Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > DF85 > S673 > S668 > DF97 > ZZ36 > FGC19851 > ~22318057-C-G > FGC19846 > FGC19840 > FGC19845 > FGC19852

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POSITION-REF-ALT (hg19) Blocks Names Region combBED STRFTDNA
205297
FGC-BigY
ZHGA5
3759043-CT-C****
17701749-C-A**
17201762-CTTT-C16×T**
16030291-C-A**
19293769-TC-T**
16279376-C-TY**
16297287-C-AY**
23807452-C-AY**
16702018-G-T**
16929821-C-A**
17135823-T-AY**
23184460-C-G**
15397763-C-A**
20995546-T-TCTTTCP4_Dst11×CTTTC**
22767669-A-C**
22765770-C-AY**
18143700-G-TY**
10018233-A-G**
22077112-C-TY**
21744398-T-C**
21672147-C-AY**
28101123-TG-TP1_Y2**
21297728-C-AY**
15863210-C-AY**
14815709-C-A**
19562493-G-C**
13881553-G-T**
28543163-C-A**
28688244-C-AY**
27319730-T-CP1_g3**
13494346-C-A**
7225683-G-AY**
7090966-C-A**
6998204-C-AY**
6978237-C-AY**
6830391-C-A**
6519314-C-T**
13890190-C-A**
14785022-C-AY**
13894441-C-T**
13897029-C-A**
13941716-A-C**
13945606-A-T**
4063917-C-T**
3986035-C-A**
3100424-G-T**
5937242-CTATATA-C18×TA**
2684611-C-AY**
14517673-C-AY**
19356390-G-TY**
24518184-C-A**
14491213-G-AY*****
20809831-C-AP4_Gap**
13461364-T-A*****
20217930-C-AP5_Dst**
13740604-AATG-A**
20390132-G-TP5_Dst**
28101093-G-AP1_Y2**
20886845-T-AP4_Dst***
25709616-G-TP1_b3***
25883843-A-CP1_Y1***
19939632-C-AP5_Prx***
25883826-A-CP1_Y1***
25845007-C-AP1_b3***
25804968-T-CP1_b3***
19992053-G-CP5_Prx***
19992054-C-TP5_Prx***
20084532-A-TP5_Dst***
25757741-G-TP1_b3***
25717459-G-AP1_b3***
25717384-C-AP1_b3***
20084558-G-TP5_Dst***
25709622-A-TP1_b3***
25709602-G-TP1_b3***
25954889-T-GP1_Y1***
25709599-C-TP1_b3***
25709598-A-TP1_b3***
25690063-G-TP1_b3***
25677461-T-GP1_b3***
20084563-A-TP5_Dst***
25677412-A-TP1_b3***
25674441-G-TP1_b3***
25671990-A-TP1_b3***
25650700-A-CP1_b3***
25650623-A-GP1_b3***
25650615-T-AP1_b3***
25650607-G-TP1_b3***
25603751-A-CP1_gr1***
25602256-G-AP1_gr1***
25899578-T-GP1_Y1***
25954922-A-GP1_Y1***
25500457-A-GP2_r2***
25955050-G-AP1_Y1***
26152255-G-TP1_Y1***
26152254-A-TP1_Y1***
26152251-T-CP1_Y1***
26124515-G-AP1_Y1***
26124511-G-AP1_Y1***
26124509-C-AP1_Y1***
26124507-G-AP1_Y1***
26098060-C-AP1_Y1***
26098047-C-AP1_Y1***
26098044-C-AP1_Y1***
26098038-G-AP1_Y1***
26089890-G-TP1_Y1***
25955052-A-GP1_Y1***
25955045-G-AP1_Y1***
25954924-T-CP1_Y1***
25955037-C-TP1_Y1***
25955032-A-GP1_Y1***
25955031-A-GP1_Y1***
25955006-T-CP1_Y1***
25954995-A-CP1_Y1***
25954990-A-GP1_Y1***
25954989-C-TP1_Y1***
25954985-A-CP1_Y1***
25954974-A-TP1_Y1***
25954969-C-GP1_Y1***
25954965-C-TP1_Y1***
25954954-A-CP1_Y1***
25954947-A-TP1_Y1***
25954931-G-AP1_Y1***
25500539-C-AP2_r2***
25493278-G-TP2_r2***
26225692-T-CP1_Y1***
24794780-G-TP3_b2***
25246351-C-TP2_r1***
25246349-C-TP2_r1***
25231927-C-GP2_r1***
20886818-T-CP4_Dst***
25207780-G-AP2_r1***
20340123-C-TP5_Dst***
25165697-G-Ag1***
25137073-G-Tg1***
25011070-G-Tg1***
24940894-C-Gg1***
24895738-A-Gg1***
24850046-G-TP3_b2***
24850014-T-GP3_b2***
24794487-C-GP3_b2***
25246362-C-TP2_r1***
24794458-A-GP3_b2***
24794431-A-GP3_b2***
24794424-T-GP3_b2***
24794415-C-GP3_b2***
24792932-C-GP3_b2***
24792917-G-AP3_b2***
24792912-G-TP3_b2***
24775669-A-CP3_b2***
24771280-G-TP3_b2***
24762687-G-TP3_b2***
24762576-A-CP3_b2***
24762565-A-CP3_b2***
24762215-C-AP3_b2***
24762211-A-GP3_b2***
25246361-C-TP2_r1***
25246364-T-CP2_r1***
25481007-G-CP2_r2***
20096972-G-TP5_Dst***
25464730-A-TP2_r2***
25464619-T-AP2_r2***
25447412-T-GP2_r2***
25440128-G-AP2_r2***
25434096-A-TP2_r2***
25432540-G-AP2_r2***
25431769-G-TP2_r2***
25375096-G-CP2_r2***
25372016-G-TP2_r2***
25366813-A-GP2_r2***
25366490-C-GP2_r2***
25366481-A-CP2_r2***
25366479-T-CP2_r2***
20097028-A-GP5_Dst***
25246444-C-TP2_r1***
20869997-A-GP4_Dst***
20107286-C-AP5_Dst***
25366477-C-GP2_r2***
20873614-G-TP4_Dst***
20243004-T-AP5_Dst***
25366474-C-GP2_r2***
20243589-G-TP5_Dst***
25366296-C-AP2_r2***
20306352-G-AP5_Dst***
25361352-C-AP2_r2***
25310160-G-AP2_r1***
25306825-C-TP2_r1***
25268509-G-AP2_r1***
20312742-G-AP5_Dst***
26152256-A-TP1_Y1***
19919382-C-AP5_Prx***
24762195-G-TP3_b2***
27205748-G-TP1_g3***
27424368-C-AP1_g3***
27420607-A-GP1_g3***
19857942-T-GP5_Prx***
27397086-A-CP1_g3***
27370655-T-AP1_g38×A***
19868136-A-TP5_Prx***
27368971-T-AP1_g3***
27329997-G-TP1_g3***
19868137-G-TP5_Prx***
27266648-G-TP1_g3***
27256273-G-TP1_g3***
27231456-T-AP1_g3***
27229530-C-AP1_g3***
27198931-G-TP1_g3***
27546167-G-TP1_Y2***
27151348-T-GP1_g3***
27150714-C-TP1_g3***
27150703-A-TP1_g3***
27129847-T-AP1_g3***
27129704-A-GP1_g3***
27128542-G-TP1_g3***
27082152-A-CP1_r4***
27082147-A-CP1_r4***
27001696-C-TP1_r4***
27001666-C-TP1_r4***
27001661-C-TP1_r4***
26997371-A-CP1_r4***
26997364-G-AP1_r4***
26997361-A-TP1_r4***
27466779-C-TP1_Y2***
27550393-C-AP1_Y2***
26997355-A-TP1_r4***
27902499-C-TP1_Y2***
28065184-A-TP1_Y2***
28065180-T-CP1_Y2***
28065178-A-CP1_Y2***
28062767-A-CP1_Y2***
28062762-G-TP1_Y2***
28060368-T-CP1_Y2***
28024588-C-AP1_Y2***
28017440-G-TP1_Y2***
28017380-C-AP1_Y2***
28009094-C-TP1_Y2***
27971792-C-AP1_Y2***
27947602-C-AP1_Y2***
27902504-A-TP1_Y2***
27902385-A-TP1_Y2***
27584263-G-TP1_Y2***
27902262-A-CP1_Y2***
27893789-T-AP1_Y2***
27874304-C-TP1_Y2***
27864418-G-CP1_Y2***
27844434-A-CP1_Y2***
27793138-C-GP1_Y2***
27793132-G-CP1_Y2***
27780504-T-AP1_Y2***
27776088-T-AP1_Y2***
27769124-G-TP1_Y2***
27763278-A-GP1_Y2***
27714820-G-AP1_Y2***
27607548-G-AP1_Y2***
27607527-C-GP1_Y2***
26997357-G-AP1_r4***
26986488-G-TP1_r4***
26243420-A-GP1_Y1***
26243447-A-CP1_Y1***
26465151-T-AP1_Y1***
26465109-G-AP1_Y1***
26465105-C-AP1_Y1***
26465104-T-AP1_Y1***
26465088-T-AP1_Y1***
26344389-G-TP1_Y1***
26344125-A-TP1_Y1***
26344120-C-TP1_Y1***
26344119-G-TP1_Y1***
26320406-C-TP1_Y1***
26320398-G-TP1_Y1***
26319788-C-AP1_Y1***
26284971-G-AP1_Y1***
26243445-A-GP1_Y1***
26505315-A-GP1_Y1***
26243442-A-GP1_Y1***
