
27819786-ATT-A 25673639-ATT-A P1_Y2 13×T***
22337543-TTAC-CAGT 20175657-TTAC-CAGT DYZ19 ***
24789179-CA-C 22643032-CA-C P3_b2 8×A***
24577878-CA-C 22431731-CA-C P3_t2 25×A***
24597813-CTT-C 22451666-CTT-C P3_t2 22×T***
24607334-G-TT 22461187-G-TT P3_t2 ***
24646583-GT-G 22500436-GT-G P3_b2 21×T***
24670716-CT-C 22524569-CT-C P3_b2 ***
24678599-A-AT 22532452-A-AT P3_b2 ***
24693328-GA-G 22547181-GA-G P3_b2 ***
24700953-AAAGACAC-A 22554806-AAAGACAC-A P3_b2 ***
24773659-AT-A 22627512-AT-A P3_b2 9×T***
24792990-ACT-CCC 22646843-ACT-CCC P3_b2 ***
24568394-AAT-A 22422247-AAT-A P3_t2 8×AT***
24794449-AGGT-GGGG 22648302-AGGT-GGGG P3_b2 ***
24794470-ACC-CCG 22648323-ACC-CCG P3_b2 ***
24794478-AGGGT-GGGGG 22648331-AGGGT-GGGGG P3_b2 ***
24795027-G-GA 22648880-G-GA P3_b2 9×A***
24825568-CT-C 22679421-CT-C P3_b2 15×T***
24895705-AG-TT 22749558-AG-TT g1 ***
24907802-AAT-A 22761655-AAT-A g1 ***
25165673-TC-T 23019526-TC-T g1 ***
25251571-G-AA 23105424-G-AA P2_r1 ***
25287593-GA-G 23141446-GA-G P2_r1 ***
24575876-CTTT-C 22429729-CTTT-C P3_t2 24×T***
24560975-T-TA 22414828-T-TA P3_t2 10×A***
25431783-AT-A 23285636-AT-A P2_r2 8×T***
23678682-G-GT 21516796-G-GT 14×T***
22358694-TTT-AAG 20196808-TTT-AAG DYZ19 ***
22431696-AA-CC 20269810-AA-CC DYZ19 ***
22446106-AC-CT 20284220-AC-CT DYZ19 ***
22492913-CTGCCGAC-GTGCAGAA 20331027-CTGCCGAC-GTGCAGAA DYZ19 ***
22493033-TGAAA-AGAAG 20331147-TGAAA-AGAAG DYZ19 ***
22493046-TTT-CTC 20331160-TTT-CTC DYZ19 ***
22502526-TTT-AAG 20340640-TTT-AAG DYZ19 ***
22502545-ATAC-TTAG 20340659-ATAC-TTAG DYZ19 ***
22829644-CAAAAAA-C 20667758-CAAAAAA-C 18×A***
23415293-TATATATGTATGTATGT-GTAAGGTCATGGAATTA 21253407-TATATATGTATGTATGT-GTAAGGTCATGGAATTA ***
23723544-CATATATAT-C 21561658-CATATATAT-C 27×AT***
24541332-TA-T 22395185-TA-T P3_t2 8×A***
24016986-C-CT 21870839-C-CT 15×T***
24027307-G-GA 21881160-G-GA 12×A***
24043029-CGGGAGGGGTCTGGTGTCTGGGTCAGGTTGAGGTACCCCTGGGACCCG-C 21896882-CGGGAGGGGTCTGGTGTCTGGGTCAGGTTGAGGTACCCCTGGGACCCG-C ***
24084207-A-CC 21938060-A-CC P3_b1 ***
24115164-CCA-C 21969017-CCA-C P3_b1 23×CA***
24235359-TC-AA 22089212-TC-AA P3_b1 ***
24280901-AG-A 22134754-AG-A P3_t1 ***
24283360-G-AA 22137213-G-AA P3_t1 ***
24323664-T-TA 22177517-T-TA P3_t1 14×A***
24432837-CAA-C 22286690-CAA-C 17×A***
25306190-GA-G 23160043-GA-G P2_r1 ***
25432611-CAAAAAA-C 23286464-CAAAAAA-C P2_r2 26×A***
27809534-GCTAT-ACAAA 25663387-GCTAT-ACAAA P1_Y2 ***
27583000-CTTTTT-C 25436853-CTTTTT-C P1_Y2 22×T***
27039067-TA-T 24892920-TA-T P1_r4 ***
27049850-ATT-A 24903703-ATT-A P1_r4 17×T***
27129771-CA-C 24983624-CA-C P1_g3 25×A***
27149714-TAA-T 25003567-TAA-T P1_g3 16×A***
27151159-ATT-A 25005012-ATT-A P1_g3 9×T***
27151328-TGTA-T 25005181-TGTA-T P1_g3 ***
27290770-C-CT 25144623-C-CT P1_g3 11×T***
27319772-CT-C 25173625-CT-C P1_g3 8×T***
27398534-G-AA 25252387-G-AA P1_g3 ***
27585914-AGTC-TT 25439767-AGTC-TT P1_Y2 ***
27030714-CTT-C 24884567-CTT-C P1_r4 13×T***
27618169-C-CT 25472022-C-CT P1_Y2 14×T***
27644243-CA-C 25498096-CA-C P1_Y2 10×A***
27711690-C-CT 25565543-C-CT P1_Y2 17×T***
27733713-CAA-C 25587566-CAA-C P1_Y2 26×A***
27745674-TA-T 25599527-TA-T P1_Y2 12×A***
27772643-TA-T 25626496-TA-T P1_Y2 21×A***
27774223-CT-C 25628076-CT-C P1_Y2 ***
27777759-G-GA 25631612-G-GA P1_Y2 19×A***
27801225-G-GA 25655078-G-GA P1_Y2 13×A***
27809490-CAGAC-TAGAT 25663343-CAGAC-TAGAT P1_Y2 ***
27035479-CCT-TC 24889332-CCT-TC P1_r4 ***
27008910-TA-T 24862763-TA-T P1_r4 ***
25439195-C-CA 23293048-C-CA P2_r2 22×A***
25733034-GT-G 23586887-GT-G P1_b3 17×T***
25447251-TGTA-T 23301104-TGTA-T P2_r2 ***
25452458-G-GTT 23306311-G-GTT P2_r2 13×T***
25456551-GATATAT-G 23310404-GATATAT-G P2_r2 20×AT***
25520340-CTT-C 23374193-CTT-C P1_gr1 16×T***
25536618-TA-T 23390471-TA-T P1_gr1 13×A***
25565654-G-GT 23419507-G-GT P1_gr1 20×T***
25592446-AT-A 23446299-AT-A P1_gr1 14×T***
25677117-CTG-C 23530970-CTG-C P1_b3 ***
25717179-C-CA 23571032-C-CA P1_b3 15×A***
25717443-GAAAG-AAAAA 23571296-GAAAG-AAAAA P1_b3 ***
25858419-G-AA 23712272-G-AA P1_Y1 ***
27004222-CT-C 24858075-CT-C P1_r4 25×T***
25940445-CT-C 23794298-CT-C P1_Y1 17×T***
25964919-G-TT 23818772-G-TT P1_Y1 ***
26089081-AG-A 23942934-AG-A P1_Y1 ***
26098021-AAAG-A 23951874-AAAG-A P1_Y1 ***
26124489-GAAAGAAGAAAT-AAAAAAAAAAAA 23978342-GAAAGAAGAAAT-AAAAAAAAAAAA P1_Y1 ***
26170521-GGAAGAG-AGAA 24024374-GGAAGAG-AGAA P1_Y1 ***
26514950-TAC-T 24368803-TAC-T P1_Y1 10×AC***
26563185-TACAC-T 24417038-TACAC-T P1_g2 15×AC***
26914079-AC-T 24767932-AC-T P1_r3 ***
26997289-CT-C 24851142-CT-C P1_r4 23×T***
58991655-C-A 56845508-C-A ***
58988285-G-A 56842138-G-A ***
25246349-C-T 23100202-C-T P2_r1 ***
26902370-T-A 24756223-T-A P1_r3 ***
26810565-A-T 24664418-A-T P1_g2 ***
26810567-G-T 24664420-G-T P1_g2 ***
26828436-G-A 24682289-G-A P1_g2 ***
26834496-A-G 24688349-A-G P1_g2 ***
26835608-T-G 24689461-T-G P1_g2 ***
26874673-C-G 24728526-C-G P1_r3 ***
26902185-T-A 24756038-T-A P1_r3 ***
26902367-C-A 24756220-C-A P1_r3 ***
26902369-G-A 24756222-G-A P1_r3 ***
26902373-T-A 24756226-T-A P1_r3 ***
26730200-G-A 24584053-G-A P1_g2 ***
26902377-C-A 24756230-C-A P1_r3 ***
26902379-G-A 24756232-G-A P1_r3 ***
26902380-C-A 24756233-C-A P1_r3 ***
26902383-C-A 24756236-C-A P1_r3 ***
26902384-C-A 24756237-C-A P1_r3 ***
26902385-C-A 24756238-C-A P1_r3 ***
26902387-T-A 24756240-T-A P1_r3 ***
26907505-A-G 24761358-A-G P1_r3 ***
26955513-T-G 24809366-T-G P1_r3 ***
26955530-A-G 24809383-A-G P1_r3 ***
26810558-T-A 24664411-T-A P1_g2 ***
26730199-A-G 24584052-A-G P1_g2 ***
26986415-G-T 24840268-G-T P1_r4 ***
26344120-C-T 24197973-C-T P1_Y1 ***
26243442-A-G 24097295-A-G P1_Y1 ***
26243445-A-G 24097298-A-G P1_Y1 ***
26243447-A-C 24097300-A-C P1_Y1 ***
26284971-G-A 24138824-G-A P1_Y1 ***
26319788-C-A 24173641-C-A P1_Y1 ***
26320398-G-T 24174251-G-T P1_Y1 ***
26320406-C-T 24174259-C-T P1_Y1 ***
26340884-A-C 24194737-A-C P1_Y1 ***
26344119-G-T 24197972-G-T P1_Y1 ***
26344125-A-T 24197978-A-T P1_Y1 ***
26592994-G-T 24446847-G-T P1_g2 ***
26344389-G-T 24198242-G-T P1_Y1 ***
26465088-T-A 24318941-T-A P1_Y1 ***
26465104-T-A 24318957-T-A P1_Y1 ***
26465105-C-A 24318958-C-A P1_Y1 ***
26465109-G-A 24318962-G-A P1_Y1 ***
26465151-T-A 24319004-T-A P1_Y1 ***
26505309-A-G 24359162-A-G P1_Y1 ***
26505315-A-G 24359168-A-G P1_Y1 ***
26505323-A-G 24359176-A-G P1_Y1 ***
26546621-G-T 24400474-G-T P1_g2 ***
26955557-T-G 24809410-T-G P1_r3 ***
26986419-C-G 24840272-C-G P1_r4 ***
26243439-A-T 24097292-A-T P1_Y1 ***
27607527-C-G 25461380-C-G P1_Y2 ***
27368971-T-A 25222824-T-A P1_g3 ***
27370655-T-A 25224508-T-A P1_g3 8×A***
27397086-A-C 25250939-A-C P1_g3 ***
27420607-A-G 25274460-A-G P1_g3 ***
27424368-C-A 25278221-C-A P1_g3 ***
27466779-C-T 25320632-C-T P1_Y2 ***
27546167-G-T 25400020-G-T P1_Y2 ***
27550393-C-A 25404246-C-A P1_Y2 ***
27584263-G-T 25438116-G-T P1_Y2 ***
27607548-G-A 25461401-G-A P1_Y2 ***
27266648-G-T 25120501-G-T P1_g3 ***
27714820-G-A 25568673-G-A P1_Y2 ***
27763278-A-G 25617131-A-G P1_Y2 ***
27769124-G-T 25622977-G-T P1_Y2 ***
27776088-T-A 25629941-T-A P1_Y2 ***
27780504-T-A 25634357-T-A P1_Y2 ***
27793132-G-C 25646985-G-C P1_Y2 ***
27793138-C-G 25646991-C-G P1_Y2 ***
27844434-A-C 25698287-A-C P1_Y2 ***
27864418-G-C 25718271-G-C P1_Y2 ***
27874304-C-T 25728157-C-T P1_Y2 ***
27329997-G-T 25183850-G-T P1_g3 ***
27256273-G-T 25110126-G-T P1_g3 ***
26986440-C-T 24840293-C-T P1_r4 24×T***
27001696-C-T 24855549-C-T P1_r4 ***
26986467-G-A 24840320-G-A P1_r4 ***
26986479-G-T 24840332-G-T P1_r4 ***
26986488-G-T 24840341-G-T P1_r4 ***
26997355-A-T 24851208-A-T P1_r4 ***
26997357-G-A 24851210-G-A P1_r4 ***
26997361-A-T 24851214-A-T P1_r4 ***
26997364-G-A 24851217-G-A P1_r4 ***
26997371-A-C 24851224-A-C P1_r4 ***
27001661-C-T 24855514-C-T P1_r4 ***
27001666-C-T 24855519-C-T P1_r4 ***
27082147-A-C 24936000-A-C P1_r4 ***
27231456-T-A 25085309-T-A P1_g3 ***
27082152-A-C 24936005-A-C P1_r4 ***
27128542-G-T 24982395-G-T P1_g3 ***
27129704-A-G 24983557-A-G P1_g3 ***
27129847-T-A 24983700-T-A P1_g3 ***
27150703-A-T 25004556-A-T P1_g3 ***
27150714-C-T 25004567-C-T P1_g3 ***
27151348-T-G 25005201-T-G P1_g3 ***
27198931-G-T 25052784-G-T P1_g3 ***
27205748-G-T 25059601-G-T P1_g3 ***
27229530-C-A 25083383-C-A P1_g3 ***
26243440-A-G 24097293-A-G P1_Y1 ***
26243437-G-A 24097290-G-A P1_Y1 ***
27902262-A-C 25756115-A-C P1_Y2 ***
25671990-A-T 23525843-A-T P1_b3 ***
25493278-G-T 23347131-G-T P2_r2 ***
25500457-A-G 23354310-A-G P2_r2 ***
25500539-C-A 23354392-C-A P2_r2 ***
25602256-G-A 23456109-G-A P1_gr1 ***
25603751-A-C 23457604-A-C P1_gr1 ***
25650607-G-T 23504460-G-T P1_b3 ***
25650615-T-A 23504468-T-A P1_b3 ***
25650623-A-G 23504476-A-G P1_b3 ***
25650700-A-C 23504553-A-C P1_b3 ***
25674441-G-T 23528294-G-T P1_b3 ***
25464730-A-T 23318583-A-T P2_r2 ***
25677412-A-T 23531265-A-T P1_b3 ***
25677461-T-G 23531314-T-G P1_b3 ***
25690063-G-T 23543916-G-T P1_b3 ***
25709598-A-T 23563451-A-T P1_b3 ***
25709599-C-T 23563452-C-T P1_b3 ***
25709602-G-T 23563455-G-T P1_b3 ***
25709616-G-T 23563469-G-T P1_b3 ***
25709622-A-T 23563475-A-T P1_b3 ***
25717365-G-T 23571218-G-T P1_b3 ***
25717384-C-A 23571237-C-A P1_b3 ***
25481007-G-C 23334860-G-C P2_r2 ***
25464619-T-A 23318472-T-A P2_r2 ***
