Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > FGC4133 > FGC4134 > BY11712 > A744

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
135550
BigY2
135550
13687777-G-T 11532101-G-T A*
28817007-C-A 26670860-C-A A*
28817678-G-T 26671531-G-T A*
28817017-G-T 26670870-G-T A*
28817689-G-T 26671542-G-T A*
13687801-G-T 11532125-G-T A*
28816623-G-T 26670476-G-T A*
28816593-G-T 26670446-G-T A*
28817717-G-T 26671570-G-T A*
28817628-G-T 26671481-G-T A*
28817624-C-A 26671477-C-A A*
28817051-C-A 26670904-C-A A*
28816968-G-T 26670821-G-T A*
13687852-G-T 11532176-G-T A*
28816618-G-T 26670471-G-T A*
28816574-G-T 26670427-G-T A*
28816573-G-T 26670426-G-T A*
28817449-G-T 26671302-G-T A*
28817693-G-T 26671546-G-T A*
28817688-G-T 26671541-G-T A*
28816584-G-T 26670437-G-T A*
13687817-G-T 11532141-G-T A*
13687802-G-T 11532126-G-T A*
28817066-C-A 26670919-C-A A*
28816644-G-T 26670497-G-T A*
28817684-G-T 26671537-G-T A*
13687811-G-T 11532135-G-T A*
28817791-C-A 26671644-C-A A*
13451044-T-C 11295368-T-C A*
13451036-C-A 11295360-C-A A*
13687227-G-T 11531551-G-T A*
13687867-G-T 11532191-G-T A*
13687914-C-A 11532238-C-A A*
13694992-G-T 11539316-G-T A*
13687796-G-T 11532120-G-T A*
28817478-C-A 26671331-C-A A*
18379826-C-T 16267946-C-T P6_Prx ***A*
13687842-G-T 11532166-G-T A*
28817073-C-A 26670926-C-A A*
28817370-G-T 26671223-G-T A*
13687742-G-T 11532066-G-T A*
28817753-G-T 26671606-G-T A*
28817488-C-A 26671341-C-A A*
28817457-C-A 26671310-C-A A*
13687831-G-T 11532155-G-T A*
13687238-G-T 11531562-G-T A*
23389855-G-A 21227969-G-A FGC43121 YY++
9307398-TTGTG-T 9469789-TTGTG-T 15×TG+
5292264-G-C 5424223-G-C FGC43118 **+
9469186-A-G 9631577-A-G FGC43119 ++
18267592-T-C 16155712-T-C FGC43120 ++
17292636-CT-C 15180756-CT-C 10×T*
28600983-ATT-A,AT 26454836-ATT-A,AT 17×T*
13449304-C-A 11293628-C-A *
15233962-G-T 13122048-G-T **
15278779-A-C 13166873-A-C **
15286586-G-T 13174685-G-T **
15260092-C-G 13148176-C-G **
15221287-T-G 13109373-T-G **
15202417-C-A 13090503-C-A **
15221212-T-C 13109298-T-C **
15215942-G-C 13104028-G-C **
15210749-C-A 13098835-C-A **
15202547-C-G 13090633-C-G **
15202452-C-A 13090538-C-A **
15202441-C-A 13090527-C-A **
15298054-C-A 13186153-C-A **
15202412-C-A 13090498-C-A **
15180254-T-G 13068340-T-G **
15180235-G-T 13068321-G-T **
15171441-T-G 13059527-T-G **
15171300-C-T 13059386-C-T **
15127863-C-T 13015950-C-T **
15127222-G-A 13015309-G-A **
15288102-G-T 13176201-G-T **
10811049-C-G **
15320623-G-T 13208729-G-T **
15655376-T-G 13543496-T-G **
15631906-T-G 13520026-T-G **
15641574-C-A 13529694-C-A **
15641599-G-T 13529719-G-T **
15647978-G-T 13536098-G-T **
15653293-C-A 13541413-C-A **
15655341-G-T 13543461-G-T **
15680083-T-G 13568203-T-G **
15622494-A-C 13510614-A-C **
15684143-G-T 13572263-G-T **
15684312-C-A 13572432-C-A **
15698674-A-C 13586794-A-C **
15699904-G-T 13588024-G-T **
15701052-T-G 13589172-T-G **
15730451-A-G 13618571-A-G **
15626516-C-A 13514636-C-A **
15604347-A-C 13492467-A-C **