26243440-A-GP1_Y1***
26243439-A-TP1_Y1***
26243437-G-AP1_Y1***
26243435-A-GP1_Y1***
26243433-G-TP1_Y1***
26243432-A-GP1_Y1***
26243430-C-GP1_Y1***
26243428-A-GP1_Y1***
26243427-A-TP1_Y1***
26243426-C-AP1_Y1***
26243425-A-TP1_Y1***
26243424-A-GP1_Y1***
26243422-C-GP1_Y1***
26505309-A-GP1_Y1***
26505323-A-GP1_Y1***
26986479-G-TP1_r4***
26902377-C-AP1_r3***
26986467-G-AP1_r4***
26986440-C-TP1_r424×T***
26986419-C-GP1_r4***
26986415-G-TP1_r4***
26955557-T-GP1_r3***
26955530-A-GP1_r3***
26955513-T-GP1_r3***
26907505-A-GP1_r3***
26902387-T-AP1_r3***
26902385-C-AP1_r3***
26902384-C-AP1_r3***
26902383-C-AP1_r3***
26902380-C-AP1_r3***
26902379-G-AP1_r3***
26902373-T-AP1_r3***
26546621-G-TP1_g2***
26902370-T-AP1_r3***
26902369-G-AP1_r3***
26902367-C-AP1_r3***
26902185-T-AP1_r3***
26874673-C-GP1_r3***
26835608-T-GP1_g2***
26834496-A-GP1_g2***
26828436-G-AP1_g2***
26810567-G-TP1_g2***
26810565-A-TP1_g2***
26810558-T-AP1_g2***
26730200-G-AP1_g2***
26730199-A-GP1_g2***
26592994-G-TP1_g2***
24762196-A-CP3_b2***
24762187-A-TP3_b2***
20886847-T-AP4_Dst***
22316743-T-GDYZ19***
22338481-C-GDYZ19***
22337751-G-CDYZ19***
22334893-A-GDYZ19***
22330562-A-GDYZ19***
22330539-G-TDYZ19***
22330477-C-ADYZ19***
22321201-A-TDYZ19***
22321197-A-CDYZ19***
20654157-A-GP4_Prx***
22319293-C-TDYZ19***
22317581-T-CDYZ19***
22317576-A-GDYZ19***
22316747-A-TDYZ19***
22315989-C-TDYZ19***
22341253-T-ADYZ19***
22301142-T-CDYZ19***
22301139-A-CDYZ19***
22293403-C-TDYZ19***
22286912-C-TDYZ19***
22286911-T-GDYZ19***
22286909-G-TDYZ19***
22286908-T-GDYZ19***
22286907-A-CDYZ19***
22286906-C-TDYZ19***
22286904-T-GDYZ19***
22286901-A-TDYZ19***
22286900-C-GDYZ19***
22286899-C-GDYZ19***
22286898-T-CDYZ19***
22338762-A-TDYZ19***
22341259-C-ADYZ19***
22266199-T-GDYZ19***
22367400-C-TDYZ19***
22493065-G-ADYZ19***
22488722-G-CDYZ19***
22482716-G-TDYZ19***
22460224-C-TDYZ19***
22460223-A-GDYZ19***
22460222-T-ADYZ19***
22460219-C-GDYZ19***
22446999-A-CDYZ19***
22446990-G-TDYZ19***
22435982-A-GDYZ19***
22429804-T-GDYZ19***
22426019-A-TDYZ19***
22367425-T-GDYZ19***
22367360-T-CDYZ19***
22344460-T-ADYZ19***
22360393-A-CDYZ19***
22358189-A-GDYZ19***
22357357-G-ADYZ19***
22357342-C-ADYZ19***
22357341-A-TDYZ19***
22357336-A-TDYZ19***
22357332-G-CDYZ19***
22356965-A-TDYZ19***
22356008-T-CDYZ19***
22354410-A-GDYZ19***
22352624-G-TDYZ19***
22352453-G-TDYZ19***
22352224-A-GDYZ19***
22344581-T-ADYZ19***
22266346-A-TDYZ19***
20654173-T-GP4_Prx***
22498856-T-ADYZ19***
20886837-G-AP4_Dst***
21747853-C-T***
20654186-C-GP4_Prx***
21700612-A-GY***
21700610-A-CY***
20654189-A-GP4_Prx***
21671987-A-G***
21629547-A-CY***
21569953-G-ASK2225Y***
21555488-C-AY***
21515781-T-GY***
20809663-G-TP4_Gap***
21503170-T-GY***
21381604-C-A***
21163096-C-AY***
22056571-C-A***
21132671-A-TY***
20869021-G-TP4_Dst21×T***
21118830-C-A***
21021584-A-TP4_Dst***
20998050-G-AP4_Dst***
20869223-C-TP4_Dst***
20984183-T-CP4_Dst***
20982336-T-AP4_Dst***
20953622-C-AP4_Dst***
20950886-C-TP4_Dst***
20943352-C-TP4_Dst***
20932604-G-TP4_Dst***
20914457-C-AP4_Dst***
20913280-G-AP4_Dst***
21852250-C-A***
20654183-A-GP4_Prx***
22266197-T-ADYZ19***
22244992-G-ADYZ19***
22258577-G-TDYZ19***
22258575-G-ADYZ19***
22258386-C-TDYZ19***
22257962-C-TDYZ19***
22256904-A-TDYZ19***
22256903-C-ADYZ19***
22256902-A-TDYZ19***
22256901-T-GDYZ19***
22256899-G-ADYZ19***
22245001-C-GDYZ19***
22244995-T-CDYZ19***
22244994-G-TDYZ19***
22244993-A-TDYZ19***
22244991-A-CDYZ19***
22169193-C-A***
22244990-C-TDYZ19***
22244989-C-ADYZ19***
22244988-T-CDYZ19***
22244986-T-ADYZ19***
22237304-T-CDYZ19***
22237303-C-TDYZ19***
22237302-T-CDYZ19***
22237301-C-ADYZ19***
22237298-A-CDYZ19***
22236337-T-CDYZ19***
22234754-A-TDYZ19***
22234735-T-GDYZ19***
22219444-A-GDYZ19***
22171734-G-T***
22496236-T-GDYZ19***
22498994-T-GDYZ19***
24762178-A-CP3_b2***
24154198-G-AP3_b1***
24242256-C-AP3_b1***
20340221-G-TP5_Dst***
20340226-A-TP5_Dst***
24235489-G-AP3_b1***
24235355-C-AP3_b1***
24157167-A-TP3_b1***
24157164-G-TP3_b1***
24157163-T-CP3_b1***
24157143-G-AP3_b1***
24157142-T-CP3_b1***
24154361-T-CP3_b1***
24154200-A-GP3_b1***
20340233-A-TP5_Dst***
24154197-T-CP3_b1***
24404165-G-T***
24143607-A-CP3_b1***
24133088-T-GP3_b1***
24084262-A-CP3_b1***
24084253-A-CP3_b1***
20348861-T-CP5_Dst***
24083893-C-AP3_b1***
24074107-A-TP3_b1***
24067362-G-AP3_b1***
24067360-A-CP3_b1***
24067327-G-TP3_b1***
20886835-G-AP4_Dst***
24043800-T-G***
24043790-C-T***
24043784-T-G***
24389468-T-A***
24420999-C-TY***
24036051-C-G***
24643276-T-CP3_t2***
24759894-G-AP3_b2***
20869292-C-AP4_Dst***
24750785-G-AP3_b2***
24728605-T-AP3_b2***
24728349-A-TP3_b2***
24720971-A-CP3_b2***
24720891-A-TP3_b2***
24673122-G-TP3_b2***
24670676-G-TP3_b2***
24664972-T-CP3_b2***
24659990-C-TP3_b2***
24654603-C-AP3_b2***
24650780-C-TP3_b2***
24643226-C-GP3_t2***
24421003-C-TY***
24636335-G-TP3_t2***
24604260-C-AP3_t2***
24602207-C-TP3_t2***
24602203-G-TP3_t2***
24602200-C-TP3_t2***
24602185-G-TP3_t2***
24595520-C-TP3_t2***
24582240-A-TP3_t2***
24579084-T-CP3_t2***
24575793-A-GP3_t2***
24571149-A-TP3_t2***
24535817-A-CP3_t2***
28086188-C-AP1_Y2***
20340126-C-TP5_Dst***
24040663-T-C***
24034873-G-A***
22499006-T-GDYZ19***
22962059-C-TY***
23415301-T-AY***
23415300-G-CY***
23360729-C-AY***
23204609-C-G***
20648947-T-CP4_Prx***
20648948-G-TP4_Prx***
23181518-T-A***
23100061-C-AY***
23066481-C-A***
23034416-A-CY***
23007487-G-T***
22995222-A-GY***
20654151-A-GP4_Prx***
22816365-T-GY***
23415303-T-GY***
20654154-C-GP4_Prx***
20654155-T-GP4_Prx***
22644673-C-A***
22511612-A-GDYZ19***
22508729-G-ADYZ19***
22508727-A-TDYZ19***
22508725-A-TDYZ19***
22508724-C-TDYZ19***
22508723-T-GDYZ19***
22508722-T-ADYZ19***
22508721-C-ADYZ19***
22508720-T-ADYZ19***
22502551-G-TDYZ19***
22502517-G-CDYZ19***
23415302-A-TY***
23415305-T-AY***
24032472-T-A***
23848581-G-TY***
24027977-G-C***
24024757-A-T***