25757741-G-T 23611594-G-T P1_b3 ***
25366474-C-G 23220327-C-G P2_r2 ***
25246351-C-T 23100204-C-T P2_r1 ***
25246361-C-T 23100214-C-T P2_r1 ***
25246362-C-T 23100215-C-T P2_r1 ***
25246364-T-C 23100217-T-C P2_r1 ***
25246444-C-T 23100297-C-T P2_r1 ***
25268509-G-A 23122362-G-A P2_r1 ***
25306825-C-T 23160678-C-T P2_r1 ***
25310160-G-A 23164013-G-A P2_r1 ***
25361352-C-A 23215205-C-A P2_r2 ***
25366296-C-A 23220149-C-A P2_r2 ***
25366477-C-G 23220330-C-G P2_r2 ***
25447412-T-G 23301265-T-G P2_r2 ***
25366479-T-C 23220332-T-C P2_r2 ***
13460538-G-A 11304862-G-A ***
25366490-C-G 23220343-C-G P2_r2 ***
25366813-A-G 23220666-A-G P2_r2 ***
25372016-G-T 23225869-G-T P2_r2 ***
25375096-G-C 23228949-G-C P2_r2 ***
25431769-G-T 23285622-G-T P2_r2 ***
25432540-G-A 23286393-G-A P2_r2 ***
25434096-A-T 23287949-A-T P2_r2 ***
25440128-G-A 23293981-G-A P2_r2 ***
25717459-G-A 23571312-G-A P1_b3 ***
25804968-T-C 23658821-T-C P1_b3 ***
26243435-A-G 24097288-A-G P1_Y1 ***
26152256-A-T 24006109-A-T P1_Y1 ***
26098047-C-A 23951900-C-A P1_Y1 ***
26098060-C-A 23951913-C-A P1_Y1 ***
26124507-G-A 23978360-G-A P1_Y1 ***
26124509-C-A 23978362-C-A P1_Y1 ***
26124511-G-A 23978364-G-A P1_Y1 ***
26124515-G-A 23978368-G-A P1_Y1 ***
26152251-T-C 24006104-T-C P1_Y1 ***
26152254-A-T 24006107-A-T P1_Y1 ***
26152255-G-T 24006108-G-T P1_Y1 ***
26225692-T-C 24079545-T-C P1_Y1 ***
26098038-G-A 23951891-G-A P1_Y1 ***
26243420-A-G 24097273-A-G P1_Y1 ***
26243422-C-G 24097275-C-G P1_Y1 ***
26243424-A-G 24097277-A-G P1_Y1 ***
26243425-A-T 24097278-A-T P1_Y1 ***
26243426-C-A 24097279-C-A P1_Y1 ***
26243427-A-T 24097280-A-T P1_Y1 ***
26243428-A-G 24097281-A-G P1_Y1 ***
26243430-C-G 24097283-C-G P1_Y1 ***
26243432-A-G 24097285-A-G P1_Y1 ***
26243433-G-T 24097286-G-T P1_Y1 ***
26098044-C-A 23951897-C-A P1_Y1 ***
26089890-G-T 23943743-G-T P1_Y1 ***
25845007-C-A 23698860-C-A P1_b3 ***
25954969-C-G 23808822-C-G P1_Y1 ***
25845166-T-A 23699019-T-A P1_b3 ***
25883843-A-C 23737696-A-C P1_Y1 ***
25899578-T-G 23753431-T-G P1_Y1 ***
25954889-T-G 23808742-T-G P1_Y1 ***
25954922-A-G 23808775-A-G P1_Y1 ***
25954924-T-C 23808777-T-C P1_Y1 ***
25954931-G-A 23808784-G-A P1_Y1 ***
25954947-A-T 23808800-A-T P1_Y1 ***
25954954-A-C 23808807-A-C P1_Y1 ***
25954965-C-T 23808818-C-T P1_Y1 ***
25954974-A-T 23808827-A-T P1_Y1 ***
25955052-A-G 23808905-A-G P1_Y1 ***
25954985-A-C 23808838-A-C P1_Y1 ***
25954989-C-T 23808842-C-T P1_Y1 ***
25954990-A-G 23808843-A-G P1_Y1 ***
25954995-A-C 23808848-A-C P1_Y1 ***
25955006-T-C 23808859-T-C P1_Y1 ***
25955031-A-G 23808884-A-G P1_Y1 ***
25955032-A-G 23808885-A-G P1_Y1 ***
25955037-C-T 23808890-C-T P1_Y1 ***
25955045-G-A 23808898-G-A P1_Y1 ***
25955050-G-A 23808903-G-A P1_Y1 ***
27893789-T-A 25747642-T-A P1_Y2 ***
27902385-A-T 25756238-A-T P1_Y2 ***
58986606-C-A 56840459-C-A ***
28814654-G-A 26668507-G-A ***
28802703-G-T 26656556-G-T ***
28802706-G-A 26656559-G-A ***
28802713-G-C 26656566-G-C ***
28802716-G-A 26656569-G-A ***
28802721-G-A 26656574-G-A ***
28802723-G-C 26656576-G-C ***
28802733-G-C 26656586-G-C ***
28802734-G-A 26656587-G-A ***
28806574-G-C 26660427-G-C ***
58819703-C-G 56771168-G-C ***
28802698-G-A 26656551-G-A ***
58819708-C-G 56771163-G-C ***
58820515-G-C 56770356-C-G ***
58823808-C-T 56767063-G-A ***
58823823-T-A 56767048-A-T ***
58824578-A-T 56766293-T-A ***
58825007-C-T 56765864-G-A ***
58827389-T-G 56763482-A-C ***
58830564-G-C 56760307-C-G ***
58830565-A-T 56760306-T-A ***
58835191-C-G 56755680-G-C ***
28802701-T-A 26656554-T-A ***
28802696-G-A 26656549-G-A ***
58838660-C-G 56752211-G-C ***
28802683-A-T 26656536-A-T ***
28802666-G-A 26656519-G-A ***
28802668-G-T 26656521-G-T ***
28802670-T-A 26656523-T-A ***
28802673-G-T 26656526-G-T ***
28802674-G-C 26656527-G-C ***
28802676-T-A 26656529-T-A ***
28802677-T-A 26656530-T-A ***
28802678-G-T 26656531-G-T ***
28802679-G-C 26656532-G-C ***
28802682-T-A 26656535-T-A ***
28802686-C-A 26656539-C-A ***
28802694-T-A 26656547-T-A ***
28802686-C-G 26656539-C-G ***
28802687-T-A 26656540-T-A ***
28802688-G-A 26656541-G-A ***
28802688-G-T 26656541-G-T ***
28802689-C-G 26656542-C-G ***
28802690-A-G 26656543-A-G ***
28802691-T-A 26656544-T-A ***
28802691-T-G 26656544-T-G ***
28802692-T-A 26656545-T-A ***
28802693-G-A 26656546-G-A ***
58835705-C-T 56755166-G-A ***
58838730-C-T 56752141-G-A ***
28802586-G-T 26656439-G-T ***
58886785-A-T 56704086-T-A ***
58874945-G-C 56715926-C-G ***
58875148-C-T 56715723-G-A ***
58883595-T-A 56707276-A-T ***
58884284-G-A 56706587-C-T ***
58884325-T-G 56706546-A-C ***
58884850-A-C 56706021-T-G ***
58885058-A-T 56705813-T-A ***
58885070-G-C 56705801-C-G ***
58885073-G-C 56705798-C-G ***
58886897-G-T 56703974-C-A ***
58873113-G-T 56717758-C-A ***
58886899-C-T 56703972-G-A ***
58912410-T-C 56678461-A-G ***
58912944-T-A 56677927-A-T ***
58912983-C-G 56677888-G-C ***
58914128-G-C 56676743-C-G ***
58914129-C-A 56676742-G-T ***
58914492-A-C 56676379-T-G ***
58984994-T-C 56838847-T-C ***
58984997-C-T 56838850-C-T ***
58985828-G-T 56839681-G-T ***
58873114-C-T 56717757-G-A ***
58866285-T-C 56724586-A-G ***
58838753-T-A 56752118-A-T ***
58842938-T-A 56747933-A-T ***
58838756-A-G 56752115-T-C ***
58838757-T-A 56752114-A-T ***
58840761-C-G 56750110-G-C ***
58840766-A-G 56750105-T-C ***
58841719-T-C 56749152-A-G ***
58842867-G-T 56748004-C-A ***
58842879-C-G 56747992-G-C ***
58842931-T-A 56747940-A-T ***
58842935-G-T 56747936-C-A ***
58842936-T-A 56747935-A-T ***
58842939-C-A 56747932-G-T ***
58865957-T-C 56724914-A-G ***
58842940-G-C 56747931-C-G ***
58846029-C-T 56744842-G-A ***
58857040-C-T 56733831-G-A ***
58857041-A-C 56733830-T-G ***
58857060-T-A 56733811-A-T ***
58857062-G-C 56733809-C-G ***
58857072-C-T 56733799-G-A ***
58857123-A-G 56733748-T-C ***
58865915-G-T 56724956-C-A ***
58865916-A-T 56724955-T-A ***
28802606-C-G 26656459-C-G ***
28802581-A-G 26656434-A-G ***
27902499-C-T 25756352-C-T P1_Y2 ***
28117363-C-T 25971216-C-T P1_b4 ***
28117344-C-T 25971197-C-T P1_b4 ***
28117350-C-T 25971203-C-T P1_b4 ***
28117351-C-T 25971204-C-T P1_b4 ***
28117352-G-T 25971205-G-T P1_b4 ***
28117355-C-T 25971208-C-T P1_b4 ***
28117357-G-T 25971210-G-T P1_b4 ***
28117358-C-T 25971211-C-T P1_b4 ***
28117360-C-T 25971213-C-T P1_b4 ***
28117362-G-T 25971215-G-T P1_b4 ***
28117365-C-T 25971218-C-T P1_b4 ***
28117340-C-T 25971193-C-T P1_b4 ***
28136374-T-A 25990227-T-A P1_b4 ***
28149467-T-A 26003320-T-A P1_b4 ***
28157385-C-A 26011238-C-A P1_b4 ***
28157390-A-G 26011243-A-G P1_b4 ***
28157402-A-G 26011255-A-G P1_b4 ***
28160781-G-T 26014634-G-T P1_b4 ***
28160784-C-T 26014637-C-T P1_b4 ***
28206475-C-T 26060328-C-T P1_b4 ***
28214125-G-C 26067978-G-C P1_b4 ***
28245687-C-G 26099540-C-G P1_b4 ***
28117342-A-T 25971195-A-T P1_b4 ***
28117338-C-T 25971191-C-T P1_b4 ***
28253618-G-A 26107471-G-A P1_b4 ***
28065178-A-C 25919031-A-C P1_Y2 ***
27902504-A-T 25756357-A-T P1_Y2 ***
27947602-C-A 25801455-C-A P1_Y2 ***
27971792-C-A 25825645-C-A P1_Y2 ***
28009094-C-T 25862947-C-T P1_Y2 ***
28017380-C-A 25871233-C-A P1_Y2 ***
28017440-G-T 25871293-G-T P1_Y2 ***
28024588-C-A 25878441-C-A P1_Y2 ***
28060368-T-C 25914221-T-C P1_Y2 ***
28062762-G-T 25916615-G-T P1_Y2 ***
28062767-A-C 25916620-A-C P1_Y2 ***
28065180-T-C 25919033-T-C P1_Y2 ***
28117336-G-T 25971189-G-T P1_b4 ***
28065184-A-T 25919037-A-T P1_Y2 ***
28086188-C-A 25940041-C-A P1_Y2 ***
28086193-G-A 25940046-G-A P1_Y2 ***
28086203-T-A 25940056-T-A P1_Y2 ***
28117322-G-T 25971175-G-T P1_b4 ***
28117323-A-T 25971176-A-T P1_b4 ***
28117324-A-T 25971177-A-T P1_b4 ***
28117325-G-T 25971178-G-T P1_b4 ***
28117326-G-T 25971179-G-T P1_b4 ***
28117334-G-T 25971187-G-T P1_b4 ***
28253600-T-A 26107453-T-A P1_b4 ***
28507551-C-A 26361404-C-A ***
28802578-T-G 26656431-T-G ***
28797846-C-T 26651699-C-T ***
28797822-A-T 26651675-A-T ***
28797824-A-G 26651677-A-G ***
28797825-G-A 26651678-G-A ***
28797826-T-A 26651679-T-A ***
28797834-G-A 26651687-G-A ***
28797835-G-A 26651688-G-A ***
28797837-G-C 26651690-G-C ***
28797838-G-A 26651691-G-A ***
28797840-T-A 26651693-T-A ***
28797848-C-G 26651701-C-G ***
28797820-T-A 26651673-T-A ***
28797849-T-A 26651702-T-A ***
28797851-T-C 26651704-T-C ***
28797852-G-C 26651705-G-C ***
28797855-G-A 26651708-G-A ***
28802565-G-A 26656418-G-A ***
28802569-T-C 26656422-T-C ***
28802571-A-G 26656424-A-G ***
28802573-T-G 26656426-T-G ***
28802575-A-T 26656428-A-T ***
28802576-A-T 26656429-A-T ***
28797821-T-A 26651674-T-A ***
28797819-T-G 26651672-T-G ***
28529465-C-A 26383318-C-A ***
28794295-T-A 26648148-T-A ***
28550108-G-T 26403961-G-T ***
28614952-C-A 26468805-C-A ***
28771834-G-A 26625687-G-A ***
28773841-C-A 26627694-C-A ***
28777762-C-A 26631615-C-A ***
28793645-G-A 26647498-G-A ***
28793712-A-G 26647565-A-G ***
28794290-G-A 26648143-G-A ***
28794292-G-A 26648145-G-A ***
28794293-G-C 26648146-G-C ***
28794301-T-A 26648154-T-A ***
28797818-T-A 26651671-T-A ***
28794302-G-C 26648155-G-C ***
28794333-G-A 26648186-G-A ***
28794335-C-A 26648188-C-A ***
28797498-G-A 26651351-G-A ***
28797811-T-A 26651664-T-A ***
28797812-G-T 26651665-G-T ***
28797813-G-C 26651666-G-C ***
28797814-A-T 26651667-A-T ***
28797816-T-A 26651669-T-A ***