15323570-G-A 13211688-G-A **
15399832-C-A 13287952-C-A **
15323588-G-A 13211706-G-A **
15334764-A-G 13222882-A-G **
15335056-A-G 13223174-A-G **
15366100-C-A 13254220-C-A **
15380421-T-G 13268541-T-G **
15399828-C-T 13287948-C-T **
15411219-C-A 13299339-C-A **
15542039-G-T 13430159-G-T **
15423982-A-C 13312102-A-C **
15452283-A-C 13340403-A-C **
15452471-T-G 13340591-T-G **
15452476-G-T 13340596-G-T **
15475343-G-T 13363463-G-T **
15498182-G-T 13386302-G-T **
15500676-G-T 13388796-G-T **
15045497-T-A 12933587-T-A **
14858889-G-T 12746955-G-T **
15045447-G-T 12933537-G-T **
14645069-T-G 12533138-T-G **
14620892-G-C 12509090-G-C **
14620894-G-T 12509092-G-T **
14638991-C-A 12527060-C-A **
14639144-C-G 12527213-C-G **
14645032-G-T 12533101-G-T **
14645062-G-T 12533131-G-T **
14687824-A-C 12575890-A-C **
14610546-TCC-T 12498748-TCC-T **
14687828-C-A 12575894-C-A **
14687840-C-T 12575906-C-T **
14687843-T-C 12575909-T-C **
14693499-T-A 12581565-T-A **
14696929-G-A 12584995-G-A **
14700904-G-T 12588970-G-T **
14711780-G-T 12599847-G-T **
14614477-C-A 12502675-C-A **
14593646-T-G 12481846-T-G **
14715410-C-A 12603477-C-A **
14556401-G-T 12444602-G-T **
14550234-G-T 12438435-G-T **
14550258-G-T 12438459-G-T **
14550269-G-T 12438470-G-T **
14550284-G-T 12438485-G-T **
14550293-T-G 12438494-T-G **
14556397-G-T 12444598-G-T **
14556436-C-A 12444637-C-A **
14593617-G-T 12481817-G-T **
14562429-C-A 12450629-C-A **
14563461-G-T 12451661-G-T **
14563468-G-T 12451668-G-T **
14563510-G-T 12451710-G-T **
14564039-G-A 12452239-G-A **
14574457-C-T 12462657-C-T **
14589445-T-G 12477645-T-G **
14715390-C-A 12603457-C-A **
14715448-C-A 12603515-C-A **
15045404-A-G 12933494-A-G **
14938168-A-C 12826243-A-C **
14815455-C-A 12703526-C-A **
14823619-A-C 12711686-A-C **
14831883-T-G 12719950-T-G **
14846830-C-A 12734896-C-A **
14858935-G-T 12747001-G-T **
14908399-A-C 12796466-A-C **
14959594-G-A 12847669-G-A **
14815409-A-C 12703480-A-C **
14981902-C-A 12869970-C-A **
14981916-C-A 12869984-C-A **
14981923-C-A 12869991-C-A **
14981953-C-A 12870021-C-A **
14981963-C-A 12870031-C-A **
14981990-T-A 12870058-T-A **
15034886-C-T 12922974-C-T **
14815443-T-C 12703514-T-C **
14806096-G-A 12694167-G-A **
14718284-C-A 12606352-C-A **
14725755-G-T 12613823-G-T **
14718307-A-C 12606375-A-C **
14718340-C-A 12606408-C-A **
14722499-C-A 12610567-C-A **
14722508-A-C 12610576-A-C **
14722553-C-A 12610621-C-A **
14725729-T-G 12613797-T-G **
14725738-G-T 12613806-G-T **
14727244-A-G 12615312-A-G **
14789427-G-A 12677498-G-A **
14738807-C-A 12626875-C-A **
14743477-C-A 12631546-C-A **
14743482-C-A 12631551-C-A **
14743532-C-A 12631601-C-A **
14769309-C-T 12657378-C-T **
14781065-A-G 12669135-A-G **
14786377-C-A 12674447-C-A **
15741632-G-T 13629752-G-T **
15893322-A-G 13781442-A-G **
15742275-C-A 13630395-C-A **
16710285-G-T 14598405-G-T **
16702932-G-T 14591052-G-T **
16702944-G-T 14591064-G-T **
16704327-A-C 14592447-A-C **
16704989-T-G 14593109-T-G **