24023431-G-A***
24023430-A-G***
20390252-G-TP5_Dst***
24023429-C-T***
24023390-G-T***
20415456-T-CP5_Dst***
24021405-T-G***
24021403-G-A***
24021384-G-T***
23901140-T-C***
23901133-A-G***
23901132-C-T***
20428440-G-TP5_Dst***
23415308-G-TY***
23822663-T-AY***
20439934-C-TP5_Dst***
20470288-C-AP5_Dst***
23696313-A-C***
23514293-C-TY***
20481135-G-AP5_Dst***
23514124-A-GY***
23475644-T-CY***
23439948-C-GY***
23415312-G-CY15×TA***
20488019-G-TP5_Dst***
23415311-T-CY***
20501116-A-TP5_Dst***
23415309-T-AY***
24754852-T-AP3_b2***
28117340-C-TP1_b4***
28086193-G-AP1_Y2***
22237286-TATA-CATCDYZ19***
22829644-CAAAAAA-C18×A***
22502545-ATAC-TTAGDYZ19***
22502526-TTT-AAGDYZ19***
22493046-TTT-CTCDYZ19***
22493033-TGAAA-AGAAGDYZ19***
22492913-CTGCCGAC-GTGCAGAADYZ19***
22446106-AC-CTDYZ19***
22431696-AA-CCDYZ19***
22358694-TTT-AAGDYZ19***
22337543-TTAC-CAGTDYZ19***
22281897-CT-TCDYZ19***
22273589-GAT-AGADYZ19***
22273575-TTACAATCCTTA-GTTACAGCACTTDYZ19***
22256889-TACGG-GTTCCDYZ19***
22235090-CAAG-AAGCDYZ19***
23678682-G-GT14×T***
20970352-C-CAAP4_Dst12×A***
20881862-C-CAP4_Dst16×A***
20886819-CACAGGCT-AAAAAAAAP4_Dst***
20920178-C-CAAP4_Dst14×A***
20932612-GAA-GP4_Dst17×A***
20949799-AAAG-GCACP4_Dst***
20949941-TTGATG-CTGACAP4_Dst***
21015059-AAG-AP4_Dst9×AG***
22235088-TA-ACDYZ19***
21022787-G-GAP4_Dst11×A***
21025133-TA-TP4_Dst***
21149582-G-TT27×T***
21306618-G-AA***
21306622-GAAAG-AAAAA***
21402212-TTTTA-T***
23415293-TATATATGTATGTATGT-GTAAGGTCATGGAATTA***
23723544-CATATATAT-C27×AT***
20755571-CTT-CP4_Prx15×T***
24646583-GT-GP3_b221×T***
24907802-AAT-Ag1***
24895705-AG-TTg1***
24825568-CT-CP3_b215×T***
24795027-G-GAP3_b29×A***
24794478-AGGGT-GGGGGP3_b2***
24794470-ACC-CCGP3_b2***
24794449-AGGT-GGGGP3_b2***
24792990-ACT-CCCP3_b2***
24789179-CA-CP3_b28×A***
24773659-AT-AP3_b29×T***
24700953-AAAGACAC-AP3_b2***
24693328-GA-GP3_b2***
24678599-A-ATP3_b2***
24670716-CT-CP3_b2***
24607334-G-TTP3_t2***
24016986-C-CT15×T***
24283360-G-AAP3_t1***
24027307-G-GA12×A***
24043029-CGGGAGGGGTCTGGTGTCTGGGTCAGGTTGAGGTACCCCTGGGACCCG-C***
24084207-A-CCP3_b1***
24115164-CCA-CP3_b123×CA***
24235359-TC-AAP3_b1***
24280901-AG-AP3_t1***
24323664-T-TAP3_t114×A***
24597813-CTT-CP3_t222×T***
24432837-CAA-C17×A***
24541332-TA-TP3_t28×A***
24560975-T-TAP3_t210×A***
24568394-AAT-AP3_t28×AT***
24575876-CTTT-CP3_t224×T***
24577878-CA-CP3_t225×A***
20757350-CCTGTGATTTACA-TTTTTTTTTTTP4_Prx***
20530282-CA-CP5_Dst***
25251571-G-AAP2_r1***
14926462-CA-C26×A***
17994869-C-AAAP7_Prx***
17872639-CTTTTT-C17×T***
17564912-GAAAAA-G16×A***
17474932-ATT-A12×T***
17459485-CAAAAA-C25×A***
16860774-G-AA9×A***
16595919-CTTTTTT-C17×T***
16297330-GTT-G26×T***
16250624-G-TT28×T***
16157792-AACTTTCCAATGACGTTCTTAGAGCAACT-GAAGGAAAGAAAGAAAGAAAAGGGTGTTGP8_Dst***
16148997-TA-TP8_Dst10×A***
16147477-TA-TP8_Dst14×A***
15866310-AAG-A***
15252823-C-AAA***
14875586-CTTTGTG-TTTTTT***
18035663-GAC-TTTT***
13885857-CTTTT-C19×T***
13740606-TGATATCGAAAGGAAGGGAA-AATGGATTTGAACAGAT***
13801113-C-CGAATGGAATGGACTCGAATGGAATGTGCTCGAATG12×GAATG***
13801174-AACTCGAATGG-GAATTGAACCA***
13801189-GATTCGAATG-TAATGGACTT***
13856642-AA-GG***
13859837-ATCGAAAGG-GTGGACACA***
13962037-CTTTCC-TTTTTT***
14743154-CAAAAAA-C19×A***
14324894-CT-C26×T***
14339089-GTTTC-TTTTT***
14491211-T-TGGTA***
14491261-AA-GT***
14491276-CGCACACTTTTAAACAA-AGCCTGTTCTTCATGTT***
14559665-GA-G10×A***
18017150-TAT-C***
18430094-CA-CP6_Dst28×A***
20492878-T-TCP5_Dst9×C***
20366225-AT-AP5_Dst8×T***
20203507-A-ATGTTGTP5_Dst10×TGT***
20245100-TA-TP5_Dst9×A***
20247747-C-CAP5_Dst10×A***
20256948-TA-TP5_Dst12×A***
20280154-TCTTC-TP5_Dst8×CTTC***
20326007-C-TTP5_Dst29×T***
20386768-G-GAAAP5_Dst15×A***
20107299-G-AAP5_Dst24×A***
20390195-GA-GP5_Dst***
20430442-CAA-CP5_Dst22×A***
20438758-AT-AP5_Dst23×T***
20439958-G-GTP5_Dst16×T***
20479819-AT-AP5_Dst14×T***
20481197-A-ATP5_Dst9×T***
20116698-T-TCP5_Dst10×C***
20086349-T-TAP5_Dst10×A***
18447621-G-TTTP6_Dst18×T***
19668814-AAT-AP5_Prx***
18448945-GT-GP6_Dst***
18465467-CAG-AAAAP6_Dst***
18487808-TAA-TP6_Dst19×A***
18615932-C-CTT27×T***
19206769-AAG-A***
19647571-CTTTT-CP5_Prx16×T***
19695161-C-CTP5_Prx18×T***
20063941-TAAAAA-TP5_Gap18×A***
19713343-G-GTP5_Prx11×T***
19775301-TC-TP5_Prx***
19809172-AT-AP5_Prx10×T***
19829294-ACTTTC-TTTTTTP5_Prx***
19892868-G-TTP5_Prx31×T***
19930476-CTT-CP5_Prx22×T***
25165673-TC-Tg1***
25287593-GA-GP2_r1***
13732560-TC-AG***
58834672-TA-T***
58844535-TCAC-CCAT***
58842185-ATTCTGTTCT-TTTCCATGCC***
58842174-GATTT-AATTC***
58842149-CTTTCT-C***
58841874-CTTCCATTCGATTCCT-C***
58840730-GCATACAATTTCACTCCATTCGTTCCC-TGCATTTTTTCCGTTCAATTACATTCG***
58838736-TTTGCC-ATTCCA***
58838722-ATAG-TTCC***
58838705-CATTACAG-GATTCGAT***
58838687-ATCCCT-TTTCAG***
58838641-ATTCGAATCCTTTCT-TTTCAAGTCCATTCC***
58837915-TCCATTTGATGCCATC-T***
58835765-GGCATTCCATTCCATTCCA-TGCATTCCATTCCT***
58835237-AT-A***
58830540-ATTCCATTGGATTACT-A***
58846098-AT-CC***
58821900-ACCT-TCAA***
28542416-CAA-C17×A***
28802672-TGGAT-AGGAG***
58819449-TTC-ATTCCATT***
58820494-GCATTCGTGTCCGTTCTATTCGAG-CCACTCGAATCCACTCCATTACAC***
58820525-CATTACAGTCT-C***
58820557-GTTG-TTCC***
58821911-GCAGTCTT-CCATTACA***
58830157-CCCATTCCATTCAATT-C***
58821923-CTTCGAG-AATCCAT***
58821938-GTTCG-ATTCC***
58821948-ATTCCG-TTTCCA***
58822051-G-GCATTCCATTCCGTGGGTGTC***
58824560-CTTC-ATTA***
58824882-TC-T***
58846063-G-ACATTC***
58857035-CTCCACA-TTCAATC***
28406839-C-CAP1_gr216×A***
58994544-ACGG-GCGA***
58914155-CTG-TTC***
58979305-CTCCAT-C***
58983167-C-CCACTA***
58989444-GGTGCTTTGTGACATATCCCTGCAATGATCACCCAGATGATGT-TGGCGTTTTGACATAGCTCTGCACAGATCACCTAGGTTATGTA***
58990390-GA-TT***
58990399-CATTTTAACT-TATTGTGAGA***
58994573-GGG-TGA***
58912402-ACTA-CAAT***
58994624-ATAAG-GTAAC***
18039365-AAT-A***
19979863-GCT-GP5_Prx***
20510960-GAT-GP5_Dst***
24686426-TAC-TP3_b2***
27412863-ATATG-AP1_g3***