28797817-G-T 26651670-G-T ***
13460539-A-G 11304863-A-G ***
13326153-C-T 11170477-C-T 12×T***
13460535-C-A 11304859-C-A ***
13859792-T-A,C 11739086-T-A,C ***
13859375-G-T 11738669-G-T ***
13859383-T-C 11738677-T-C ***
13859399-G-A 11738693-G-A ***
13859413-T-C 11738707-T-C ***
13859414-G-T 11738708-G-T ***
13859460-G-A 11738754-G-A ***
13859464-A-C,G 11738758-A-C,G ***
13859480-G-A 11738774-G-A Z7402 ***
13859503-T-A 11738797-T-A ***
13863499-T-G 11742793-T-G ***
13859358-T-C 11738652-T-C ***
13863583-C-T 11742877-C-T ***
13864879-A-T 11744173-A-T ***
13864936-A-G 11744230-A-G ***
13869980-C-A 11749274-C-A ***
13869995-G-C 11749289-G-C ***
13870154-T-A 11749448-T-A ***
13870159-T-A 11749453-T-A ***
13870160-A-C 11749454-A-C ***
13870163-A-G 11749457-A-G ***
13870168-C-A 11749462-C-A ***
13859359-G-C 11738653-G-C ***
13859295-A-G 11738589-A-G ***
13870178-A-G 11749472-A-G ***
13848278-T-A 11727572-T-A ***
13832640-A-G 11711934-A-G ***
13838316-C-A 11717610-C-A ***
13838685-A-T 11717979-A-T ***
13839756-TAATGG-G,T 11719050-TAATGG-G,T 11×AATGG***
13841234-T-A 11720528-T-A ***
13841495-T-C 11720789-T-C ***
13842084-G-A 11721378-G-A ***
13843850-A-G 11723144-A-G ***
13847184-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAATGGAGTGGACTCA 11726478-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAATGGAGTGGACTCA ***
13850475-A-G 11729769-A-G ***
13855986-C-A 11735280-C-A ***
13852747-A-G 11732041-A-G ***
13852753-A-G 11732047-A-G ***
13854606-T-A 11733900-T-A ***
13854608-C-G 11733902-C-G ***
13854621-C-T 11733915-C-T ***
13854622-A-G 11733916-A-G ***
13854650-G-A 11733944-G-A ***
13854675-A-G 11733969-A-G ***
13855239-T-A 11734533-T-A ***
13855938-A-T 11735232-A-T ***
13870170-C-G 11749464-C-G ***
13870183-T-A 11749477-T-A ***
13815566-T-C 11694860-T-C ***
28801009-T-G 26654862-T-G ***
28791773-G-GTGCAGTGGAT 26645626-G-GTGCAGTGGAT ***
28796694-T-G 26650547-T-G ***
28798897-G-C 26652750-G-C ***
28798917-G-A 26652770-G-A ***
28799136-T-A 26652989-T-A ***
28799244-C-G 26653097-C-G ***
28800106-GGAGTC-G 26653959-GGAGTC-G ***
28800307-G-A 26654160-G-A ***
28800322-G-A 26654175-G-A FGC30407 ***
28805575-A-G 26659428-A-G ***
28788090-T-G 26641943-T-G ***
28810131-G-T 26663984-G-T ***
28810144-C-A 26663997-C-A ***
28811222-T-G 26665075-T-G ***
58829921-T-G 56760950-A-C ***
58974218-T-G 56828071-T-G ***
58976262-T-C 56830115-T-C ***
58977221-A-T 56831074-A-T ***
58979741-A-ATTCTG,G 56833594-A-ATTCTG,G ***
58980008-A-T 56833861-A-T ***
58981639-C-A 56835492-C-A ***
28791635-A-G 26645488-A-G Z27086 ***
28787531-T-A 26641384-T-A ***
22219966-C-T 20058080-C-T FGC4596 DYZ19 ***
23347909-CT-C 21186023-CT-C 10×T***
22220033-T-C 20058147-T-C DYZ19 ***
22267228-A-C 20105342-A-C DYZ19 ******
22267233-C-G 20105347-C-G DYZ19 ******
22269595-T-A 20107709-T-A DYZ19 ***
22269597-C-T 20107711-C-T DYZ19 ***
22336298-C-T 20174412-C-T A4144 DYZ19 ***
22344960-T-G 20183074-T-G DYZ19 ***
22421036-C-T 20259150-C-T DYZ19 ***
22430289-A-T 20268403-A-T DYZ19 ***
22493048-T-C 20331162-T-C DYZ19 ***
25064987-A-G 22918840-A-G g1 ***
28787529-A-G 26641382-A-G ***
28785581-G-A 26639434-G-A ***
28785686-TTATTG-G,T 26639539-TTATTG-G,T ***
28785707-G-T 26639560-G-T ***
28785880-T-C 26639733-T-C ***
28785885-T-G 26639738-T-G ***
28785927-G-A 26639780-G-A ***
28786586-A-G 26640439-A-G ***
28786597-TGGGAA-T 26640450-TGGGAA-T ***
28787331-G-A 26641184-G-A ***
28787341-G-A 26641194-G-A ***
13817678-C-G 11696972-C-G ***
13812988-C-A 11692282-C-A ***
58981956-C-T 56835809-C-T ***
13194020-C-T 11038344-C-T ***
9215565-C-G 9377956-C-G ***
9941268-T-TCCAG,TCTAA 10103659-T-TCCAG,TCTAA ***
9979644-AATG-A 10142035-AATG-A ***
9992944-T-A 10155335-T-A ***
9992953-T-C 10155344-T-C ***
13139504-T-C 10628990-T-C F10591 ***
13140333-A-T 10629819-A-T ***
13142282-T-C 10631768-T-C ***
13143306-T-A 10632792-T-A ***
13194025-C-T 11038349-C-T ***
9215557-A-G 9377948-A-G ***
13194736-T-A 11039060-T-A ***
13194740-T-C 11039064-T-C ***
13194744-T-C 11039068-T-C ***
13194765-T-C 11039089-T-C ***
13194802-G-C 11039126-G-C ***
13196155-T-A 11040479-T-A ***
13268904-T-C 11113228-T-C ***
13447696-T-C 11292020-T-C ***
13448841-T-C 11293165-T-C ***
13449987-T-G 11294311-T-G ***
9215562-A-G 9377953-A-G ***
8702810-GTTT-G 8834769-GTTT-G 21×T***
13454363-C-A 11298687-C-A ***
13194017-T-C 11038341-T-C ***
26325206-ATG-A 24179059-ATG-A P1_Y1 14×TG******
13845483-T-A 11724777-T-A ***
13830100-A-G 11709394-A-G ***
58820546-C-A 56770325-G-T ***
9344791-G-A 9507182-G-A ***
13869209-G-C 11748503-G-C ***
13203966-A-G 11048290-A-G ***
25841842-T-G 23695695-T-G P1_b3 ***
9191076-AAC-A 9353467-AAC-A 20×AC***
13449999-T-A 11294323-T-A ***
6250254-C-CT 6382213-C-CT IR3_Dst 11×T***
13459278-T-C 11303602-T-C ***
13691246-TTGGAATGGAA-T 11535570-TTGGAATGGAA-T ***
13817625-A-G 11696919-A-G ***
13818280-C-A 11697574-C-A ***
13868153-C-A 11747447-C-A ***
28798896-G-A 26652749-G-A ***
28798927-G-A 26652780-G-A ***
28798937-G-A 26652790-G-A ***
28799852-G-A 26653705-G-A ***
58912477-G-C 56678394-C-G 4×CATTC***
13449990-C-T 11294314-C-T ***
13456566-T-C 11300890-T-C ***
13810778-C-G 11690072-C-G ***
13734980-A-T 11579304-A-T ***
13691129-C-A 11535453-C-A ***
13704227-A-T 11548551-A-T ***
13706407-T-C 11550731-T-C ***
13711384-T-G 11555708-T-G ***
13713139-GACTGGAATCA-G 11557463-GACTGGAATCA-G ***
13713155-AATGGC-A 11557479-AATGGC-A ***
13716537-A-G 11560861-A-G ***
13720502-T-A 11564826-T-A ******
13720724-T-G 11565048-T-G ***
13736432-C-T 11580756-C-T ***
13680945-CGAATG-T,TGAAAT 11525269-CGAATG-T,TGAAAT ***
13737678-A-G 11582002-A-G ***
13737692-C-A 11582016-C-A ***
13801549-G-A 11680843-G-A ***
13801720-G-A 11681014-G-A ***
13803170-C-A 11682464-C-A ***
13804153-A-C 11683447-A-C ***
13805245-G-T 11684539-G-T ***
13805291-T-G 11684585-T-G ***
13805486-C-G 11684780-C-G ***
13810108-C-G 11689402-C-G ***
13681108-C-A,G 11525432-C-A,G ***
13680916-A-T 11525240-A-T ***
13459243-T-C 11303567-T-C ***
13482911-A-C 11327235-A-C ***
13459645-C-A 11303969-C-A ***
13459677-T-C 11304001-T-C ***
13459685-C-G 11304009-C-G ***
13461324-A-AT 11305648-A-AT ***
13461328-G-T 11305652-G-T ***
13464336-C-T 11308660-C-T ***
13465561-T-C 11309885-T-C ***
13466012-C-A 11310336-C-A ***
13475919-A-G 11320243-A-G ***
13481626-T-C 11325950-T-C ***
13488130-C-T 11332454-C-T ***
13680906-G-A 11525230-G-A ***
13488708-G-A 11333032-G-A ***
13650661-T-A 11494985-T-A ***
13658897-G-T 11503221-G-T ***
13664314-T-G 11508638-T-G ***
13664767-T-A 11509091-T-A ***
13680670-A-G 11524994-A-G ***
13680890-G-A 11525214-G-A ***
13680892-C-A,T 11525216-C-A,T ***
13680898-A-G 11525222-A-G ***
13680899-T-A 11525223-T-A ***
58981921-T-A 56835774-T-A ***
58981961-C-A 56835814-C-A ***
28811311-C-T 26665164-C-T ***
58862488-GCATTC-G 56728358-CAATGG-C 4×CATTC***
25766541-C-CA 23620394-C-CA P1_b3 16×A***
26117889-TAAC-AAAA 23971742-TAAC-AAAA P1_Y1 ***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
27214310-CT-C 25068163-CT-C P1_g3 10×T***
27550462-CT-C 25404315-CT-C P1_Y2 13×T***
28008036-CA-C 25861889-CA-C P1_Y2 17×A***
28027982-AT-A 25881835-AT-A P1_Y2 17×T***
28360492-TA-T 26214345-TA-T P1_gr2 13×A***
58827357-CTCCATTCAATTCCTT-C 56763491-GGAATGGAAAGGAATT-G ***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
25662890-CA-C 23516743-CA-C P1_b3 15×A***
58972169-GTT-TTG 56826022-GTT-TTG ***
22337428-C-T 20175542-C-T DYZ19 ***
22360373-T-G 20198487-T-G DYZ19 ***
22360387-TC-T 20198501-TC-T DYZ19 ***
3790838-GTA-G 3922797-GTA-G 8×TA***
22361069-CA-C 20199183-CA-C DYZ19 ***
24446852-AAT-A 22300705-AAT-A 15×AT***
58820555-G-C 56770316-C-G ***
22365767-A-T 20203881-A-T DYZ19 ***
14696023-CAGAAAG-AAAAAAA 12584089-CAGAAAG-AAAAAAA ***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25426962-A-AT 23280815-A-AT P2_r2 10×T***
13449515-TCC-T 11293839-TCC-T ***
22503218-TC-T 20341332-TC-T DYZ19 ***
20255094-TA-T 18093208-TA-T P5_Dst 20×A***
20723277-CT-C 18561391-CT-C P4_Prx 15×T***
20954340-CA-C 18792454-CA-C P4_Dst 23×A***
20991160-AT-A 18829274-AT-A P4_Dst 18×T***
20993598-CA-C 18831712-CA-C P4_Dst 17×A***
21011657-G-GT 18849771-G-GT P4_Dst 11×T***
21328805-CA-C 19166919-CA-C 30×A***
22256872-ATGAAGC-TGTTATG 20094986-ATGAAGC-TGTTATG DYZ19 ***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
24035198-T-TA 21889051-T-TA 14×A***
25422190-CT-C 23276043-CT-C P2_r2 16×T***
24582352-CT-C 22436205-CT-C P3_t2 17×T***
24760000-T-TTA 22613853-T-TTA P3_b2 11×TA***
25272972-G-GA 23126825-G-GA P2_r1 19×A***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
25301411-GA-G 23155264-GA-G P2_r1 ***
25312610-AAG-A 23166463-AAG-A P2_r1 ***
25412653-CT-C 23266506-CT-C P2_r2 16×T***
25415037-C-CT 23268890-C-CT P2_r2 17×T***
25417422-CT-C 23271275-CT-C P2_r2 16×T***
13394165-A-ATT 11238489-A-ATT ***
27904476-CT-C 25758329-CT-C P1_Y2 11×T***
18499927-G-GA 16388047-G-GA P6_Dst 13×A***
13279036-GA-G 11123360-GA-G ***
59007968-A-C 56861821-A-C ***
59007972-A-C 56861825-A-C ***
59007976-A-C 56861829-A-C ***
58857035-C-T 56733836-G-A ***
58857090-T-G 56733781-A-C ***
20197205-GA-G 18035319-GA-G P5_Dst 14×A***
25709386-G-T 23563239-G-T P1_b3 31×T***
15029495-CTTTT-C 12917583-CTTTT-C 16×T***