16704991-A-G 14593111-A-G **
16704996-T-G 14593116-T-G **
16705016-A-G 14593136-A-G **
16738922-G-T 14627042-G-T **
16701830-A-G 14589950-A-G **
16743133-T-G 14631253-T-G **
16777746-C-A 14665866-C-A **
16777953-T-G 14666073-T-G **
16779110-A-C 14667230-A-C **
16786035-T-G 14674155-T-G **
16786204-T-A 14674324-T-A **
16828969-A-C 14717089-A-C **
16701849-C-A 14589969-C-A **
16689942-C-T 14578062-C-T **
16842038-C-A 14730158-C-A **
16620269-G-T 14508389-G-T **
16588329-G-C 14476449-G-C **
16598849-G-T 14486969-G-T **
16616891-A-G 14505011-A-G **
16617091-C-A 14505211-C-A **
16617867-G-T 14505987-G-T **
16619631-T-G 14507751-T-G **
16619668-T-G 14507788-T-G **
16623477-G-T 14511597-G-T **
16667128-G-T 14555248-G-T **
16645922-G-T 14534042-G-T **
16653217-C-A 14541337-C-A **
16653238-G-T 14541358-G-T **
16654648-T-G 14542768-T-G **
16656723-A-C 14544843-A-C **
16658593-C-A 14546713-C-A **
16667008-C-A 14555128-C-A **
16829010-A-C 14717130-A-C **
16908372-G-T 14796492-G-T **
16560013-A-G 14448133-A-G **
17135923-T-G 15024043-T-G **
17087489-T-G 14975609-T-G **
17087495-G-T 14975615-G-T **
17095280-A-C 14983400-A-C **
17095282-C-A 14983402-C-A **
17104019-C-A 14992139-C-A **
17130278-G-T 15018398-G-T **
17135604-C-A 15023724-C-A **
17158631-AT-A 15046751-AT-A **
17070980-C-G 14959100-C-G **
17165542-G-T 15053662-G-T **
17183372-G-T 15071492-G-T **
17196306-A-C 15084426-A-C **
17215987-G-T 15104107-G-T **
17217188-A-C 15105308-A-C **
17224250-A-C 15112370-A-C **
17226084-C-A 15114204-C-A **
17087485-C-G 14975605-C-G **
17063714-T-G 14951834-T-G **
16920094-T-G 14808214-T-G **
17038605-C-T 14926725-C-T **
16921291-G-T 14809411-G-T **
16921297-G-T 14809417-G-T **
16921348-A-C 14809468-A-C **
16931346-C-A 14819466-C-A **
16968228-T-G 14856348-T-G **
16971396-C-A 14859516-C-A **
16989975-C-A 14878095-C-A **
17042936-C-G 14931056-C-G **
17063713-T-G 14951833-T-G **
17046761-C-G 14934881-C-G **
17052955-A-G 14941075-A-G **
17052976-T-G 14941096-T-G **
17052996-T-G 14941116-T-G **
17053003-G-T 14941123-G-T **
17053036-T-G 14941156-T-G **
17063706-G-T 14951826-G-T **
16581385-C-A 14469505-C-A **
16474705-C-G 14362825-C-G **
15746132-G-T 13634252-G-T **
15969741-C-T 13857861-C-T **
15921899-G-A 13810019-G-A **
15922397-T-C 13810517-T-C **
15931714-C-T 13819834-C-T **
15936972-C-G 13825092-C-G **
15943628-C-A 13831748-C-A **
15943636-C-A 13831756-C-A **
15963854-A-G 13851974-A-G **
15969748-C-G 13857868-C-G **
15921325-G-T 13809445-G-T **
15971759-T-G 13859879-T-G **
15986680-C-G 13874800-C-G **
15995164-C-A 13883284-C-A **
16004248-C-A 13892368-C-A **
16004260-C-A 13892380-C-A **
16004280-C-A 13892400-C-A **
16004997-C-A 13893117-C-A **
15921895-G-C 13810015-G-C **
15912107-T-G 13800227-T-G **
16008332-G-T 13896452-G-T **
15808895-A-C 13697015-A-C **
15747423-T-C 13635543-T-C **
15788087-C-G 13676207-C-G **
15788106-C-G 13676226-C-G **
15792649-T-C 13680769-T-C **
15793636-A-C 13681756-A-C **