58912415-TACCATTCCAT-CTCCACTCCTC***
58908953-CTG-TCC***
58865958-GAG-CAT***
58886881-GGAGTCA-CGATTCC***
58865999-TA-AT***
58866431-TCCATTTGATGCCATC-T***
58873268-CTCTATC-TTCCATT***
58874918-CTCC-TTCA***
58883875-TTCCAT-C***
58885021-TGTTCT-CATTCC***
58886893-TTT-ATA***
58908939-ACATTCTACTCTA-CCGTTCCATTAGT***
58890943-GTCCATTTCACACCAG-CTACAGTCCACTCCTC***
58890964-TACTA-AACAC***
58890973-TTCCATA-CTCCACT***
58890983-TTCCATCCCAC-CTCTAA***
58908829-CCATACCAT-TGGGTTGAA***
58908924-GCACTCC-AGGATTG***
28438188-CAAAA-CP1_gr231×A***
28257584-C-GAGP1_b418×AG***
25306190-GA-GP2_r1***
26124489-GAAAGAAGAAAT-AAAAAAAAAAAAP1_Y1***
27151159-ATT-AP1_g39×T***
27149714-TAA-TP1_g316×A***
27129771-CA-CP1_g325×A***
27049850-ATT-AP1_r417×T***
27039067-TA-TP1_r4***
27035479-CCT-TCP1_r4***
27030714-CTT-CP1_r413×T***
27008910-TA-TP1_r4***
27004222-CT-CP1_r425×T***
26997289-CT-CP1_r423×T***
26914079-AC-TP1_r3***
26563185-TACAC-TP1_g215×AC***
26514950-TAC-TP1_Y110×AC***
26170521-GGAAGAG-AGAAP1_Y1***
26098021-AAAG-AP1_Y1***
27290770-C-CTP1_g311×T***
25520340-CTT-CP1_gr116×T***
25431783-AT-AP2_r28×T***
25432611-CAAAAAA-CP2_r226×A***
25439195-C-CAP2_r222×A***
25447251-TGTA-TP2_r2***
25452458-G-GTTP2_r213×T***
25456551-GATATAT-GP2_r220×AT***
25536618-TA-TP1_gr113×A***
26089081-AG-AP1_Y1***
25677117-CTG-CP1_b3***
25717179-C-CAP1_b315×A***
25717443-GAAAG-AAAAAP1_b3***
25858419-G-AAP1_Y1***
25940445-CT-CP1_Y117×T***
25964919-G-TTP1_Y1***
27151328-TGTA-TP1_g3***
27319772-CT-CP1_g38×T***
28253556-GAAGCT-AAAAAAP1_b4***
27971754-C-AAP1_Y2***
27918818-GA-GP1_Y211×A***
27943970-CCA-CP1_Y214×CA***
27947646-C-CAP1_Y28×A***
27960966-TAA-TP1_Y218×A***
27963480-CA-CP1_Y211×A***
27968354-C-CTTP1_Y214×T***
27996127-G-GAAP1_Y214×A***
27873319-CTTTCC-TTTTTTTP1_Y2***
28027423-AT-AP1_Y210×T***
28030733-T-TTTCGP1_Y2***
28033129-C-CAP1_Y217×A***
28044809-CA-CP1_Y2***
28203963-ACCTA-CCCTTP1_b4***
28242000-GT-GP1_b49×T***
27889318-AAC-AP1_Y214×AC***
27847931-GT-GP1_Y211×T***
27398534-G-AAP1_g3***
27745674-TA-TP1_Y212×A***
27583000-CTTTTT-CP1_Y222×T***
27585914-AGTC-TTP1_Y2***
27618169-C-CTP1_Y214×T***
27644243-CA-CP1_Y210×A***
27711690-C-CTP1_Y217×T***
27733713-CAA-CP1_Y226×A***
27772643-TA-TP1_Y221×A***
27844422-ACCCA-CCCCCP1_Y2***
27774223-CT-CP1_Y2***
27777759-G-GAP1_Y219×A***
27801225-G-GAP1_Y213×A***
27809490-CAGAC-TAGATP1_Y2***
27809534-GCTAT-ACAAAP1_Y2***
27819786-ATT-AP1_Y213×T***
13734783-TTC-CTG***
13732202-T-TATGGA***
28086203-T-AP1_Y2***
28802668-G-T***
28802688-G-T***
28802688-G-A***
28802687-T-A***
28802686-C-G***
28802686-C-A***
28802683-A-T***
28802682-T-A***
28802679-G-C***
28802678-G-T***
28802677-T-A***
28802676-T-A***
28802674-G-C***
28802673-G-T***
28802670-T-A***
28802666-G-A***
28802690-A-G***
28802569-T-C***
28797848-C-G***
28797849-T-A***
28797851-T-C***
28797852-G-C***
28797855-G-A***
28802565-G-A***
28802571-A-G***
28802606-C-G***
28802573-T-G***
28802575-A-T***
28802576-A-T***
28802578-T-G***
28802581-A-G***
28802586-G-T***
28802689-C-G***
28802691-T-A***
28797840-T-A***
58830564-G-C***
58820515-G-C***
58823808-C-T***
58823823-T-A***
58824578-A-T***
58825007-C-T***
58827389-T-G***
58830565-A-T***
58819703-C-G***
58835191-C-G***
58835705-C-T***
58838730-C-T***
58838753-T-A***
58838756-A-G***
58838757-T-A***
58819708-C-G***
28814654-G-A***
28802691-T-G***
28802703-G-T***
28802692-T-A***
28802693-G-A***
28802694-T-A***
28802696-G-A***
28802698-G-A***
28802701-T-A***
28802706-G-A***
28806574-G-C***
28802713-G-C***
28802716-G-A***
28802721-G-A***
28802723-G-C***
28802733-G-C***
28802734-G-A***
28797846-C-T***
28797838-G-A***
58840766-A-G***
28117358-C-TP1_b4***
28245687-C-GP1_b4***
28214125-G-CP1_b4***
28206475-C-TP1_b4***
28160784-C-TP1_b4***
28160781-G-TP1_b4***
28157402-A-GP1_b4***
28157390-A-GP1_b4***
28157385-C-AP1_b4***
28149467-T-AP1_b4***
28136374-T-AP1_b4***
28117365-C-TP1_b4***
28117363-C-TP1_b4***
28117362-G-TP1_b4***
28117360-C-TP1_b4***
28117357-G-TP1_b4***
28253618-G-AP1_b4***
28117336-G-TP1_b4***
28117322-G-TP1_b4***
28117323-A-TP1_b4***
28117324-A-TP1_b4***
28117325-G-TP1_b4***
28117326-G-TP1_b4***
28117334-G-TP1_b4***
28117338-C-TP1_b4***
28117355-C-TP1_b4***
19765775-C-TP5_Prx***
28117342-A-TP1_b4***
28117344-C-TP1_b4***
28117350-C-TP1_b4***
28117351-C-TP1_b4***
28117352-G-TP1_b4***
28253600-T-AP1_b4***
28507551-C-A***
28797837-G-C***
28797820-T-A***
28797813-G-C***
28797814-A-T***
28797816-T-A***
28797817-G-T***
28797818-T-A***
28797819-T-G***
28797821-T-A***
28797811-T-A***
28797822-A-T***
28797824-A-G***
28797825-G-A***
28797826-T-A***
28797834-G-A***
28797835-G-A***
28797812-G-T***
28797498-G-A***
28529465-C-A***
28793712-A-G***
28550108-G-T***
28614952-C-A***
28771834-G-A***
28773841-C-A***
28777762-C-A***
28793645-G-A***
28794290-G-A***
28794335-C-A***
28794292-G-A***
28794293-G-C***
28794295-T-A***
28794301-T-A***
28794302-G-C***
28794333-G-A***
58840761-C-G***
58841719-T-C***
13732202-T-AATGGA***
6403210-CTTAG-GTTTT***
9930171-GCTAG-TCTTA***
9654389-A-AGAAGIR3_Prx***
9623645-T-TAIR3_Prx11×A***
9589945-C-CTIR3_Prx10×T***
9345036-AAGGC-GGGGG***
9345025-CTTGGGCA-GGGGGGGGGG***
9307398-TTGTGTGTG-T15×TG***
9304418-CTCGGAGGAGGCTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGGGGGGGGGGGGGG***
9215556-CAGGGAAGGC-GGGGGGGGGG***
8786746-ACCA-CCCC***
7867929-A-AAAG***
7405015-AGAT-A***
7165273-CTG-TTT***
6734680-CTTTTT-C21×T***
6403097-GTA-ATC***
9943885-ATTA-TTTT***
3544896-G-GA***
20723982-AT-AP4_Prx14×T***
16340170-C-AA***
9531231-GGT-GIR3_Prx10×GT***
27761295-GA-GP1_Y215×A***
24601759-G-GTP3_t211×T***
26556114-C-CAP1_g210×A***
4358621-TTCTAACTTGAACATACACACTCCCACATAC-CCCCGAAACCCATCTCACTCACATACATACAT***
6323750-CA-CIR3_Dst12×A***
4358656-CTGTGCATGCACACAC-ACGTACATACATAGAT***
4358676-CACACAC-ACACACA***
4521612-TAA-T17×A***
6210549-C-CTIR3_Dst14×T***
6226043-T-TCTTCIR3_Dst***
6226088-T-TTTCCIR3_Dst***