7359768-AAT-A 7491727-AAT-A 10×AT***
28147152-GCA-G 26001005-GCA-G P1_b4 13×CA***
18012134-A-AT 15900254-A-AT P7_Dst 11×T***
18639018-A-AGTGT 16527138-A-AGTGT 26×GT***
58884239-GTTTGATGCCATCCCA-G 56706615-CATGGGATGGCATCAA-C ***
13287202-A-G 11131526-A-G ***
18511195-CA-C 16399315-CA-C P6_Dst 30×A***
13437713-C-T 11282037-C-T ***
13445160-G-T 11289484-G-T ***
13253782-A-G 11098106-A-G ***
28797856-A-T 26651709-A-T ***
13733672-C-T 11577996-C-T ***
13725417-T-A 11569741-T-A ***
59007964-A-C 56861817-A-C ***
27809543-G-A 25663396-G-A P1_Y2 ***
20622519-CA-C 18460633-CA-C P4_Prx 17×A***
9952699-G-A 10115090-G-A ***
9574853-CA-C 9737244-CA-C IR3_Prx 12×A***
7387383-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT 7519342-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT ***
22422026-TC-GT 20260140-TC-GT DYZ19 ***
23505519-C-AAA 21343633-C-AAA ***
13143656-AC-GG 10633142-AC-GG ***
9952738-T-C 10115129-T-C ***
9952737-T-G 10115128-T-G ***
27585912-G-T 25439765-G-T P1_Y2 ***
58848265-T-C 56742606-A-G ***
27546742-CT-C 25400595-CT-C P1_Y2 19×T***
22234368-TC-GA 20072482-TC-GA DYZ19 ***
27809505-C-T 25663358-C-T P1_Y2 ***
20350311-CA-C 18188425-CA-C P5_Dst 12×A***
27824063-G-GT 25677916-G-GT P1_Y2 10×T***
28797882-G-T 26651735-G-T ***
13488961-CCA-GCC 11333285-CCA-GCC ***
22354401-T-C 20192515-T-C DYZ19 ***
10015017-A-G 10177408-A-G ***
58885041-T-C 56705830-A-G ***
58883603-A-C 56707268-T-G ***
58825004-T-C 56765867-A-G ***
22245000-T-A 20083114-T-A DYZ19 ***
18984946-CTTTC-TTTTT 16873066-CTTTC-TTTTT ***
18147509-C-CT 16035629-C-CT 28×T***
58981966-C-T 56835819-C-T ***
20949930-CATT-C 18788044-CATT-C P4_Dst ***
9945157-G-C 10107548-G-C ***
20141149-CT-C 18029269-CT-C P5_Dst 12×T***
20873676-CGA-C 18711790-CGA-C P4_Dst 8×GA***
24760630-TA-T 22614483-TA-T P3_b2 15×A***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
25652602-CT-C 23506455-CT-C P1_b3 11×T***
27976945-CA-C 25830798-CA-C P1_Y2 12×A***
25207880-T-A 23061733-T-A P2_r1 ***
25207886-T-A 23061739-T-A P2_r1 ***
25207822-C-CAA 23061675-C-CAA P2_r1 51×A***
25845104-G-A 23698957-G-A P1_b3 ***
25491429-CA-C 23345282-CA-C P2_r2 19×A***
13842790-ATCAACCTGAG-A 11722084-ATCAACCTGAG-A ***
20206644-T-TA 18044758-T-TA P5_Dst 11×A***
28802531-G-A 26656384-G-A ***
13457716-G-GATTCCATTCC 11302040-G-GATTCCATTCC 12×ATTCC***
6179592-AT-A 6311551-AT-A IR3_Dst 22×T***
28797827-G-A 26651680-G-A ***
25207874-G-A 23061727-G-A P2_r1 ***
25441211-ATT-A 23295064-ATT-A P2_r2 22×T***
27809502-T-A 25663355-T-A P1_Y2 ***
58848262-C-T 56742609-G-A ***
25207883-G-A 23061736-G-A P2_r1 ***
26730213-G-A 24584066-G-A P1_g2 ***
27815070-CT-C 25668923-CT-C P1_Y2 10×T***
58981975-AT-A,AC 56835828-AT-A,AC ***
58982800-G-C 56836653-G-C ***
59004620-G-C 56858473-G-C ***
13702761-A-G 11547085-A-G ***
20230152-T-TA 18068266-T-TA P5_Dst 16×A***
58844522-T-A 56746349-A-T ***
58844528-G-T 56746343-C-A ***
58885152-C-A 56705719-G-T ***
58885176-T-C 56705695-A-G ***
28253523-AC-A 26107376-AC-A P1_b4 ***
26953179-G-A 24807032-G-A P1_r3 ***
20949951-T-TG 18788065-T-TG P4_Dst ***
27785784-TA-T 25639637-TA-T P1_Y2 10×A***
20348763-G-GT 18186877-G-GT P5_Dst 9×T***
20989908-CT-C 18828022-CT-C P4_Dst 11×T***
27739907-GA-G 25593760-GA-G P1_Y2 10×A***
27937836-G-GA 25791689-G-GA P1_Y2 17×A***
2970336-GGT-G 3102295-GGT-G 18×GT***
13203964-G-T 11048288-G-T ***
20949941-T-C 18788055-T-C P4_Dst ***
20949945-T-C 18788059-T-C P4_Dst ***
20949946-G-A 18788060-G-A P4_Dst ***
13680778-C-A,T 11525102-C-A,T 4×TGGAA***
28149455-G-A 26003308-G-A P1_b4 ***
13801053-TGGATAGAACGG-GGAATGGAGATT 11680347-TGGATAGAACGG-GGAATGGAGATT ***
27971780-G-A 25825633-G-A P1_Y2 ***
13203963-T-A 11048287-T-A ***
13275918-C-T 11120242-C-T ***
13523557-A-C 11367881-A-C ***
20886850-G-A 18724964-G-A P4_Dst ***
24895723-G-T 22749576-G-T g1 ***
25312613-T-A 23166466-T-A P2_r1 ***
26902359-G-A 24756212-G-A P1_r3 ***
27080501-A-T 24934354-A-T P1_r4 ***
27971775-G-A 25825628-G-A P1_Y2 ***
27971785-G-A 25825638-G-A P1_Y2 ***
13203959-A-G 11048283-A-G ***
28253572-G-A 26107425-G-A P1_b4 ***
28253578-C-T 26107431-C-T P1_b4 ***
58984308-CTG-TTA 56838161-CTG-TTA ***
19052438-AG-A 16940558-AG-A ***
20242479-TG-T 18080593-TG-T P5_Dst 12×G***
13842630-CC-AT 11721924-CC-AT ***
24612840-AT-A 22466693-AT-A P3_t2 16×T***
6944943-CA-C 7076902-CA-C 28×A***
13521662-AG-CA 11365986-AG-CA ***
13801031-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA 11680325-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA ***
13203960-T-A 11048284-T-A ***
13203958-C-T 11048282-C-T ***
25461433-C-T 23315286-C-T P2_r2 26×T***
13203974-C-G 11048298-C-G ***
27918646-G-GT 25772499-G-GT P1_Y2 11×T***
58984897-A-C 56838750-A-C ***
13460523-C-G 11304847-C-G ***
22236806-C-A 20074920-C-A DYZ19 ***
13456019-GATTCC-G 11300343-GATTCC-G 11×ATTCC***
23702223-G-GT 21540337-G-GT 14×T***
13203979-C-T 11048303-C-T ***
13203978-C-G 11048302-C-G ***
13203975-C-A 11048299-C-A ***
13203973-C-T 11048297-C-T ***
13203971-C-A 11048295-C-A ***
9956771-T-C 10119162-T-C ***
58984310-G-A 56838163-G-A ***
24458784-G-A 22312637-G-A ***
9956763-T-A 10119154-T-A ***
13523585-T-G 11367909-T-G ***
13523547-C-T 11367871-C-T ***
9215993-A-G 9378384-A-G ***
9304872-A-G 9467263-A-G ***
9304875-A-G 9467266-A-G ***
9311499-T-G 9473890-T-G ***
9325208-C-G 9487599-C-G ***
21002535-TTC-T 18840649-TTC-T P4_Dst 16×TC***
28808707-A-G 26662560-A-G ZS4485 GG346 ***
17580932-CT-C 15469052-CT-C 13×T***
58981055-A-T 56834908-A-T ***
28799835-T-G 26653688-T-G ***
28799840-G-T 26653693-G-T ***
28799843-G-T 26653696-G-T ***
28799851-T-A 26653704-T-A ***
28799853-G-T 26653706-G-T ***
28799890-C-G 26653743-C-G ***
28799895-C-G 26653748-C-G 5×TGGAA***
28805236-ATGGAATGGAATGGAAT-A 26659089-ATGGAATGGAATGGAAT-A ***
28811220-A-G 26665073-A-G ***
58981063-A-C 56834916-A-C ***
28799816-T-A 26653669-T-A ***
58981065-T-A 56834918-T-A ***
58981075-T-A 56834928-T-A ***
58982093-C-T 56835946-C-T ***
13819959-TGAATG-G,T 11699253-TGAATG-G,T 14×GAATG***
20645840-TTTC-T 18483954-TTTC-T P4_Prx ***
27809465-T-C 25663318-T-C P1_Y2 ***
13143780-CACTGCACTGCACATCACTCT-C 10633266-CACTGCACTGCACATCACTCT-C ******
13194842-A-T 11039166-A-T ***
13452653-C-T 11296977-C-T ***
13693927-GCTATCGAATA-G 11538251-GCTATCGAATA-G ***
28799832-G-A 26653685-G-A ***
28799810-GTGGCA-G 26653663-GTGGCA-G ***
13870125-A-G 11749419-A-G ***
13859479-C-G 11738773-C-G ***
13847328-A-G 11726622-A-G ***
13850305-T-A 11729599-T-A ***
13850326-G-C 11729620-G-C ***
13850366-G-A 11729660-G-A ***
13851460-T-A 11730754-T-A ***
13851476-A-G 11730770-A-G ***
13851486-T-G 11730780-T-G ***
13859324-A-G 11738618-A-G ***
13859467-A-G 11738761-A-G ***
13859483-A-T 11738777-A-T ***
28793368-A-G 26647221-A-G ***
22243099-T-A 20081213-T-A DYZ19 ***
28785521-A-G 26639374-A-G ***
28785524-A-C 26639377-A-C ***
28785536-G-T 26639389-G-T ***
28785541-A-G 26639394-A-G ***
28785543-A-C 26639396-A-C ***
28785586-G-T 26639439-G-T ***
28785627-A-G,T 26639480-A-G,T ***
28787264-GAATGGAATTC-G 26641117-GAATGGAATTC-G ***
28788080-G-A 26641933-G-A ***
13850411-C-G 11729705-C-G ***
58865997-A-C 56724874-T-G ***
13842277-A-G 11721571-A-G ***
13842115-G-A 11721409-G-A ***
58976247-C-T 56830100-C-T ***
58982108-T-C 56835961-T-C ***
13689189-A-T 11533513-A-T ***
17802197-G-A 15690317-G-A ***
23747205-CTT-C 21585319-CTT-C 29×T***
13805179-A-C 11684473-A-C ***
13838257-G-A 11717551-G-A ***
27134986-GA-G 24988839-GA-G P1_g3 11×A***
58819373-C-G 56771498-G-C ***
28800096-T-G 26653949-T-G ***
13870131-A-G 11749425-A-G ***
13459696-T-A 11304020-T-A ***
13805184-C-A 11684478-C-A ***
13857586-G-A 11736880-G-A ***
20096628-AT-A 17984748-AT-A P5_Dst 13×T***
20197604-C-CT 18035718-C-CT P5_Dst 11×T***
28043512-GA-G 25897365-GA-G P1_Y2 10×A***
58982803-T-G 56836656-T-G ***
59004617-A-G 56858470-A-G ***
13454718-T-A 11299042-T-A ***
13654364-T-G 11498688-T-G ***
13870141-C-G 11749435-C-G S15185 ***
13870055-G-C 11749349-G-C ***
58977633-T-C 56831486-T-C ***
13818672-G-C 11697966-G-C ***
58981926-T-C 56835779-T-C ***
28132475-C-CT 25986328-C-CT P1_b4 15×T***
13139628-T-C 10629114-T-C ***
13447706-T-C 11292030-T-C ***
13459383-T-C 11303707-T-C ***
13459393-T-C 11303717-T-C ***
13689194-C-T 11533518-C-T ***
13801484-A-G 11680778-A-G ***
13801702-A-C 11680996-A-C ***
13818670-A-G 11697964-A-G ***
13832413-C-G 11711707-C-G ***
13870053-T-C 11749347-T-C ***
13850409-C-A 11729703-C-A ***
13850425-A-T 11729719-A-T ***
13850431-T-G 11729725-T-G ***
13850450-A-T 11729744-A-T ***
13859442-A-G 11738736-A-G ***
13865605-T-G 11744899-T-G ***
13868869-C-T 11748163-C-T ***
13869965-G-C 11749259-G-C ***
13869999-T-A 11749293-T-A ***
13870003-C-A 11749297-C-A ***
13846297-T-A,C 11725591-T-A,C ***
13842227-A-C 11721521-A-C ***
13832520-A-G 11711814-A-G ***
13856417-C-G 11735711-C-G ***
13824094-G-A 11703388-G-A ***
13824952-A-T 11704246-A-T ***
13830135-C-G 11709429-C-G ***
13830162-G-A 11709456-G-A ***
13833826-A-G 11713120-A-G ***
13839010-C-G 11718304-C-G ***
13846284-C-G 11725578-C-G ***
13846725-A-G 11726019-A-G ***
13851475-C-T 11730769-C-T ***
13858460-T-G 11737754-T-G ***
13813203-G-A 11692497-G-A ***
13860240-G-A 11739534-G-A ***