15803436-A-C 13691556-A-C **
15808893-A-C 13697013-A-C **
15818536-G-T 13706656-G-T **
15898821-A-C 13786941-A-C **
15818543-G-T 13706663-G-T **
15841928-T-G 13730048-T-G **
15843047-G-T 13731167-G-T **
15864443-C-A 13752563-C-A **
14550218-G-T 12438419-G-T **
15894537-G-T 13782657-G-T **
15894585-T-G 13782705-T-G **
16005518-T-G 13893638-T-G **
16008361-T-G 13896481-T-G **
16462501-G-C 14350621-G-C **
16297412-T-G 14185532-T-G **
16273401-C-A 14161521-C-A **
16273402-A-C 14161522-A-C **
16273418-C-A 14161538-C-A **
16273467-C-A 14161587-C-A **
16284159-T-C 14172279-T-C **
16297399-T-G 14185519-T-G **
16297407-G-T 14185527-G-T **
16302322-G-C 14190442-G-C **
16272182-C-A 14160302-C-A **
16319739-C-A 14207859-C-A **
16324105-G-T 14212225-G-T **
16342441-A-C 14230561-A-C **
16342448-G-C 14230568-G-C **
16383461-C-A 14271581-C-A **
16417515-C-A 14305635-C-A **
16425549-T-C 14313669-T-C **
16272206-C-A 14160326-C-A **
16266243-G-A 14154363-G-A **
16008403-T-G 13896523-T-G **
16065003-G-T 13953123-G-T **
16008412-G-T 13896532-G-T **
16039167-T-G 13927287-T-G **
16041234-T-G 13929354-T-G **
16054070-T-C 13942190-T-C **
16064527-G-T 13952647-G-T **
16064528-G-T 13952648-G-T **
16064545-G-T 13952665-G-T **
16108689-T-G 13996809-T-G P8_Prx **
16246110-C-A 14134230-C-A **
16108692-G-T 13996812-G-T P8_Prx **
16108745-T-G 13996865-T-G P8_Prx **
16177104-G-T 14065224-G-T **
16181005-A-G 14069125-A-G **
16181012-C-T 14069132-C-T **
16214143-A-C 14102263-A-C **
16214791-G-T 14102911-G-T **
14550219-G-T 12438420-G-T **
14470588-C-T 12349857-C-T **
14543938-C-A 12432139-C-A **
13238470-G-T 11082794-G-T **
13215351-T-G 11059675-T-G **
13216800-G-T 11061124-G-T **
13224522-C-T 11068846-C-T **
13226177-C-A 11070501-C-A **
13238200-G-T 11082524-G-T **
13238462-G-C 11082786-G-C **
13238468-G-A 11082792-G-A **
13239851-G-T 11084175-G-T **
13215331-C-A 11059655-C-A **
13254405-C-A 11098729-C-A **
13255499-C-A 11099823-C-A **
13271429-G-T 11115753-G-T **
13271436-G-T 11115760-G-T **
13271446-G-T 11115770-G-T **
13280574-C-A 11124898-C-A **
13280597-A-C 11124921-A-C **
13215338-A-G 11059662-A-G **
11034911-G-A **
13293958-G-T 11138282-G-T **
11025956-TCCC-T **
11006712-C-A **
11015627-C-A **
11018939-G-T **
11022823-G-T **
11022963-A-T **
11025428-C-A **
11025953-CAT-C **
11025975-T-TTGCA **
11034828-C-T **
11027044-C-A **
11027070-A-G **
11032828-A-G **
11032855-T-G **
11034801-C-T **
11034816-C-T **
11034819-C-T **
13293951-G-T 11138275-G-T **
13295040-C-A 11139364-C-A **
11000730-C-A **
13486473-A-C 11330797-A-C **
13480799-C-A 11325123-C-A **
13480824-A-C 11325148-A-C **
13481950-C-A 11326274-C-A **
13481956-C-A 11326280-C-A **
13481978-A-C 11326302-A-C **
13482016-G-T 11326340-G-T **
13483270-T-G 11327594-T-G **
13488665-C-A 11332989-C-A **
13480169-A-C 11324493-A-C **
13490557-G-T 11334881-G-T **
13490560-T-G 11334884-T-G **
13503450-G-T 11347774-G-T **
13507401-G-C 11351725-G-C **
13522954-G-T 11367278-G-T **
13526399-A-C 11370723-A-C **