9930212-TGAAGACACCTGCGACCTCAGGAACG-ACACCCCGGGACGGCAGGAAACCTAC***
9945412-CAC-AAT***
10048872-CA-TG***
13486740-CATT-TATC***
13460808-AAGC-GAGT***
13460851-TTCCC-ATCCG***
13461010-AAGT-GAGA***
13461127-ACTA-CCTG***
13461325-CAAG-TAAAT***
13461354-GAG-CTT***
13489616-C-CCCCGT***
13423948-AGT-GGG***
13729318-TAA-GG***
13729613-GGG-TGC***
13729781-TG-AC***
13729958-TCAAGTGGAA-AGGAGCAGAG***
13731966-CCAA-TGAC***
13732034-ACA-TTT***
13452873-GCATTCCATTCCATTCCATTCCATTC-G14×CATTC***
13329549-ACT-GCA***
9951900-GAATA-CAATG***
13140098-AGA-TCC***
9952707-GTCTC-ATCTG***
9952735-AGTTA-GGGCG***
10014734-AATGT-TATGC***
10086310-TC-GA***
10086339-TAT-AAA***
10102809-AG-A***
13140601-AA-TC***
13320303-TAAAA-GAAAG***
13143462-TAAT-CCAC***
13143473-AAT-CAC***
13193995-TCCCAT-CTCCAC***
13287377-TT-CG***
13301231-TAA-CAG***
13301284-CA-TG***
28065155-C-CTP1_Y215×T***
20950918-G-GAP4_Dst9×A***
58841804-A-T***
58865916-A-T***
58886785-A-T***
58885073-G-C***
58885070-G-C***
58885058-A-T***
58884850-A-C***
58884325-T-G***
58884284-G-A***
58883595-T-A***
58875148-C-T***
58874945-G-C***
58873114-C-T***
58873113-G-T***
58866285-T-C***
58865957-T-C***
58865915-G-T***
58886899-C-T***
58842939-C-A***
58842867-G-T***
58842879-C-G***
58842931-T-A***
58842935-G-T***
58842936-T-A***
58842938-T-A***
58842940-G-C***
58857123-A-G***
58846029-C-T***
58857040-C-T***
58857041-A-C***
58857060-T-A***
58857062-G-C***
58857072-C-T***
58886897-G-T***
58912410-T-C***
10067427-AC-CA***
27509349-G-GAP1_Y212×A***
27692068-GA-GP1_Y215×A***
18492480-GA-GP6_Dst17×A***
19790172-GA-GP5_Prx15×A***
23807600-G-AA***
14061366-AT-A17×T***
22341286-GATGAAGCTGCA-AAAGAATGAAGCDYZ19***
26713801-CA-CP1_g218×A***
26890135-GAT-GP1_r320×AT***
19121920-CT-C17×T***
9636618-TTG-TIR3_Prx13×TG***
27881475-C-CTP1_Y212×T***
27311977-C-CAP1_g316×A***
9557583-C-CAIR3_Prx11×A***
27222206-GA-GP1_g316×A***
9622370-TTG-TIR3_Prx***
22263725-AT-TCDYZ19***
58912944-T-A***
58988285-G-A***
58914128-G-C***
58914129-C-A***
58914492-A-C***
58984994-T-C***
58984997-C-T***
58985828-G-T***
58990413-A-T***
20815408-CATAT-CP4_Gap22×AT***
58991655-C-A***
58994612-T-C***
58995897-G-T***
59022265-T-A***
59022271-C-A50×A***
13460876-AGG-GAT***
19783687-C-AP5_Prx***
19577837-C-GP5_Prx***
19744955-G-TP5_Prx***
5170209-C-A***
6148266-T-GIR3_Dst***
6146508-T-AIR3_Dst***
6140561-A-TIR3_Dst***
6134448-A-G***
6134445-C-G***
5937210-C-A***
5937209-T-C***
5860975-C-A***
5774865-A-G***
5293993-T-C***
5274773-C-A***
5267517-T-A***
5267513-T-A***
5186768-G-T***
5059718-A-C***
6232708-C-AIR3_Dst***
4123548-C-A***
2979296-C-T15×T***
3115899-C-A***
3164984-G-T***
3559887-C-A***
3705166-C-A***
4062509-C-A***
4271257-C-A***
5000599-C-A***
4472320-C-A***
4504681-T-A***
4554469-T-C***
4554470-G-T***
4554471-A-G***
4769384-C-A***
6149780-G-TIR3_Dst***
6258554-G-TIR3_Dst***
2979275-C-T***
7149453-G-A***
7753232-C-AY***
7608481-T-CY***
7473196-T-CIR1_L***
7414129-T-AY***
7371972-C-A***
7362171-C-AY***
7338459-A-G***
7321848-C-AY***
7320375-G-AY***
7313384-C-A***
7312633-G-AY***
7310543-C-AY***
7303498-G-A***
7199423-C-AY***
7127413-C-AY***
6280379-C-AIR3_Dst***
6593504-C-A***
6341165-C-TIR3_Dst***
6377005-C-A***
6377072-C-A***
6382210-C-T***
6398215-C-A***
6592372-C-A***
6648166-G-TY***
6977442-C-AY***
6648538-C-AY***
6709332-C-A***
6756906-C-T***
6808157-G-AY***
6901284-A-G***
6903588-C-AY***
2979281-C-T***
2845202-G-AY***
8085601-T-CY***
13268004-A-T***
22234331-TCTATCAGT-CCACCGTADYZ19***
28025169-GA-GP1_Y211×A***
58992739-G-A***
28802712-A-T***
28797847-T-C***
22238337-A-GDYZ19***
19510294-A-TY***
18184647-G-T***
17203349-C-TY***
14413234-C-AY***
14267133-C-AZ24295***
13446330-G-T***
13445157-C-G***
13435833-A-G***
10068256-T-G***
13486729-C-G***
24794491-A-GP3_b2***
6359640-TAAA-T22×A***
9202348-TGGT-GGGG***
13744426-GGAAC-AGAAT***
19510292-GTA-TTT***
58914170-C-T***
22346982-A-CDYZ19***
26505318-T-GP1_Y1***
10048961-T-C***
22229643-AGGAA-TGGAGDYZ19***
26730212-A-GP1_g2***
7044413-G-TZ14994***
9939797-AT-A***
9945172-A-G***
10014639-T-C***
9945123-A-G***
13287270-T-A***
2845201-A-GY***
58994560-C-G***
2845200-C-TY***
2845197-G-AY***
2719068-T-GY***
2697578-C-AY***
2649734-C-G***
2649728-G-C***
2649725-C-A***
27546172-G-AP1_Y2***
13460839-T-A***
9952739-A-G***
22316744-G-TDYZ19***
14491261-A-GY***
14491260-C-AY***
22349092-A-TDYZ19***
58986090-G-T***
13287275-C-G***
58994554-G-C***
13287206-G-T***
9957802-T-C***
13287263-C-A***
2979289-G-T***
22263743-G-TDYZ19***
22311536-A-GDYZ19***
58994580-A-G***
13193978-T-C***
13143263-A-T***
58994586-T-A***
13460770-A-G***
13143264-T-C***
58992849-C-T***
14491270-A-GY***
7886240-C-TY***
8181216-G-AY***
27398234-T-AP1_g3***
9344809-C-T***
9344831-G-T***
9344828-T-C***
9344826-C-T***
9344822-A-C***
9344821-T-A***
9344820-G-C***
9344819-T-C***
9344817-G-A***
9344816-T-C***
9344815-C-A***
9344814-T-A***
9344813-A-C***
9344811-G-T***
9344810-T-G***
9344808-T-G***
9344833-A-C***
9344796-C-A***
9344789-C-T***
9344790-A-C***
9344792-C-A***
9344793-A-T***
9344794-A-C***
9344795-C-T***
9344797-A-T***
9344807-C-T***
9344798-G-A***
9344801-A-C***
9344802-G-T***
9344803-A-C***
9344804-G-A***
9344806-T-A***
9344832-T-C***
9344834-C-A***
9344787-C-G***
9345521-T-C***
9628537-G-TIR3_Prx***
9626973-A-TIR3_Prx***
9615410-C-TIR3_Prx***
9583288-T-CIR3_Prx***
9540319-C-AIR3_Prx***
9529047-C-G***
9384551-A-G***
9384549-C-G***
9365790-C-G***
9365346-C-G***
9365337-A-G***
9365316-A-G***
9345531-A-G***
9345525-C-G***
9345516-G-T***
9344835-C-A***
9344844-G-C***
9344836-A-T***
9344837-T-A***
9344839-T-A***
9344840-A-T***
9344841-C-T***
9344842-C-T***
9344845-G-C***
9345513-C-G***
9345022-A-G***
9345505-A-C***
9345506-G-A***
9345508-C-G***
9345510-G-C***
9345512-G-T***
9344788-C-T***
9344786-C-T***
8181259-G-TY***
8732304-G-T***
9186041-T-G***
9127497-G-TY***
9063520-C-AY***
9025409-C-AY***
9013235-G-CY***