58976237-C-T 56830090-C-T ***
58982280-T-C 56836133-T-C ***
13461115-T-C 11305439-T-C ***
13680870-G-C 11525194-G-C ***
13843864-T-G 11723158-T-G ***
13843879-C-G 11723173-C-G ***
13856409-T-A 11735703-T-A ***
13856432-C-G 11735726-C-G ***
20998300-CA-C 18836414-CA-C P4_Dst 28×A***
13823239-G-A 11702533-G-A ***
13810068-C-G 11689362-C-G ***
13869404-C-G 11748698-C-G 9×GAATG***
13448846-T-C 11293170-T-C ***
13813392-C-G 11692686-C-G ***
13813395-G-T 11692689-G-T ***
13846552-A-T 11725846-A-T ***
13865937-C-A 11745231-C-A ***
13867932-A-G 11747226-A-G ***
28787565-G-A 26641418-G-A ***
13688450-A-T 11532774-A-T ***
28793613-T-C 26647466-T-C ***
28793625-A-T 26647478-A-T ***
13664626-G-A 11508950-G-A ***
13680689-T-A 11525013-T-A ***
13843764-G-C 11723058-G-C ***
25860053-CT-C 23713906-CT-C P1_Y1 11×T***
58820795-C-CCATTCCATTCGATTG 56770048-T-TTCGAATGGAATGCAA ***
58819691-C-T 56771180-G-A ***
13142008-C-T 10631494-C-T ***
13455365-T-A 11299689-T-A ***
13459689-T-C 11304013-T-C ***
13459691-T-A 11304015-T-A ***
13459699-G-C 11304023-G-C ***
13680688-A-G 11525012-A-G ***
24015843-CTCT-C 21869696-CTCT-C 5×TCT***
13456344-C-A 11300668-C-A ***
13838244-A-G 11717538-A-G ***
13729952-GTGGAATCAAGTGGAA-G 11574276-GTGGAATCAAGTGGAA-G ***
13680673-A-G 11524997-A-G ***
13680679-T-G 11525003-T-G ***
13680694-A-T 11525018-A-T ***
13680695-G-C 11525019-G-C ***
13680696-G-A 11525020-G-A ***
13680701-A-G 11525025-A-G ***
13680705-A-G 11525029-A-G ***
13680889-T-C 11525213-T-C ***
13680904-T-C 11525228-T-C ***
13803092-C-G 11682386-C-G 5×GAATG***
13677944-A-G 11522268-A-G ***
13803117-GGAATT-G,GCAATT 11682411-GGAATT-G,GCAATT ***
13805217-A-G 11684511-A-G ***
13805505-C-T 11684799-C-T ***
13812971-A-G 11692265-A-G ***
13817517-C-G 11696811-C-G ***
13818637-C-G 11697931-C-G ***
13818641-C-T 11697935-C-T ***
13832530-A-G 11711824-A-G ***
13832535-A-G 11711829-A-G ***
13832984-C-A 11712278-C-A ***
13677949-A-G 11522273-A-G ***
13664768-T-G 11509092-T-G ***
13457891-A-C 11302215-A-C ***
13669533-AATGGT-A 11513857-AATGGT-A ***
13458212-T-A 11302536-T-A ***
13459373-T-C 11303697-T-C ***
13731468-T-A 11575792-T-A ***
13801218-G-A 11680512-G-A ***
13824962-A-T 11704256-A-T ***
22256898-T-G 20095012-T-G DYZ19 ***
22488513-TG-T 20326627-TG-T DYZ19 ***
28784321-C-G 26638174-C-G ***
28784713-G-A 26638566-G-A ***
6280414-TA-T 6412373-TA-T IR3_Dst 10×A***
20084494-C-T 17972614-C-T P5_Dst ***
13470307-T-C 11314631-T-C ***
13842085-T-A 11721379-T-A ***
28785575-A-T 26639428-A-T ***
13137442-G-C 10626928-G-C ***
13138746-G-C 10628232-G-C 4×ACTCC***
13138813-T-C 10628299-T-C ***
13138833-T-C 10628319-T-C ***
13446960-A-C 11291284-A-C ***
13459208-T-C 11303532-T-C ***
13464328-G-C 11308652-G-C ***
13467150-G-A 11311474-G-A ***
13810110-G-A 11689404-G-A 5×ATGGA***
58976532-C-T 56830385-C-T ***
28807630-T-C 26661483-T-C ***
13850310-T-A 11729604-T-A ***
13817662-C-G 11696956-C-G ***
13817666-A-T 11696960-A-T ***
13817669-G-A 11696963-G-A ***
13818275-C-A 11697569-C-A ***
13833811-C-G 11713105-C-G ***
13842096-C-T 11721390-C-T ***
13846185-A-G 11725479-A-G ***
13848362-A-G 11727656-A-G ***
13848363-T-G 11727657-T-G ***
13854607-T-G 11733901-T-G ***
13817648-G-A 11696942-G-A ***
13855200-A-T 11734494-A-T ***
13856427-C-G 11735721-C-G ***
13858121-G-A 11737415-G-A ***
13858128-A-T 11737422-A-T ***
13870161-C-G 11749455-C-G ***
19765977-CT-C 17654097-CT-C P5_Prx 12×T***
22269590-C-G 20107704-C-G DYZ19 ***
25897206-CA-C 23751059-CA-C P1_Y1 15×A***
28786069-C-T 26639922-C-T ***
28787490-A-G 26641343-A-G ***
13817660-T-C 11696954-T-C ***
13817646-T-A 11696940-T-A ***
28787532-T-A 26641385-T-A ***
10037325-G-C 10199716-G-C ***
58981941-T-C 56835794-T-C ***
58981950-C-A 56835803-C-A ***
58981951-T-A 56835804-T-A ***
13857595-C-G 11736889-C-G ***
26990078-T-TA 24843931-T-TA P1_r4 11×A***
27147441-AT-A 25001294-AT-A P1_g3 12×T***
27808854-TA-T 25662707-TA-T P1_Y2 10×A***
22258592-C-T 20096706-C-T DYZ19 ***
24232093-C-CA 22085946-C-CA P3_b1 21×A***
13194783-A-T 11039107-A-T ***
13817640-A-G 11696934-A-G ***
13838607-A-G 11717901-A-G ***
13139411-C-A 10628897-C-A ***
13140455-A-C 10629941-A-C ***
13142091-A-C 10631577-A-C ***
13454727-T-C 11299051-T-C ***
13461325-C-A 11305649-C-A ***
13468398-G-A 11312722-G-A ***
13658958-G-A 11503282-G-A FGC40602 ***
13739663-G-C 11583987-G-C ***
13817638-G-C 11696932-G-C ***
28787515-A-G 26641368-A-G ***
28787540-G-T 26641393-G-T ***
58981931-C-G 56835784-C-G ***
28798928-C-T 26652781-C-T ***
13870029-C-A 11749323-C-A ***
13870050-G-T 11749344-G-T ***
13870110-GA-G 11749404-GA-G ***
13870128-A-C 11749422-A-C ***
13870134-T-A 11749428-T-A ***
13870143-A-C 11749437-A-C ***
21562049-TCA-T 19400163-TCA-T 18×CA***
22421068-T-G 20259182-T-G DYZ19 ***
27864383-CTT-C 25718236-CTT-C P1_Y2 22×T***
58873382-G-A 56717489-C-T ***
13817507-A-G 11696801-A-G ***
58977130-G-A,GCTCTA 56830983-G-A,GCTCTA ***
58981087-T-C 56834940-T-C ***
9540686-CA-C 9703077-CA-C IR3_Prx 9×A***
20084142-TAG-T 17972262-TAG-T P5_Dst 13×AG***
22239331-A-G 20077445-A-G DYZ19 ***
22421018-G-T 20259132-G-T DYZ19 ***
22505199-T-G 20343313-T-G DYZ19 ***
27062945-GGTA-G 24916798-GGTA-G P1_r4 11×GTA***
13830085-A-G 11709379-A-G ***
21009205-CAT-C 18847319-CAT-C P4_Dst 9×AT***
13870005-C-A 11749299-C-A ***
13450029-C-A 11294353-C-A ***
28798965-A-G 26652818-A-G ***
13680672-T-A 11524996-T-A 4×ATGGA***
58972530-G-C 56826383-G-C ***
58976780-C-T 56830633-C-T ***
58976784-T-C 56830637-T-C ***
58983214-C-A 56837067-C-A ***
13140566-C-T 10630052-C-T ***
13194013-T-C 11038337-T-C ***
13194037-T-C 11038361-T-C ***
13194045-T-C 11038369-T-C ***
13446908-T-C 11291232-T-C ***
13467034-T-G 11311358-T-G ***
13833684-A-G 11712978-A-G ***
13450014-C-A 11294338-C-A ***
13838224-A-C 11717518-A-C ***
28787500-A-G 26641353-A-G ***
28801003-A-G 26654856-A-G ***
58983155-C-T 56837008-C-T ***
22244999-T-A 20083113-T-A DYZ19 ***
13458046-A-C 11302370-A-C ***
13449997-T-C 11294321-T-C ***
13735162-A-G 11579486-A-G 4×AATGG***
13824095-A-T 11703389-A-T ***
28811215-T-G 26665068-T-G ***
58981936-T-C 56835789-T-C ***
58981088-G-C 56834941-G-C ***
13138460-C-T 10627946-C-T ***
28797847-T-A 26651700-T-A ***
58981933-G-C 56835786-G-C ***
9943805-T-C 10106196-T-C ***
13713707-A-G 11558031-A-G ***
13817183-T-G 11696477-T-G ***
13854096-A-T 11733390-A-T ***
13854097-C-G 11733391-C-G ***
13854098-A-C 11733392-A-C ***
13868751-G-A 11748045-G-A ***
28797830-C-A 26651683-C-A ******
28253529-G-A 26107382-G-A P1_b4 ***
58844543-G-T 56746328-C-A ***
13140342-A-T 10629828-A-T ***
13140408-T-C 10629894-T-C ***
13143909-G-C 10633395-G-C ***
13452550-G-C 11296874-G-C ***
13460649-T-C 11304973-T-C ***
13669442-T-G 11513766-T-G ***
13669460-A-T 11513784-A-T ***
13703586-G-C 11547910-G-C ***
13703588-A-G 11547912-A-G ***
13703596-G-A 11547920-G-A ***
58844546-T-C 56746325-A-G FGC44146 ***
28801038-T-G 26654891-T-G ***
13703629-T-A 11547953-T-A ***
13828038-T-A 11707332-T-A ***
13809751-A-C 11689045-A-C ***
13813479-T-C 11692773-T-C ***
13454351-G-C 11298675-G-C ***
13654358-A-G 11498682-A-G ***
13654369-GGCTCA-G 11498693-GGCTCA-G ***
13801709-A-G 11681003-A-G ***
13805210-T-C 11684504-T-C ***
13817515-C-A 11696809-C-A ***
13817643-A-G 11696937-A-G ***
13824523-TATGGAATTGATTCAA-T 11703817-TATGGAATTGATTCAA-T ***
13830109-T-G 11709403-T-G ***
28801033-C-G 26654886-C-G ***
13830113-C-T 11709407-C-T ***
13860411-C-A 11739705-C-A ***
13862305-A-G 11741599-A-G ***
13866902-C-A 11746196-C-A ***
22341523-C-G 20179637-C-G DYZ19 ***
28798940-T-G 26652793-T-G ***
28798967-G-A 26652820-G-A ***
28798972-G-A 26652825-G-A ***
28798982-T-A 26652835-T-A ***
28798994-T-G 26652847-T-G ***
13703626-G-T 11547950-G-T ***
13703636-G-C 11547960-G-C ***
58981084-A-C 56834937-A-C ***
28811407-G-A 26665260-G-A ***
28787520-G-A 26641373-G-A ***
28788098-C-G 26641951-C-G ***
28799118-A-G 26652971-A-G ***
28799131-A-G 26652984-A-G ***
28800342-A-G 26654195-A-G ***
28804258-T-C 26658111-T-C KMS171 ***
28808660-A-G 26662513-A-G ***
28811401-C-T 26665254-C-T ***
28811403-A-G 26665256-A-G ***
28811410-G-T 26665263-G-T ***
22446803-T-C 20284917-T-C DYZ19 ***
28811413-T-C 26665266-T-C ***
28811419-C-A 26665272-C-A ***
58976252-C-T 56830105-C-T ***
58976257-T-C 56830110-T-C ***
58976259-T-C 56830112-T-C ***
58976348-C-T 56830201-C-T ***
58976349-A-C 56830202-A-C ***
58978267-C-T 56832120-C-T ***
58978281-T-A 56832134-T-A ***
58981078-G-C 56834931-G-C ***
28785528-A-C 26639381-A-C ***
13870130-C-G 11749424-C-G ***
13703637-G-T 11547961-G-T ***
13832411-C-A 11711705-C-A ***
13703646-G-A 11547970-G-A ***
13703649-C-A 11547973-C-A ***
13703650-C-T 11547974-C-T ***
13703652-T-A 11547976-T-A ***
13703666-G-C 11547990-G-C ***
13703671-T-G 11547995-T-G ***
13703680-A-T 11548004-A-T ***
13805211-G-A 11684505-G-A ***
13818857-C-G 11698151-C-G ***
13828028-G-A 11707322-G-A ***
13833525-A-C 11712819-A-C ***
13867731-T-G 11747025-T-G ***
13833535-T-A 11712829-T-A ***
13833698-G-A 11712992-G-A ***
13838977-C-A 11718271-C-A ***
13846582-A-T 11725876-A-T ***
13846596-A-C 11725890-A-C ***
13851121-G-A 11730415-G-A ***
13851124-A-G 11730418-A-G ***
13851287-G-T 11730581-G-T ***