13539980-G-T 11384304-G-T **
13480770-C-A 11325094-C-A **
13477454-A-C 11321778-A-C **
13299555-A-C 11143879-A-C **
13326274-T-G 11170598-T-G **
13303420-T-C 11147744-T-C **
13303457-T-G 11147781-T-G **
13310153-C-A 11154477-C-A **
13312414-C-A 11156738-C-A **
13313771-T-A 11158095-T-A **
13324641-C-A 11168965-C-A **
13325870-G-A 11170194-G-A **
13331047-A-G 11175371-A-G **
13476219-CT-C 11320543-CT-C **
13335915-G-A 11180239-G-A **
13434583-C-A 11278907-C-A **
13443134-A-C 11287458-A-C **
13443154-C-A 11287478-C-A **
13443172-C-A 11287496-C-A **
13444975-G-T 11289299-G-T **
13472295-G-T 11316619-G-T **
11000733-C-A **
10999955-ATTCCG-A **
13553345-T-A 11397669-T-A **
10889750-AATTCCATTCCATTCCATTCCATTCC-A **
10874820-C-A **
10877926-G-T **
10878528-C-G **
10878602-A-C **
10880833-C-T **
10883839-C-A **
10887385-A-T **
10890060-C-A **
10874789-C-A **
10892165-C-G **
10892558-C-CAACCGGATTT **
10893528-C-T **
10904979-G-T **
10905014-G-T **
10906597-G-T **
10907714-G-C **
10874800-C-A **
10868724-G-T **
10909787-A-C **
10814709-C-A **
10800318-T-G **
10800565-C-A **
10800901-C-G **
10801771-C-A **
10810725-C-A **
10811077-T-G **
10811085-T-G **
10821974-T-G **
10868722-T-G **
10830871-T-A **
10832979-C-A **
10835305-G-T **
10843483-C-T **
10850425-C-A **
10850450-C-A **
10866136-C-A **
10909745-C-A **
10912258-G-T **
10999956-T-C **
10972159-C-A **
10963236-T-G **
10963242-C-A **
10963248-C-A **
10963911-C-A **
10965313-C-A **
10968850-C-A **
10968851-C-A **
10972501-G-T **
10961308-C-G **
10972515-G-T **
10973637-C-G **
10984096-C-A **
10989514-C-A **
10994639-C-A **
10997726-T-G **
10997745-A-C **
10963231-T-G **
10952425-T-G **
10916978-G-T **
10937202-G-T **
10916985-G-T **
10916987-G-T **
10921563-T-C **
10924861-G-T **
10933438-T-G **
10937086-C-A **
10937088-C-A **
10940355-C-T **
10950347-C-A **
10940367-A-C **
10940372-A-G **
10940375-C-T **
10940376-C-G **
10940386-C-CACTAA **
10940391-C-G **
10942880-T-G **
10944909-T-A **
13550738-T-G 11395062-T-G **
13557071-C-A 11401395-C-A **
14524003-G-C 12412204-G-C **
14250523-C-A 12129817-C-A **
14226476-C-A 12105770-C-A **
14226481-A-C 12105775-A-C **
14228880-G-T 12108174-G-T **
14231992-T-G 12111286-T-G **
14246772-C-A 12126066-C-A **
14250458-A-G 12129752-A-G **
14250514-A-C 12129808-A-C **
14250534-A-C 12129828-A-C **
14219581-G-T 12098875-G-T **
14250540-A-C 12129834-A-C **
14250554-A-C 12129848-A-C **
14250561-C-A 12129855-C-A **
14272990-T-G 12152284-T-G **
14284598-C-A 12163892-C-A **
14289463-C-G 12168757-C-G **
14292590-G-T 12171884-G-T **
14219619-G-T 12098913-G-T **
14175581-G-A 12054875-G-A **
14292599-G-T 12171893-G-T **
14071468-C-A 11950762-C-A **
14022849-C-A 11902143-C-A **
14030269-T-C 11909563-T-C **
14041466-T-G 11920760-T-G **
14041472-A-G 11920766-A-G **
14048020-C-T 11927314-C-T **
14050708-G-T 11930002-G-T **
14053003-TA-T 11932297-TA-T **
14071497-C-A 11950791-C-A **
14114832-C-A 11994126-C-A **
14073084-G-T 11952378-G-T **