8856145-C-A***
8786800-T-GY***
8786789-C-AY***
8786771-A-CY***
8739092-A-GY***
8739084-A-CY***
8739078-C-GY***
8739046-T-CY***
8739045-G-CY***
8408450-A-TY***
9216110-G-C***
8181272-T-CY***
8181260-A-TY***
8181262-C-TY***
8181264-C-TY***
8181265-G-TY***
8181267-C-AY***
8181268-T-CY***
8181273-G-CY***
8293355-C-AY***
8181277-G-CY***
8181279-T-CY***
8181282-G-CY***
8181285-T-CY***
8181288-C-GY***
8181295-A-CY***
9216018-T-C***
9216150-C-G***
9344785-G-A***
9296031-A-G***
9344784-A-G***
9344783-T-G***
9344782-C-G***
9344781-C-A***
9344779-G-C***
9344778-C-T***
9336340-A-G***
9325220-A-C***
9325218-A-G***
9304887-C-G***
9304881-A-C***
9296035-T-C***
9296033-A-G***
9296032-G-T***
9296030-C-T***
9216151-G-C***
9296006-A-G***
9217171-A-G***
9224946-A-C***
9230363-A-C***
9236257-A-G***
9295048-T-C***
9296005-C-G***
9296007-G-C***
9296020-A-G***
9296008-A-G***
9296011-T-G***
9296012-T-G***
9296013-G-T***
9296015-A-G***
9296016-T-C***
28136379-C-AP1_b4***
26997351-G-TP1_r4***
9637196-C-TIR3_Prx***
9345055-C-G***
22236796-TCAAGAGCCTC-GGAACAAACTADYZ19***
22501912-T-CDYZ19***
22226464-A-TDYZ19***
27776111-GA-GP1_Y29×A***
26873983-C-CTP1_r323×T***
26130114-CA-CP1_Y117×A***
24618868-CT-CP3_t212×T***
19743718-C-CAP5_Prx13×A***
9626124-CA-CIR3_Prx12×A***
16136069-AT-AP8_Dst15×T***
17994811-G-AP7_Prx***
16162122-G-AP8_Dst***
9952050-T-G***
22344592-A-CDYZ19***
22344617-G-CDYZ19***
58995224-G-T***
59007968-A-C***
58982800-G-C***
27809502-T-AP1_Y2***
13449515-TCC-T***
27809505-C-TP1_Y2***
27809543-G-AP1_Y2***
18012134-A-ATP7_Dst11×T***
59007972-A-C***
24552048-T-CP3_t2***
59007976-A-C***
58857090-T-G***
25709386-G-TP1_b331×T***
13725417-T-A***
13725418-C-T***
13460553-A-G***
28805796-CGT-TGG***
58857159-G-T***
58981921-T-A***
9215996-A-G***
13203921-A-G***
13203920-G-T***
13203919-T-A***
13203917-G-T***
13203916-T-A***
13203915-A-G***
13203914-G-T***
13203913-C-G***
9930211-C-G***
9930207-A-G***
9930204-A-G***
9325211-A-C***
9325205-A-G***
9215999-C-G***
9202323-C-T***
4841726-A-C***
13287288-A-T***
5393362-CGGA-C10×GGA***
6001342-T-C***
10014627-T-G***
10048759-A-G***
13268165-G-A***
13287192-A-T***
13326060-TA-T14×A***
6134451-A-G***
13543271-A-C***
17346142-C-TM9211Y18×T***
20778781-T-TTGTGP4_Prx18×TG***
22995397-TG-T***
20949802-G-CP4_Dst***
22315987-A-TDYZ19***
58981975-AT-A,AC***
58976262-T-C***
13275934-A-G***
13680945-CGAATG-T,TGAAAT***
13855239-T-A***
13854622-A-G***
13854621-C-T***
13854606-T-A***
13848278-T-A***
13847184-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAATGGAGTGGACTCA***
13838316-C-A***
13817678-C-G***
13815566-T-C***
13812988-C-A***
13810778-C-G***
13801720-G-A***
13801549-G-A***
13736432-C-T***
13680670-A-G***
13855986-C-A***
13194740-T-C***
9941268-T-TCCAG,TCTAA***
9979644-AATG-A***
13139504-T-CF10591***
13194020-C-T***
13194025-C-T***
13194736-T-A***
13194765-T-C***
13488130-C-T***
13196155-T-A***
13268904-T-C***
13449987-T-G***
13456566-T-C***
13464336-C-T***
13478524-C-T***
13855938-A-T***
13859295-A-G***
58974218-T-G***
22421036-C-TDYZ19***
58829921-T-G***
28811222-T-G***
28810144-C-A***
28810131-G-T***
28805575-A-G***
28798917-G-A***
28791773-G-GTGCAGTGGAT***
28787529-A-G***
28787341-G-A***
28785880-T-C***
25064987-A-Gg1***
23347909-CT-C10×T***
22493048-T-CDYZ19***
22430289-A-TDYZ19***
22344960-T-GDYZ19***
13859358-T-C***
13859503-T-A***
13859359-G-C***
13859375-G-T***
13859383-T-C***
13859399-G-A***
13859413-T-C***
13859414-G-T***
13864936-A-G***
22267233-C-GDYZ19******
13869980-C-A***
13869995-G-C***
13870163-A-G***
13870178-A-G***
22219966-C-TFGC4596DYZ19***
22267228-A-CDYZ19******
13203922-C-A***
13486740-C-T***
13552721-C-T***
10014645-C-CTAAT4×TAAT***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGTP6_Dst***
18501374-A-ATP6_Dst10×T***
18369645-TAC-AAAP6_Prx***
16099087-CTG-CP8_Prx23×TG***
13856627-TA-GG***
13801012-TGCAATG-AGGAATA***
13740761-GGA-CGG***
13740632-GAACTC-CGAACG***
13699416-GAAACGAATTC-TACACAAATGG***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA***
13275922-C-CA***
9571868-TTG-TIR3_Prx10×TG***
20428140-AT-AP5_Dst17×T***
28017356-C-CAP1_Y216×A***
16150948-TA-TP8_Dst22×A***
20110561-G-GAP5_Dst20×A***
28797860-G-T***
28253599-C-AP1_b4***
28253601-C-AP1_b4***
28253603-T-AP1_b4***
28253604-G-AP1_b4***
28253606-C-AP1_b4***
28253610-T-AP1_b4***
28797862-G-T***
13488987-CAGGGT-TGGGGC***
28797865-G-A***
28797868-A-G***
28797869-A-C***
28797870-G-A***
28797872-G-T***
28797875-T-A***
19727393-TA-CCP5_Prx***
20333189-C-CAP5_Dst17×A***
28253595-G-AP1_b4***
27186323-G-GAP1_g319×A***
2758620-T-AY***
58846004-G-C***
26874716-G-AP1_r3***
24794448-C-GP3_b2***
19727364-A-CP5_Prx***
14088854-C-A***
9940961-C-G***
9293361-C-T***
58823383-CTCTATC-TTCCATT***
25176848-TTC-Tg1***
58823840-TG-AT***
28180701-CA-CP1_b416×A***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAAP1_Y2***
27412214-CA-CP1_g38×A***
26907510-A-ATP1_r322×T***
20717039-C-AAP4_Prx35×A***
24736119-CA-CP3_b211×A***
20917254-CA-CP4_Dst14×A***
21006509-GAC-GP4_Dst16×AC***
22269595-TTCG-ATTADYZ19***
22505217-TG-TDYZ19***
24582837-CA-CP3_t217×A***
24684828-TAC-TP3_b215×AC***
24785778-C-CTP3_b214×T***
26900719-GA-GP1_r317×A***
25300414-CA-CP2_r18×A***
25301996-CT-CP2_r1***
25310157-AAG-AP2_r1***
25437894-T-TAP2_r212×A***
25567552-AT-AP1_gr117×T***
25675782-T-TAP1_b312×A***
28253597-T-AP1_b4***
28253594-T-AP1_b4***
13731459-T-A***
18008794-C-TP7_Dst***
22341557-G-TDYZ19***
22256897-G-ADYZ19***
22256896-A-CDYZ19***
22256895-G-TDYZ19***
20949800-A-CP4_Dst***
20949799-A-GP4_Dst***
20886833-G-AP4_Dst***
20252829-G-AP5_Dst***
20217481-A-CP5_Dst***
19727382-A-CP5_Prx***
19189522-A-CY***
18008803-C-TP7_Dst***
18008799-G-TP7_Dst***
18008796-C-TP7_Dst***
18008791-A-TP7_Dst***
22341578-G-ADYZ19***
18008754-C-TP7_Dst***
18008739-G-TP7_Dst***
18008744-G-TP7_Dst***
18008745-G-TP7_Dst***
18008746-C-TP7_Dst***