13857571-G-T 11736865-G-T ***
13861686-A-T 11740980-A-T ***
13725418-C-T 11569742-C-T ***
13496734-A-G 11341058-A-G ***
13460526-A-G 11304850-A-G ***
8181264-C-T 8313223-C-T ***
7473196-T-C 7605155-T-C IR1_L ***
7608481-T-C 7740440-T-C ***
7753232-C-A 7885191-C-A ***
7886240-C-T 8018199-C-T ***
8085601-T-C 8217560-T-C ***
8181216-G-A 8313175-G-A ***
8181259-G-T 8313218-G-T ***
8181260-A-T 8313219-A-T ***
8181262-C-T 8313221-C-T ***
8181265-G-T 8313224-G-T ***
7371972-C-A 7503931-C-A ***
8181267-C-A 8313226-C-A ***
8181268-T-C 8313227-T-C ***
8181272-T-C 8313231-T-C ***
8181273-G-C 8313232-G-C ***
8181277-G-C 8313236-G-C ***
8181279-T-C 8313238-T-C ***
8181282-G-C 8313241-G-C ***
8181285-T-C 8313244-T-C ***
8181288-C-G 8313247-C-G ***
8181295-A-C 8313254-A-C ***
7414129-T-A 7546088-T-A ***
7362171-C-A 7494130-C-A ***
8408450-A-T 8540409-A-T ***
6901284-A-G 7033243-A-G ***
6382210-C-T 6514169-C-T ***
6398215-C-A 6530174-C-A ***
6592372-C-A 6724331-C-A ***
6593504-C-A 6725463-C-A ***
6648166-G-T 6780125-G-T ***
6648538-C-A 6780497-C-A ***
6709332-C-A 6841291-C-A ***
6756906-C-T 6888865-C-T ***
6808157-G-A 6940116-G-A ***
6903588-C-A 7035547-C-A ***
7338459-A-G 7470418-A-G ***
6977442-C-A 7109401-C-A ***
7127413-C-A 7259372-C-A ***
7149453-G-A 7281412-G-A ***
7199423-C-A 7331382-C-A ***
7303498-G-A 7435457-G-A ***
7310543-C-A 7442502-C-A ***
7312633-G-A 7444592-G-A ***
7313384-C-A 7445343-C-A ***
7320375-G-A 7452334-G-A ***
7321848-C-A 7453807-C-A ***
8293355-C-A 8425314-C-A ***
8732304-G-T 8864263-G-T ***
6377005-C-A 6508964-C-A ***
9296032-G-T 9458423-G-T ***
9296008-A-G 9458399-A-G ***
9296011-T-G 9458402-T-G ***
9296012-T-G 9458403-T-G ***
9296013-G-T 9458404-G-T ***
9296015-A-G 9458406-A-G ***
9296016-T-C 9458407-T-C ***
9296020-A-G 9458411-A-G ***
9296030-C-T 9458421-C-T ***
9296031-A-G 9458422-A-G ***
9296033-A-G 9458424-A-G ***
9296006-A-G 9458397-A-G ***
9296035-T-C 9458426-T-C ***
9298915-A-C 9461306-A-C ***
9304881-A-C 9467272-A-C ***
9304887-C-G 9467278-C-G ***
9325218-A-G 9487609-A-G ***
9325220-A-C 9487611-A-C ***
9336340-A-G 9498731-A-G ***
9344778-C-T 9507169-C-T ***
9344779-G-C 9507170-G-C ***
9344781-C-A 9507172-C-A ***
9296007-G-C 9458398-G-C ***
9296005-C-G 9458396-C-G ***
8739045-G-C 8871004-G-C ***
9025409-C-A 9187800-C-A ***
8739046-T-C 8871005-T-C ***
8739078-C-G 8871037-C-G ***
8739084-A-C 8871043-A-C ***
8739092-A-G 8871051-A-G ***
8786771-A-C 8918730-A-C ***
8786781-T-A 8918740-T-A ***
8786789-C-A 8918748-C-A ***
8786800-T-G 8918759-T-G ***
8856145-C-A 8988104-C-A ***
9013235-G-C 9175626-G-C ***
9063520-C-A 9225911-C-A ***
9295048-T-C 9457439-T-C ***
9127497-G-T 9289888-G-T ***
9186041-T-G 9348432-T-G ***
9216018-T-C 9378409-T-C ***
9216110-G-C 9378501-G-C ***
9216150-C-G 9378541-C-G ***
9216151-G-C 9378542-G-C ***
9217171-A-G 9379562-A-G ***
9224946-A-C 9387337-A-C ***
9230363-A-C 9392754-A-C ***
9236257-A-G 9398648-A-G ***
6377072-C-A 6509031-C-A ***
6341165-C-T 6473124-C-T IR3_Dst ***
9344783-T-G 9507174-T-G ***
13143263-A-T 10632749-A-T ***
13287206-G-T 11131530-G-T ***
9957802-T-C 10120193-T-C ***
13287263-C-A 11131587-C-A ***
2979289-G-T 3111248-G-T ***
22263743-G-T 20101857-G-T DYZ19 ***
22311536-A-G 20149650-A-G DYZ19 ***
58994554-G-C 56848407-G-C ***
58994580-A-G 56848433-A-G ***
13460747-T-G 11305071-T-G ***
58994586-T-A 56848439-T-A ***
13287270-T-A 11131594-T-A ***
13460770-A-G 11305094-A-G ***
13143264-T-C 10632750-T-C ***
58992849-C-T 56846702-C-T ***
14491270-A-G ***
10068230-G-C 10230621-G-C ***
13193978-T-C 11038302-T-C ***
22236342-G-A 20074456-G-A DYZ19 ***
58986090-G-T 56839943-G-T ***
58994560-C-G 56848413-C-G ***
22349092-A-T 20187206-A-T DYZ19 ***
13287275-C-G 11131599-C-G ***
14491296-T-G ***
14491261-A-G ***
9325217-C-G 9487608-C-G ***
25464587-AT-A 23318440-AT-A P2_r2 11×T***
27001771-CTT-C 24855624-CTT-C P1_r4 24×T***
28229322-TA-T 26083175-TA-T P1_b4 17×A***
22234331-TCTATCAGT-CCACCGTA 20072445-TCTATCAGT-CCACCGTA DYZ19 ***
17349364-G-A 15237484-G-A ***
19721752-A-C 17609872-A-C P5_Prx ***
24794438-T-G 22648291-T-G P3_b2 ***
25467010-A-C 23320863-A-C P2_r2 ***
9945123-A-G 10107514-A-G ***
14339102-C-T 12218397-C-T ***
13661287-A-AATGGC 11505611-A-AATGGC ***
25231949-A-G 23085802-A-G P2_r1 ***
25717453-C-A 23571306-C-A P1_b3 ***
27585894-C-T 25439747-C-T P1_Y2 ***
13856303-A-AAATGG 11735597-A-AAATGG 15×AATGG***
17662010-ATGTGTG-A 15550130-ATGTGTG-A 21×TG***
22328388-A-G 20166502-A-G DYZ19 ***
24207437-A-C 22061290-A-C P3_b1 ***
28802685-A-G 26656538-A-G ***
13486729-C-G 11331053-C-G ***
14727319-ATT-A 12615387-ATT-A 23×T***
14491260-C-A ***
22316744-G-T 20154858-G-T DYZ19 ***
6280379-C-A 6412338-C-A IR3_Dst ***
5774865-A-G 5906824-A-G ***
4769384-C-A 4901343-C-A ***
5000599-C-A 5132558-C-A ***
5059718-A-C 5191677-A-C ***
5170209-C-A 5302168-C-A ***
5186768-G-T 5318727-G-T ***
5267513-T-A 5399472-T-A ***
5267517-T-A 5399476-T-A ***
5274773-C-A 5406732-C-A ***
5293993-T-C 5425952-T-C ***
5860975-C-A 5992934-C-A ***
4554470-G-T 4686429-G-T ***
5937209-T-C 6069168-T-C ***
5937210-C-A 6069169-C-A ***
6134445-C-G 6266404-C-G ***
6134448-A-G 6266407-A-G ***
6140561-A-T 6272520-A-T IR3_Dst ***
6146508-T-A 6278467-T-A IR3_Dst ***
6148266-T-G 6280225-T-G IR3_Dst ***
6149780-G-T 6281739-G-T IR3_Dst ***
6232708-C-A 6364667-C-A IR3_Dst ***
6258554-G-T 6390513-G-T IR3_Dst ***
4554471-A-G 4686430-A-G ***
4554469-T-C 4686428-T-C ***
9952739-A-G 10115130-A-G ***
2845202-G-A 2977161-G-A ***
13460839-T-A 11305163-T-A ***
27546172-G-A 25400025-G-A P1_Y2 ***
2649725-C-A 2781684-C-A ***
2649728-G-C 2781687-G-C ***
2649734-C-G 2781693-C-G ***
2697578-C-A 2829537-C-A ***
2719068-T-G 2851027-T-G ***
2845197-G-A 2977156-G-A ***
2845200-C-T 2977159-C-T ***
2845201-A-G 2977160-A-G ***
2979275-C-T 3111234-C-T ***
4504681-T-A 4636640-T-A ***
2979281-C-T 3111240-C-T ***
2979296-C-T 3111255-C-T 15×T***
3115899-C-A 3247858-C-A ***
3164984-G-T 3296943-G-T ***
3559887-C-A 3691846-C-A ***
3705166-C-A 3837125-C-A ***
4062509-C-A 4194468-C-A ***
4123548-C-A 4255507-C-A ***
4271257-C-A 4403216-C-A ***
4472320-C-A 4604279-C-A ***
9344782-C-G 9507173-C-G ***
9344784-A-G 9507175-A-G ***
20323695-CT-C 18161809-CT-C P5_Dst 9×T***
10068221-G-C 10230612-G-C ***
10015033-G-T 10177424-G-T ***
10015037-A-C 10177428-A-C ***
10018264-C-A 10180655-C-A ***
10025236-C-A 10187627-C-A ***
10033210-G-A 10195601-G-A ***
10048793-A-G 10211184-A-G ***
10048797-T-G 10211188-T-G ***
10048924-T-G 10211315-T-G ***
10048931-T-C 10211322-T-C ***
10068232-T-A 10230623-T-A ***
10015028-C-T 10177419-C-T ***
10068239-T-G 10230630-T-G ***
10068247-G-A 10230638-G-A ***
10068251-T-A 10230642-T-A ***
10068261-A-T 10230652-A-T ***
10068265-T-G 10230656-T-G ***
10068281-G-A 10230672-G-A ***
10068286-C-T 10230677-C-T ***
10068325-G-T 10230716-G-T ***
10068327-G-C 10230718-G-C ***
10068852-G-A 10231243-G-A ***
10015030-T-C 10177421-T-C ***
10015025-A-C 10177416-A-C ***
10086325-T-A 10248716-T-A ***
9962287-A-G 10124678-A-G ***
9950938-A-C 10113329-A-C ***
9951026-A-G 10113417-A-G ***
9951042-G-A 10113433-G-A ***
9952707-G-A 10115098-G-A ***
9952711-C-G 10115102-C-G ***
9952723-C-T 10115114-C-T ***
9952735-A-G 10115126-A-G ***
9956533-C-A 10118924-C-A ***
9957834-T-C 10120225-T-C ***
9990104-G-T 10152495-G-T ***
10015024-C-T 10177415-C-T ***
10014738-T-C 10177129-T-C ***
10014749-A-T 10177140-A-T ***
10014761-G-A 10177152-G-A ***
10015013-A-G 10177404-A-G ***
10015015-A-G 10177406-A-G ***
10015016-C-G 10177407-C-G ***
10015019-A-C 10177410-A-C ***
10015021-T-C 10177412-T-C ***
10015022-C-T 10177413-C-T ***
10015023-T-C 10177414-T-C ***
10068876-T-A 10231267-T-A A3766 ***
10086348-A-G 10248739-A-G ***
9945001-C-A 10107392-C-A ***
13372140-A-C 11216464-A-C ***
13253198-A-G 11097522-A-G ***
13253199-G-T 11097523-G-T 14×T***
13316695-G-A 11161019-G-A ***
13813390-A-T 11692684-A-T ***
13326154-T-C 11170478-T-C ***
13329192-A-G 11173516-A-G ***
13329524-G-T 11173848-G-T ***
13331681-C-A 11176005-C-A ***
13372126-A-C 11216450-A-C ***
13372148-A-G 11216472-A-G ***
13236129-A-T 11080453-A-T ***
13394921-T-C 11239245-T-C ***
13394925-T-A 11239249-T-A ***
13394929-A-T 11239253-A-T ***
13394932-G-T 11239256-G-T ***
13446389-C-T 11290713-C-T ***
13446392-T-G 11290716-T-G ***
13460518-C-A 11304842-C-A ***
13460522-A-G 11304846-A-G ***
13460524-G-C 11304848-G-C ***
13460525-C-T 11304849-C-T ***
13252868-C-T 11097192-C-T ***
13227907-C-A 11072231-C-A ***
10102744-C-G 10265135-C-G ***
13140082-G-A 10629568-G-A ***
10102910-T-C 10265301-T-C ***
13109159-C-T 10598645-C-T ***
13120598-A-C 10610084-A-C ***
13140055-A-C 10629541-A-C ***
13140060-A-C 10629546-A-C ***
13140065-A-C 10629551-A-C ***
13140067-T-A 10629553-T-A ***
13140070-A-C 10629556-A-C ***
13140073-C-T 10629559-C-T ***
13140080-G-C 10629566-G-C ***
13143257-A-C 10632743-A-C ***
13203911-G-T 11048235-G-T ***
13143480-A-C 10632966-A-C ***
13143491-G-T 10632977-G-T ***
13143952-T-C 10633438-T-C ***
13193955-G-C 11038279-G-C ***
13193956-A-T 11038280-A-T ***
13193957-T-C 11038281-T-C ***
13193984-T-G 11038308-T-G ***
13203907-T-A 11048231-T-A ***
13203908-C-T 11048232-C-T ***
13203910-C-A 11048234-C-A ***