18008748-C-TP7_Dst***
18008752-C-TP7_Dst***
18008756-G-TP7_Dst***
18008789-C-TP7_Dst***
18008757-C-TP7_Dst***
18008764-C-TP7_Dst***
18008766-G-TP7_Dst***
18008781-G-TP7_Dst***
18008782-G-TP7_Dst***
18008788-G-TP7_Dst***
22341567-C-ADYZ19***
22341586-G-CDYZ19***
28253593-C-AP1_b4***
26907499-A-TP1_r3***
28253592-C-AP1_b4***
28253589-C-AP1_b4***
28253588-T-AP1_b4***
28253587-C-AP1_b4***
28253586-C-AP1_b4***
28253584-C-AP1_b4***
28253583-C-AP1_b4***
28253581-T-AP1_b4***
28253580-T-AP1_b4***
26991383-G-AP1_r4***
26991381-C-AP1_r4***
26991377-G-AP1_r4***
26991375-G-AP1_r4***
26991369-G-AP1_r4***
26098042-G-AP1_Y1***
22358798-T-GDYZ19***
26089868-G-AP1_Y1***
24084229-A-CP3_b1***
24084251-A-CP3_b1***
24216307-G-TP3_b1***
24420937-C-TY***
25165722-G-Ag1***
25207893-G-AP2_r1***
26089870-A-TP1_Y1***
26089887-C-TP1_Y1***
26089873-C-TP1_Y1***
26089876-C-TP1_Y1***
26089879-C-TP1_Y1***
26089881-G-TP1_Y1***
26089882-A-TP1_Y1***
26089884-C-TP1_Y1***
9636564-G-TIR3_Prx***
9689956-G-TIR3_Prx***
19730964-A-CP5_Prx***
17994815-C-GP7_Prx***
17994839-G-AP7_Prx***
17994837-G-AP7_Prx***
17994835-C-AP7_Prx***
17994833-G-AP7_Prx***
17994832-C-AP7_Prx***
17994830-G-AP7_Prx***
17994829-G-AP7_Prx***
17994828-T-AP7_Prx***
17994827-C-AP7_Prx***
17994826-C-AP7_Prx***
17994822-C-AP7_Prx***
17994821-T-AP7_Prx***
17994820-C-AP7_Prx***
17994818-C-AP7_Prx***
17994810-C-AP7_Prx***
18008707-A-TP7_Dst***
17843227-G-AY***
17802162-T-CY***
17843182-C-TY***
17843200-T-CY***
17843204-G-TY***
17843207-T-CY***
17843223-C-GY***
17859103-C-A***
17994809-G-AP7_Prx***
17860031-T-G***
17929813-G-T***
17944931-A-CY***
17994798-G-AP7_Prx***
17994806-A-CP7_Prx***
17994807-T-AP7_Prx***
17994841-G-AP7_Prx***
18008708-G-TP7_Dst***
17475209-G-CY***
18008749-A-TP7_Dst***
18008787-C-AP7_Dst***
18008785-C-TP7_Dst***
18008780-G-AP7_Dst***
18008777-C-AP7_Dst***
18008776-C-AP7_Dst***
18008775-C-AP7_Dst***
18008770-C-TP7_Dst***
18008767-G-AP7_Dst***
18008763-G-TP7_Dst***
18008761-C-TP7_Dst***
18008760-A-TP7_Dst***
18008759-C-GP7_Dst***
18008755-G-AP7_Dst***
18008750-A-TP7_Dst***
18008747-G-TP7_Dst***
18008710-C-TP7_Dst***
18008729-A-TP7_Dst***
18008712-G-TP7_Dst***
18008718-C-TP7_Dst***
18008719-G-TP7_Dst***
18008722-G-AP7_Dst***
18008724-C-TP7_Dst***
18008725-G-TP7_Dst***
18008730-G-TP7_Dst***
18008742-G-TP7_Dst***
18008731-G-TP7_Dst***
18008732-C-TP7_Dst***
18008734-G-TP7_Dst***
18008735-G-TP7_Dst***
18008736-A-TP7_Dst***
18008737-G-TP7_Dst***
17629653-C-AY***
17475198-C-TY***
18008801-C-TP7_Dst***
15169057-A-T***
15865989-A-TY***
15865987-A-TY***
15865986-A-TY***
15865984-G-TY***
15842861-T-CY***
15793427-T-A***
15792856-C-AY***
15764047-C-AY***
15749060-G-T***
15475254-C-AY***
15364003-T-GY***
15363994-A-GY***
15363991-C-GY***
15280405-A-GY***
15049903-A-GY***
15865993-A-TY***
14491292-A-TY***
14491282-C-TY***
14491284-T-CY***
14491287-A-CY***
14491289-A-TY***
14491290-C-GY***
14491291-A-TY***
14607525-G-T***
14990346-A-CY***
14607632-G-T***
14667815-C-AY***
14667816-T-AY***
14667817-C-AY23×A***
14926455-T-CY***
14959796-C-A***
15865990-A-TY***
15865994-G-TY***
17475195-C-TY***
16205774-C-AY***
17475193-C-TY***
17385378-C-AY***
17349339-T-AY***
17260415-C-A***
17244630-G-T***
16993533-G-T***
16897642-T-AY***
16816364-C-A***
16720239-C-A***
16704877-C-A***
16677596-C-A***
16562830-T-CY***
16480952-T-GY***
16292639-C-TY***
16181300-C-A***
15865995-A-TY***
16015686-C-A***
15865996-A-TY***
15865997-G-TY***
15865998-G-TY***
15865999-A-TY***
15866000-A-TY***
15928726-G-TY***
16016446-C-A***
16150060-G-TP8_Dst***
16044457-C-A***
16054042-C-AY***
16073050-C-A***
16147434-C-AP8_Dst***
16148322-A-TP8_Dst***
16150031-C-AP8_Dst***
18008800-C-TP7_Dst***
18158321-C-A***
14491280-C-TY***
19577790-A-TP5_Prx***
19577812-C-TP5_Prx***
19577811-T-GP5_Prx***
19577808-A-CP5_Prx***
19577806-G-TP5_Prx***
19577805-A-GP5_Prx***
19577804-A-TP5_Prx***
19577801-T-AP5_Prx***
19577799-T-CP5_Prx***
19577798-A-TP5_Prx***
19577797-C-TP5_Prx***
19577796-A-TP5_Prx***
19577794-A-CP5_Prx***
19577792-A-TP5_Prx***
19577791-A-TP5_Prx***
19577788-G-AP5_Prx***
19577814-A-GP5_Prx***
19577718-A-CP5_Prx***
19389746-T-A***
19509947-C-AY***
19577686-T-CP5_Prx***
19577696-C-TP5_Prx***
19577706-A-TP5_Prx***
19577708-A-TP5_Prx***
19577757-T-CP5_Prx***
19577786-G-AP5_Prx***
19577759-C-TP5_Prx***
19577761-C-TP5_Prx***
19577764-T-AP5_Prx***
19577774-A-GP5_Prx***
19577780-G-TP5_Prx***
19577784-G-AP5_Prx***
19577813-T-GP5_Prx***
19577815-T-AP5_Prx***
19319863-T-AY***
19695087-C-TP5_Prx***
19727554-A-CP5_Prx***
19727536-A-CP5_Prx***
19727423-T-CP5_Prx***
19727388-G-CP5_Prx***
19727387-T-CP5_Prx***
19727384-T-CP5_Prx***
19709807-C-AP5_Prx***
19709803-C-AP5_Prx***
19709801-G-AP5_Prx***
19709800-G-AP5_Prx***
19709798-T-AP5_Prx***
19709771-G-AP5_Prx***
19700555-C-TP5_Prx***
19695090-C-TP5_Prx***
19577838-T-CP5_Prx***
19577818-A-GP5_Prx***
19577826-T-CP5_Prx***
19577819-G-TP5_Prx***
19577820-T-CP5_Prx***
19577822-G-AP5_Prx***
19577823-A-GP5_Prx***
19577824-C-TP5_Prx***
19577825-C-AP5_Prx***
19577828-C-GP5_Prx***
9215557-A-G***
19577830-G-AP5_Prx***
19577831-G-TP5_Prx***
19577832-G-TP5_Prx***
19577833-A-GP5_Prx***
19577834-C-AP5_Prx***
19577835-T-AP5_Prx***
19389745-G-A***
19319862-A-CY***
18184564-G-T***
18353697-G-TP6_Prx***
18353714-T-GP6_Prx***
18353711-C-AP6_Prx***
18353710-C-AP6_Prx***
18353709-A-CP6_Prx***
18353708-G-AP6_Prx***
18353707-T-AP6_Prx***
18353706-T-AP6_Prx***
18353705-C-TP6_Prx***
18353704-T-AP6_Prx***
18353703-C-GP6_Prx***
18353702-T-GP6_Prx***
18353701-A-TP6_Prx***
18353699-C-AP6_Prx***
18353698-G-AP6_Prx***
18353696-C-GP6_Prx***
18353717-T-GP6_Prx***
18353685-A-CP6_Prx***
18186136-C-A***
18297946-G-TP6_Prx***
18353677-T-CP6_Prx***
18353679-A-CP6_Prx***
18353681-T-AP6_Prx***
18353683-A-TP6_Prx***
18353686-A-CP6_Prx***
18353695-A-GP6_Prx***
18353687-G-CP6_Prx***
18353688-T-AP6_Prx***
18353689-C-TP6_Prx***