9950937-T-A 10113328-T-A ***
9942180-C-G 10104571-C-G ***
9344785-G-A 9507176-G-A ***
9344832-T-C 9507223-T-C ***
9344817-G-A 9507208-G-A ***
9344819-T-C 9507210-T-C ***
9344820-G-C 9507211-G-C ***
9344821-T-A 9507212-T-A ***
9344822-A-C 9507213-A-C ***
9344826-C-T 9507217-C-T ***
9344827-C-T 9507218-C-T ***
9344828-T-C 9507219-T-C ***
9344831-G-T 9507222-G-T ***
9344833-A-C 9507224-A-C ***
9344815-C-A 9507206-C-A ***
9344834-C-A 9507225-C-A ***
9344835-C-A 9507226-C-A ***
9344836-A-T 9507227-A-T ***
9344837-T-A 9507228-T-A ***
9344839-T-A 9507230-T-A ***
9344840-A-T 9507231-A-T ***
9344841-C-T 9507232-C-T ***
9344842-C-T 9507233-C-T ***
9344844-G-C 9507235-G-C ***
9344845-G-C 9507236-G-C ***
9344816-T-C 9507207-T-C ***
9344814-T-A 9507205-T-A ***
9345505-A-C 9507896-A-C ***
9344797-A-T 9507188-A-T ***
9344786-C-T 9507177-C-T ***
9344787-C-G 9507178-C-G ***
9344788-C-T 9507179-C-T ***
9344789-C-T 9507180-C-T ***
9344790-A-C 9507181-A-C ***
9344792-C-A 9507183-C-A ***
9344793-A-T 9507184-A-T ***
9344794-A-C 9507185-A-C ***
9344795-C-T 9507186-C-T ***
9344796-C-A 9507187-C-A ***
9344798-G-A 9507189-G-A ***
9344813-A-C 9507204-A-C ***
9344801-A-C 9507192-A-C ***
9344802-G-T 9507193-G-T ***
9344803-A-C 9507194-A-C ***
9344804-G-A 9507195-G-A ***
9344806-T-A 9507197-T-A ***
9344807-C-T 9507198-C-T ***
9344808-T-G 9507199-T-G ***
9344809-C-T 9507200-C-T ***
9344810-T-G 9507201-T-G ***
9344811-G-T 9507202-G-T ***
9345022-A-G 9507413-A-G ***
9345506-G-A 9507897-G-A ***
9940090-C-A 10102481-C-A ***
9930195-T-G 10092586-T-G ***
9725048-T-G 9887439-T-G IR3_Prx ***
9735652-A-T 9898043-A-T IR3_Prx ***
9799324-C-A 9961715-C-A ***
9930171-G-T 10092562-G-T ***
9930186-A-T 10092577-A-T ***
9930188-A-C 10092579-A-C ***
9930189-A-C 10092580-A-C ***
9930191-T-G 10092582-T-G ***
9930193-C-G 10092584-C-G ***
9930196-G-T 10092587-G-T ***
9706175-A-C 9868566-A-C IR3_Prx ***
9930197-G-C 10092588-G-C ***
9930198-G-C 10092589-G-C ***
9930199-A-G 10092590-A-G ***
9930201-T-A 10092592-T-A ***
9930202-C-G 10092593-C-G ***
9930203-C-A 10092594-C-A ***
9930205-G-C 10092596-G-C ***
9930208-A-T 10092599-A-T ***
9930209-G-A 10092600-G-A ***
9930210-C-A 10092601-C-A ***
9725007-C-T 9887398-C-T IR3_Prx ***
9706166-A-C 9868557-A-C IR3_Prx ***
9345508-C-G 9507899-C-G ***
9365790-C-G 9528181-C-G ***
9345510-G-C 9507901-G-C ***
9345512-G-T 9507903-G-T ***
9345513-C-G 9507904-C-G ***
9345516-G-T 9507907-G-T ***
9345521-T-C 9507912-T-C ***
9345525-C-G 9507916-C-G ***
9345531-A-G 9507922-A-G ***
9365316-A-G 9527707-A-G ***
9365337-A-G 9527728-A-G ***
9365346-C-G 9527737-C-G ***
9384549-C-G 9546940-C-G ***
9706039-C-A 9868430-C-A IR3_Prx ***
9384551-A-G 9546942-A-G ***
9529047-C-G 9691438-C-G ***
9540319-C-A 9702710-C-A IR3_Prx ***
9583288-T-C 9745679-T-C IR3_Prx ***
9615410-C-T 9777801-C-T IR3_Prx ***
9626973-A-T 9789364-A-T IR3_Prx ***
9628537-G-T 9790928-G-T IR3_Prx ***
9636564-G-T 9798955-G-T IR3_Prx ***
9637196-C-T 9799587-C-T IR3_Prx ***
9689956-G-T 9852347-G-T IR3_Prx ***
25460675-TATA-T 23314528-TATA-T P2_r2 13×ATA***
18017108-GATATAT-G 15905228-GATATAT-G 22×AT***
13460553-A-G 11304877-A-G ***
18008746-C-T 15896866-C-T P7_Dst ***
13203956-A-G 11048280-A-G ***
13203957-T-A 11048281-T-A ***
13275934-A-G 11120258-A-G ***
13486740-C-T 11331064-C-T ***
13731459-T-A 11575783-T-A ***
18008739-G-T 15896859-G-T P7_Dst ***
18008740-C-T 15896860-C-T P7_Dst ***
18008744-G-T 15896864-G-T P7_Dst ***
18008745-G-T 15896865-G-T P7_Dst ***
18008748-C-T 15896868-C-T P7_Dst ***
13203954-T-G 11048278-T-G ***
18008752-C-T 15896872-C-T P7_Dst ***
18008754-C-T 15896874-C-T P7_Dst ***
18008756-G-T 15896876-G-T P7_Dst ***
18008757-C-T 15896877-C-T P7_Dst ***
18008764-C-T 15896884-C-T P7_Dst ***
18008766-G-T 15896886-G-T P7_Dst ***
18008781-G-T 15896901-G-T P7_Dst ***
18008782-G-T 15896902-G-T P7_Dst ***
18008788-G-T 15896908-G-T P7_Dst ***
18008789-C-T 15896909-C-T P7_Dst ***
13203955-C-T 11048279-C-T ***
13203952-G-T 11048276-G-T ***
18008794-C-T 15896914-C-T P7_Dst ***
13203936-A-G 11048260-A-G ***
13203926-A-T 11048250-A-T ***
13203927-T-A 11048251-T-A ***
13203929-G-T 11048253-G-T ***
13203930-T-A 11048254-T-A ***
13203931-G-T 11048255-G-T ***
13203932-A-G 11048256-A-G ***
13203933-T-A 11048257-T-A ***
13203934-A-T 11048258-A-T ***
13203935-G-A 11048259-G-A ***
13203937-G-T 11048261-G-T ***
13203951-T-A 11048275-T-A ***
13203938-A-G 11048262-A-G ***
13203939-T-A 11048263-T-A ***
13203940-G-T 11048264-G-T ***
13203941-A-G 11048265-A-G ***
13203942-T-A 11048266-T-A ***
13203945-A-G 11048269-A-G ***
13203946-G-T 11048270-G-T ***
13203948-T-G 11048272-T-G ***
13203949-G-T 11048273-G-T ***
13203950-A-G 11048274-A-G ***
18008791-A-T 15896911-A-T P7_Dst ***
18008796-C-T 15896916-C-T P7_Dst ***
13203923-G-T 11048247-G-T ***
26089884-C-T 23943737-C-T P1_Y1 ***
25845055-C-A 23698908-C-A P1_b3 ***
25845058-T-A 23698911-T-A P1_b3 ***
26089868-G-A 23943721-G-A P1_Y1 ***
26089870-A-T 23943723-A-T P1_Y1 ***
26089873-C-T 23943726-C-T P1_Y1 ***
26089876-C-T 23943729-C-T P1_Y1 ***
26089879-C-T 23943732-C-T P1_Y1 ***
26089881-G-T 23943734-G-T P1_Y1 ***
26089882-A-T 23943735-A-T P1_Y1 ***
26089887-C-T 23943740-C-T P1_Y1 ***
25165722-G-A 23019575-G-A g1 ***
26098042-G-A 23951895-G-A P1_Y1 ***
26907499-A-T 24761352-A-T P1_r3 ***
26991369-G-A 24845222-G-A P1_r4 ***
26991375-G-A 24845228-G-A P1_r4 ***
26991377-G-A 24845230-G-A P1_r4 ***
26991381-C-A 24845234-C-A P1_r4 ***
26991383-G-A 24845236-G-A P1_r4 ***
27585891-A-T 25439744-A-T P1_Y2 ***
27585905-A-T 25439758-A-T P1_Y2 ***
28253528-T-A 26107381-T-A P1_b4 ***
25207893-G-A 23061746-G-A P2_r1 ***
24420937-C-T 22274790-C-T ***
18008799-G-T 15896919-G-T P7_Dst ***
20949800-A-C 18787914-A-C P4_Dst ***
18008803-C-T 15896923-C-T P7_Dst ***
19189522-A-C 17077642-A-C ***
19727382-A-C 17615502-A-C P5_Prx ***
20217481-A-C 18055595-A-C P5_Dst ***
20252822-C-A 18090936-C-A P5_Dst ***
20252825-G-A 18090939-G-A P5_Dst ***
20252827-T-A 18090941-T-A P5_Dst ***
20252829-G-A 18090943-G-A P5_Dst ***
20886833-G-A 18724947-G-A P4_Dst ***
20949799-A-G 18787913-A-G P4_Dst ***
22256895-G-T 20095009-G-T DYZ19 ***
24216307-G-T 22070160-G-T P3_b1 ***
22256896-A-C 20095010-A-C DYZ19 ***
22256897-G-A 20095011-G-A DYZ19 ***
22341557-G-T 20179671-G-T DYZ19 ***
22341567-C-A 20179681-C-A DYZ19 ***
22341578-G-A 20179692-G-A DYZ19 ***
22341586-G-C 20179700-G-C DYZ19 ***
22358798-T-G 20196912-T-G DYZ19 ***
23667682-T-G 21505796-T-G ***
24084229-A-C 21938082-A-C P3_b1 ***
24084251-A-C 21938104-A-C P3_b1 ***
13203925-C-G 11048249-C-G ***
13203922-C-A 11048246-C-A ***
28253537-G-A 26107390-G-A P1_b4 ***
6001342-T-C 6133301-T-C ***
28802524-C-G 26656377-C-G S835 ***
28802525-G-A 26656378-G-A ***
13461335-T-G 11305659-T-G ***
58995224-G-T 56849077-G-T ***
58857159-G-T 56733712-C-A ***
58887515-C-T 56703356-G-A ***
13740650-CTGG-ATGA 11584974-CTGG-ATGA ***
14696034-G-A 12584100-G-A ***
4841726-A-C 4973685-A-C ***
9956705-G-C 10119096-G-C ***
22236796-TCAAGAGCCTC-GGAACAAACTA 20074910-TCAAGAGCCTC-GGAACAAACTA DYZ19 ***
9956706-A-T 10119097-A-T ***
10014627-T-G 10177018-T-G ***
10014714-A-G 10177105-A-G ***
10014734-A-T 10177125-A-T ***
10037786-G-A 10200177-G-A ***
10048759-A-G 10211150-A-G ***
10048933-A-T 10211324-A-T ***
10048936-A-G 10211327-A-G ***
10048945-T-C 10211336-T-C ***
13256126-G-GT 11100450-G-GT ***
28805796-CGT-TGG 26659649-CGT-TGG ***
22501912-T-C 20340026-T-C DYZ19 ***
13272378-C-T 11116702-C-T ***
17994811-G-A 15882931-G-A P7_Prx ***
58838785-A-C 56752086-T-G ***
58989404-C-T 56843257-C-T ***
24552048-T-C 22405901-T-C P3_t2 ***
22344617-G-C 20182731-G-C DYZ19 ***
9345055-C-G 9507446-C-G ***
22344592-A-C 20182706-A-C DYZ19 ***
9952050-T-G 10114441-T-G ***
16162122-G-A 14050242-G-A P8_Dst ***
16162130-T-A 14050250-T-A P8_Dst ***
18008709-A-T 15896829-A-T P7_Dst ***
22356064-G-C 20194178-G-C DYZ19 ***
18008713-A-T 15896833-A-T P7_Dst ***
16136069-AT-A 14024189-AT-A P8_Dst 15×T***
9626124-CA-C 9788515-CA-C IR3_Prx 12×A***
19743718-C-CA 17631838-C-CA P5_Prx 13×A***
24618868-CT-C 22472721-CT-C P3_t2 12×T***
26130114-CA-C 23983967-CA-C P1_Y1 17×A***
26873983-C-CT 24727836-C-CT P1_r3 23×T***
27776111-GA-G 25629964-GA-G P1_Y2 9×A***
22226464-A-T 20064578-A-T DYZ19 ***
7464063-G-A 7596022-G-A IR1_L ***
13268165-G-A 11112489-G-A ***
13287192-A-T 11131516-A-T ***
13203921-A-G 11048245-A-G ***
9325211-A-C 9487602-A-C ***
28802556-A-G 26656409-A-G ***
22315987-A-T 20154101-A-T DYZ19 ***
6134451-A-G 6266410-A-G ***
9202323-C-T 9364714-C-T ***
9215996-A-G 9378387-A-G ***
9215999-C-G 9378390-C-G ***
9216002-A-C 9378393-A-C ***
9304878-C-G 9467269-C-G ***
9325205-A-G 9487596-A-G ***
9930204-A-G 10092595-A-G ***
13437416-A-C 11281740-A-C ***
9930207-A-G 10092598-A-G ***
9930211-C-G 10092602-C-G ***
10068837-T-C 10231228-T-C A4931 ***
13203913-C-G 11048237-C-G ***
13203914-G-T 11048238-G-T ***
13203915-A-G 11048239-A-G ***
13203916-T-A 11048240-T-A ***
13203917-G-T 11048241-G-T ***
13203919-T-A 11048243-T-A ***
13203920-G-T 11048244-G-T ***
28802553-T-G 26656406-T-G ***
22257958-G-T 20096072-G-T DYZ19 ***
13287288-A-T 11131612-A-T ***
19389740-G-A 17277860-G-A ***
13296851-C-T 11141175-C-T ***
13326060-TA-T 11170384-TA-T 14×A***
13329172-A-G 11173496-A-G ***
13433088-TAA-T 11277412-TAA-T ***
13460721-T-C 11305045-T-C ***
13543271-A-C 11387595-A-C ***
17346142-C-T 15234262-C-T M9211 18×T***
17926565-G-A 15814685-G-A ***
17926575-C-A 15814695-C-A ***
18534143-CAT-C 16422263-CAT-C P6_Dst 8×AT***
19520867-G-A 17408987-G-A ***
20949802-G-C 18787916-G-C P4_Dst ***
20778781-T-TTGTG 18616895-T-TTGTG P4_Prx 18×TG***
22520812-G-A 20358926-G-A ***
22995397-TG-T 20833511-TG-T ***
22995398-G-T 20833512-G-T ***
28797878-G-A 26651731-G-A ***
28797880-G-A 26651733-G-A ***
28802738-G-C 26656591-G-C ***
28802739-C-A 26656592-C-A ***
58994804-C-T 56848657-C-T ***
59032197-T-C 56886050-T-C ***
28253532-G-A 26107385-G-A P1_b4 ***
28253545-G-A 26107398-G-A P1_b4 ***
13861579-GAT-CAG 11740873-GAT-CAG ***
7044413-G-T 7176372-G-T Z14994 ***
13320385-CAT-GAA 11164709-CAT-GAA ***
9746248-T-G 9908639-T-G ***
22346982-A-C 20185096-A-C DYZ19 ***
24794491-A-G 22648344-A-G P3_b2 ***
25727456-G-A 23581309-G-A P1_b3 ***
26505318-T-G 24359171-T-G P1_Y1 ***
22229643-AGGAA-TGGAG 20067757-AGGAA-TGGAG DYZ19 ***
26267693-TAC-AAA 24121546-TAC-AAA P1_Y1 ***
26730212-A-G 24584065-A-G P1_g2 ***
9939797-AT-A 10102188-AT-A ***
28117346-C-T 25971199-C-T P1_b4 ***
9945130-T-C 10107521-T-C ***
9945172-A-G 10107563-A-G ***
9956692-G-A 10119083-G-A ***
10014639-T-C 10177030-T-C ***
10014729-A-G 10177120-A-G ***
10048872-C-T 10211263-C-T ***
10048873-A-G 10211264-A-G ***
10048961-T-C 10211352-T-C ***
10068256-T-G 10230647-T-G ***
13268004-A-T 11112328-A-T ***
4416867-CA-C 4548826-CA-C 17×A***
13437739-CA-GC 11282063-CA-GC ***
13423950-T-G 11268274-T-G ***
27398234-T-A 25252087-T-A P1_g3 ***
24794448-C-G 22648301-C-G P3_b2 ***
18340731-GT-G 16228851-GT-G P6_Prx 13×T***
19749309-CT-C 17637429-CT-C P5_Prx 22×T***
58846004-G-C 56744867-C-G ***
22236782-CGA-TGC 20074896-CGA-TGC DYZ19 ***
2758620-T-A 2890579-T-A ***
13552721-C-T 11397045-C-T ***
26997351-G-T 24851204-G-T P1_r4 ***
27082215-G-A 24936068-G-A P1_r4 ***
28136379-C-A 25990232-C-A P1_b4 ***
20500942-GA-G 18339056-GA-G P5_Dst 15×A***
6359640-TAAA-T 6491599-TAAA-T 22×A***
9202348-TGGT-GGGG 9364739-TGGT-GGGG ***
13744426-GGAAC-AGAAT 11588750-GGAAC-AGAAT ***
19510292-GTA-TTT 17398412-GTA-TTT ***
19682558-TGGGT-GGGGG 17570678-TGGGT-GGGGG P5_Prx ***
58993334-AGG-GGT 56847187-AGG-GGT ***
58914170-C-T 56676701-G-A ***
15450073-CT-C 13338193-CT-C 15×T***
9216030-T-C 9378421-T-C ***
24040739-G-T 21894592-G-T ***
13423948-A-G 11268272-A-G ***
13435833-A-G 11280157-A-G ***
19727360-A-C 17615480-A-C P5_Prx ***
27585908-A-T 25439761-A-T P1_Y2 ***
19727366-T-C 17615486-T-C P5_Prx ***
20243030-G-A 18081144-G-A P5_Dst ***
26277719-A-T 24131572-A-T P1_Y1 ***
26900301-G-A 24754154-G-A P1_r3 ***
26986481-C-T 24840334-C-T P1_r4 ***
27585896-A-T 25439749-A-T P1_Y2 ***
27585901-G-T 25439754-G-T P1_Y2 ***
27585902-C-T 25439755-C-T P1_Y2 ***
27585907-C-T 25439760-C-T P1_Y2 ***
28806573-G-T 26660426-G-T ***
18008714-G-T 15896834-G-T P7_Dst ***
28806577-T-A 26660430-T-A ***
28806578-G-T 26660431-G-T ***
13868769-CA-TG 11748063-CA-TG ***
13140125-G-CACTC 10629611-G-CACTC 6×CACTC***
13140214-CCT-TCC 10629700-CCT-TCC ***
13447311-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA 11291635-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA ***
13681022-TCTCCAATGT-AATGGTACCG 11525346-TCTCCAATGT-AATGGTACCG ***
13860093-AT-TG 11739387-AT-TG ***
13860133-TTCGTTGGAACTT-AGGAATAGAATGG 11739427-TTCGTTGGAACTT-AGGAATAGAATGG ***
13861497-TCGA-AGAT 11740791-TCGA-AGAT ***
19189470-C-G 17077590-C-G ***
18008711-G-T 15896831-G-T P7_Dst ***
13445157-C-G 11289481-C-G ***
58992739-G-A 56846592-G-A ***
13446330-G-T 11290654-G-T ***
14267133-C-A 12146427-C-A Z24295 ***
14413234-C-A 12292531-C-A ***
17203349-C-T 15091469-C-T ***
18184647-G-T 16072767-G-T ***
19510294-A-T 17398414-A-T ***
22238337-A-G 20076451-A-G DYZ19 ***
28797847-T-C 26651700-T-C ***
28802712-A-T 26656565-A-T ***
58884623-T-A 56706248-A-T ***
59032175-T-C 56886028-T-C ***
16292641-A-T 14180761-A-T ***
2807024-TTATA-T 2938983-TTATA-T 20×TA***
28025169-GA-G 25879022-GA-G P1_Y2 11×A***
26900291-G-A 24754144-G-A P1_r3 ***
6174500-T-G 6306459-T-G IR3_Dst ***
8181242-C-G 8313201-C-G ***
8181256-C-G 8313215-C-G ***
9345434-T-G 9507825-T-G ***
9372453-T-G 9534844-T-G ***
13140094-A-C 10629580-A-C ***
15364005-A-G 13252125-A-G ***
19727364-A-C 17615484-A-C P5_Prx ***
14088854-C-A 11968148-C-A ***
28253548-C-A 26107401-C-A P1_b4 ***
14785532-CT-C 12673602-CT-C 18×T***
28797875-T-A 26651728-T-A ***
28802529-A-G 26656382-A-G ***
28802532-T-A 26656385-T-A ***
28802536-G-A 26656389-G-A ***
28802541-T-A 26656394-T-A ***
28802543-G-T 26656396-G-T ***
28802561-A-G 26656414-A-G ***
28802562-T-A 26656415-T-A ***
13488715-CA-GG 11333039-CA-GG ***
13488987-CAGGGT-TGGGGC 11333311-CAGGGT-TGGGGC ***
28797870-G-A 26651723-G-A ***
16150948-TA-T 14039068-TA-T P8_Dst 22×A***
10014645-C-CTAAT 10177036-C-CTAAT 4×TAAT***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
28017356-C-CA 25871209-C-CA P1_Y2 16×A***
9540246-CT-C 9702637-CT-C IR3_Prx 18×T***
20428140-AT-A 18266254-AT-A P5_Dst 17×T***
9571868-TTG-T 9734259-TTG-T IR3_Prx 10×TG***
9639183-CT-C 9801574-CT-C IR3_Prx 12×T***
13120632-TA-T 10610118-TA-T 8×A***
13275922-C-CA 11120246-C-CA ***
28797872-G-T 26651725-G-T ***
28797869-A-C 26651722-A-C ***
13681005-GA-CG 11525329-GA-CG ***
28253594-T-A 26107447-T-A P1_b4 ***
28253580-T-A 26107433-T-A P1_b4 ***
28253581-T-A 26107434-T-A P1_b4 ***
28253583-C-A 26107436-C-A P1_b4 ***
28253584-C-A 26107437-C-A P1_b4 ***
28253586-C-A 26107439-C-A P1_b4 ***
28253587-C-A 26107440-C-A P1_b4 ***
28253588-T-A 26107441-T-A P1_b4 ***
28253589-C-A 26107442-C-A P1_b4 ***
28253592-C-A 26107445-C-A P1_b4 ***
28253593-C-A 26107446-C-A P1_b4 ***
28253595-G-A 26107448-G-A P1_b4 ***
28797868-A-G 26651721-A-G ***
28253597-T-A 26107450-T-A P1_b4 ***
28253599-C-A 26107452-C-A P1_b4 ***
28253601-C-A 26107454-C-A P1_b4 ***
28253603-T-A 26107456-T-A P1_b4 ***
28253604-G-A 26107457-G-A P1_b4 ***
28253606-C-A 26107459-C-A P1_b4 ***
28253610-T-A 26107463-T-A P1_b4 ***
28797860-G-T 26651713-G-T ***
28797862-G-T 26651715-G-T ***
28797865-G-A 26651718-G-A ***
13446403-CA-TG 11290727-CA-TG ***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13143459-C-A 10632945-C-A ***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
24785778-C-CT 22639631-C-CT P3_b2 14×T***
25300414-CA-C 23154267-CA-C P2_r1 8×A***
25301996-CT-C 23155849-CT-C P2_r1 ***
25310157-AAG-A 23164010-AAG-A P2_r1 ***
25437894-T-TA 23291747-T-TA P2_r2 12×A***
25675782-T-TA 23529635-T-TA P1_b3 12×A***
26880198-CT-C 24734051-CT-C P1_r3 25×T***
26900719-GA-G 24754572-GA-G P1_r3 17×A***
26907510-A-AT 24761363-A-AT P1_r3 22×T***
27186323-G-GA 25040176-G-GA P1_g3 19×A***
24684828-TAC-T 22538681-TAC-T P3_b2 15×AC***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
27412214-CA-C 25266067-CA-C P1_g3 8×A***
27736672-G-GA 25590525-G-GA P1_Y2 10×A***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAA 25825609-CACACACACACAAAG-AAAAAAAAAAAAAAA P1_Y2 ***
28180701-CA-C 26034554-CA-C P1_b4 16×A***
58823840-TG-AT 56767030-CA-AT ***
25176848-TTC-T 23030701-TTC-T g1 ***
58823383-CTCTATC-TTCCATT 56767482-GATAGAG-AATGGAA ***
9293361-C-T 9455752-C-T ***
9940961-C-G 10103352-C-G ***
24736119-CA-C 22589972-CA-C P3_b2 11×A***
24582837-CA-C 22436690-CA-C P3_t2 17×A***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA 11543717-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA ***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGT 16421255-CTTTGTTTCTTGC-TTTTTTTTTTTGT P6_Dst ***
13699416-GAAACGAATTC-TACACAAATGG 11543740-GAAACGAATTC-TACACAAATGG ***
13729554-CA-GG 11573878-CA-GG ***
13740632-GAACTC-CGAACG 11584956-GAACTC-CGAACG ***
13740761-GGA-CGG 11585085-GGA-CGG ***
13801012-TGCAATG-AGGAATA 11680306-TGCAATG-AGGAATA ***
13856627-TA-GG 11735921-TA-GG ***
16099087-CTG-C 13987207-CTG-C P8_Prx 23×TG***
18369645-TAC-AAA 16257765-TAC-AAA P6_Prx ***
18490252-C-CT 16378372-C-CT P6_Dst 11×T***
18501374-A-AT 16389494-A-AT P6_Dst 10×T***
19727393-TA-CC 17615513-TA-CC P5_Prx ***
22505217-TG-T 20343331-TG-T DYZ19 ***
20110561-G-GA 17998681-G-GA P5_Dst 20×A***
20229254-G-GT 18067368-G-GT P5_Dst 15×T***
20333189-C-CA 18171303-C-CA P5_Dst 17×A***
20717039-C-AA 18555153-C-AA P4_Prx 35×A***
20917254-CA-C 18755368-CA-C P4_Dst 14×A***
20949903-TCC-CCT 18788017-TCC-CCT P4_Dst ***
21006509-GAC-G 18844623-GAC-G P4_Dst 16×AC***
22269595-TTCG-ATTA 20107709-TTCG-ATTA DYZ19 ***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
22337965-ACTTT-CCTTC 20176079-ACTTT-CCTTC DYZ19 ***
58866431-TCCATTTGATGCCATC-T,TCCATTTGATGCCATT ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McConnaughhay1325141111-12121211121428179-1111112515183015-15-16-17111119-231716191739-39121211915-1681010810101221-231610121216812262013121113111112123515916122426191211121211913121011113012132413101022151913241713152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 2052971102098680396408132801
Used in age calculations1102098680396408132801
Counts of SNPs00
Variant counts last updated 2017-09-19 23:22:51.



Big Tree Main Page