18353690-A-CP6_Prx***
18353691-G-AP6_Prx***
18353693-A-CP6_Prx***
18353716-T-GP6_Prx***
18353719-T-GP6_Prx***
19319861-T-AY***
18747146-T-AY***
19206740-G-AY***
19206734-C-AY***
19206732-C-TY***
19189547-A-CY***
19189545-T-CY***
19189534-G-CY***
19189531-T-CY***
19189512-A-CY***
19189467-A-TY***
19189466-G-TY***
19031323-C-TY***
18856983-A-GY***
18856982-C-TY***
18780360-C-AY***
18653325-C-AY***
18353721-T-AP6_Prx***
18369623-G-AP6_Prx***
18353722-C-TP6_Prx***
18353723-T-CP6_Prx***
18353724-G-TP6_Prx***
18353725-G-AP6_Prx***
18361316-T-AP6_Prx***
18361485-C-AP6_Prx***
18462334-A-CP6_Dst***
18627476-C-A***
18467065-G-TP6_Dst***
18490226-C-AP6_Dst***
18511138-T-AP6_Dst***
18524640-A-TP6_Dst***
18530741-G-AP6_Dst***
18533071-C-AP6_Dst***
14491281-A-GY***
14491279-A-CY***
9706039-C-AIR3_Prx***
13143952-T-C***
13316695-G-A***
13253199-G-T14×T***
13253198-A-G***
13252868-C-T***
13236129-A-T***
13227907-C-A***
13203911-G-T***
13203910-C-A***
13203908-C-T***
13203907-T-A***
13193984-T-G***
13193957-T-C***
13193956-A-T***
13193955-G-C***
13143491-G-T***
13326154-T-C***
13140060-A-C***
10068852-G-A***
10068876-T-AA3766***
10102744-C-G***
10102910-T-C***
13109159-C-T***
13140055-A-C***
13140065-A-C***
13143480-A-C***
13140067-T-A***
13140070-A-C***
13140073-C-T***
13140080-G-C***
13140082-G-A***
13143257-A-C***
13326153-C-T12×T***
13329192-A-G***
10068325-G-T***
13460538-G-A***
13461369-G-A***
13461342-G-A***
13460908-T-C***
13460907-A-T***
13460885-C-T***
13460783-G-A***
13460762-A-T***
13460760-T-A***
13460748-T-A***
13460732-C-G***
13460731-T-A***
13460727-C-G***
13460632-A-T***
13460539-A-G***
13460535-C-A***
13329524-G-T***
13394929-A-T***
13331681-C-A***
13372126-A-C***
13372140-A-C***
13372148-A-G***
13394921-T-C***
13394925-T-A***
13394932-G-T***
13460526-A-G***
13446389-C-T***
13446392-T-G***
13460518-C-A***
13460522-A-G***
13460524-G-C***
13460525-C-T***
10068327-G-C***
10068286-C-T***
13478263-C-T***
9930199-A-G***
9952707-G-A***
9950938-A-C***
9950937-T-A***
9945001-C-A***
9942180-C-G***
9941271-G-C***
9940090-C-A***
9930210-C-A***
9930209-G-A***
9930208-A-T***
9930205-G-C***
9930203-C-A***
9930202-C-G***
9930201-T-A***
9930198-G-C***
9952723-C-T***
9930171-G-T***
9706166-A-CIR3_Prx***
9706175-A-CIR3_Prx***
9725007-C-TIR3_Prx***
9725048-T-GIR3_Prx***
9799324-C-AY***
9930055-A-T***
9930186-A-T***
9930197-G-C***
9930188-A-C***
9930189-A-C***
9930191-T-G***
9930193-C-G***
9930195-T-G***
9930196-G-T***
9952711-C-G***
9952735-A-G***
10068281-G-A***
10015037-A-C***
10068265-T-G***
10068261-A-T***
10068251-T-A***
10068247-G-A***
10068239-T-G***
10068232-T-A***
10068221-G-C***
10048931-T-C***
10048924-T-G***
10048797-T-G***
10048793-A-G***
10033210-G-A***
10025236-C-A***
10018264-C-A***
10015033-G-T***
9956533-C-A***
10015016-C-G***
9962287-A-G***
9990104-G-T***
10014749-A-T***
10014761-G-A***
10015013-A-G***
10015015-A-G***
10015019-A-C***
10015030-T-C***
10015021-T-C***
10015022-C-T***
10015023-T-C***
10015024-C-T***
10015025-A-C***
10015028-C-T***
13478182-C-G***
13480547-G-A***
14491276-C-AY***
14391565-G-A***
14491228-A-CY***
14491227-G-TY***
14491225-G-CY***
14491224-G-TY***
14491223-A-TY***
14491222-A-TY***
14491221-G-AY***
14491220-G-CY***
14491219-T-GY***
14491218-G-TY***
14491217-G-TY***
14491214-T-CY***
14483192-C-GY***
14391567-T-G***
14295414-C-AY***
14491230-G-AY***
13859039-C-T***
13732171-C-G***
13744820-C-G***
13745216-A-G***
13854738-A-G***
13856849-G-A***
13858825-T-A***
13908698-C-A***
14295298-A-GY***
14065508-C-AY***
14118448-C-AY***
14128409-A-TY***
14161578-A-G***
14228914-C-AY***
14283443-C-AY***
14491229-A-TY***
14491231-G-AY***
13729992-G-A***
14491256-G-AY***
14491275-C-AY***
14491274-G-AY***
14491273-A-GY***
14491272-G-TY***
14491269-G-TY***
14491268-G-TY***
14491267-G-TY***
14491266-G-TY***
14491265-A-GY***
14491264-G-TY***
14491263-G-CY***
14491262-A-TY***
14491258-A-TY***
14491257-G-CY***
14491255-A-TY***
14491235-C-TY***
14491244-C-TY***
14491236-A-CY***
14491237-G-TY***
14491238-G-TY***
14491239-A-CY***
14491240-G-AY***
14491242-C-TY***
14491245-A-GY***
14491254-C-AY***
14491246-A-TY***
14491248-C-GY***
14491249-A-TY***
14491250-G-AY***
14491251-G-CY***
14491253-G-CY***
13732155-C-T***
13725465-G-C***
13486758-T-G***
13702759-G-A***
13725395-A-T***
13725394-T-G***
13725393-A-T***
13720933-A-C***
13720907-A-G***
13720891-A-T***
13720890-C-A***
13720887-G-A***
13720883-G-A***
13720565-A-G***
13711825-A-C***
13703383-G-A***
13703377-T-A***
13703376-G-C***
13692483-T-G***
13725398-A-T***
13524079-G-T***
13489194-G-A***
13489211-A-T***
13496712-C-A***
13496731-G-C***
13523596-C-A***
13523597-T-G***
13543294-A-G***
13692482-G-T***
13552588-T-G***
13571646-A-C***
13585082-G-A***
13597057-C-A***
13689950-G-A***
13692481-A-C***
13725396-G-A***
13725399-C-G***
13725464-A-C***
13725432-A-C***
13725462-A-C***
13725460-C-G***
13725459-G-T***
13725453-T-A***
13725447-A-G***
13725446-A-T***
13725443-T-G***
13725442-A-T***
13725441-A-C***
13725440-C-G***
13725439-A-G***
13725438-T-A***
13725435-C-G***
13725434-T-G***
13725431-T-A***
13725401-G-A***
13725414-A-G***
13725403-A-T***
13725404-T-G***
13725406-G-A***
13725410-G-A***
13725411-G-A***
13725413-A-T***
13725416-G-A***
13725430-T-G***
13725419-T-C***
13725421-A-G***
13725424-T-A***
13725425-G-T***
13725426-G-C***
13725428-A-T***
9181072-CATAT-C,CAT14×AT***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin, The Russian Journal of Genetic Genealogy (Русская версия), Vol 6, No 2 (2014)/Vol 7, No 1 (2015).

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McConnaughhay1325141111-12121211121428179-1111112515183015-15-16-17111119-231716191739-39121211915-1681010810101221-231610121216812262013121113111112123515916122426191211121211913121011113012132413101022151913241713152412231810141791211



Big Tree Main Page