14074017-C-A 11953311-C-A **
14089874-G-T 11969168-G-T **
14090692-T-G 11969986-T-G **
14090699-T-G 11969993-T-G **
14106949-C-A 11986243-C-A **
14109370-C-T 11988664-C-T **
14292598-G-T 12171892-G-T **
14292610-G-A 12171904-G-A **
13987355-G-T 11866649-G-T **
14505315-C-A 12393520-C-A **
14431226-C-A 12310499-C-A **
14447575-C-T 12326848-C-T **
14461440-C-A 12340713-C-A **
17285180-G-A 15173300-G-A **
14474889-G-C 12354158-G-C **
14491015-T-C 12370284-T-C **
14491019-G-T 12370288-G-T **
14508670-G-T 12396875-G-T **
14404887-C-A 12284184-C-A **
14508673-G-T 12396878-G-T **
14512545-T-G 12400750-T-G **
14514893-C-A 12403098-C-A **
14514900-C-A 12403105-C-A **
14514933-C-A 12403138-C-A **
14514983-C-A 12403188-C-A **
14516941-T-A 12405142-T-A **
14427160-A-G 12306435-A-G **
14395750-C-T 12275046-C-T **
14292661-G-T 12171955-G-T **
14348033-G-T 12227328-G-T **
14301848-C-A 12181142-C-A **
14301906-C-A 12181200-C-A **
14314142-G-T 12193436-G-T **
14339388-T-G 12218683-T-G **
14344982-G-T 12224277-G-T **
14344994-G-T 12224289-G-T **
14347849-C-A 12227144-C-A **
14355502-T-G 12234797-T-G **
14390489-C-A 12269785-C-A **
14371981-G-T 12251277-G-T **
14373564-A-C 12252860-A-C **
14373591-G-C 12252887-G-C **
14373797-G-T 12253093-G-T **
14385528-C-A 12264824-C-A **
14385560-G-C 12264856-G-C **
14389907-C-A 12269203-C-A **
14000926-C-A 11880220-C-A **
13952469-G-T 11831763-G-T **
13561377-C-A 11405701-C-A **
13721669-G-C 11565993-G-C **
13697154-C-T 11541478-C-T **
13697158-G-T 11541482-G-T **
13697159-G-T 11541483-G-T **
13697173-G-T 11541497-G-T **
13700715-G-T 11545039-G-T **
13700729-G-T 11545053-G-T **
13709505-A-T 11553829-A-T **
13739978-G-C 11584302-G-C **
13697105-G-T 11541429-G-T **
11645107-C-A **
11645137-C-G **
11648533-G-T **
11648699-C-A **
11648754-C-A **
11649743-G-C **
11651215-C-G **
13697109-G-T 11541433-G-T **
13690250-G-T 11534574-G-T **
11651272-T-G **
13606323-G-T 11450647-G-T **
13565631-T-G 11409955-T-G **
13566017-A-C 11410341-A-C **
13568561-G-T 11412885-G-T **
13568607-A-G 11412931-A-G **
13576118-T-C 11420442-T-C **
13583166-C-T 11427490-C-T **
13604478-G-T 11448802-G-T **
13611128-C-A 11455452-C-A **
13644194-G-T 11488518-G-T **
13620828-C-A 11465152-C-A **
13620840-A-C 11465164-A-C **
13625799-C-A 11470123-C-A **
13628864-C-A 11473188-C-A **
13637911-A-C 11482235-A-C **
13642421-A-G 11486745-A-G **
13644165-T-G 11488489-T-G **
11651265-T-G **
11651277-T-G **
13944614-G-T 11823908-G-T **
13900366-A-C 11779660-A-C **
13859705-C-A 11738999-C-A **
13861199-G-T 11740493-G-T **
13874059-T-G 11753353-T-G **
13874074-G-T 11753368-G-T **
13875651-C-A 11754945-C-A **
13884191-T-C 11763485-T-C **
13896472-G-T 11775766-G-T **
13900373-C-A 11779667-C-A **
13858350-G-T 11737644-G-T **
13900388-C-A 11779682-C-A **
13900395-C-A 11779689-C-A **
13903725-G-T 11783019-G-T **
13919185-G-T 11798479-G-T **
13919205-T-G 11798499-T-G **
13919686-G-A 11798980-G-A **
13928246-G-T 11807540-G-T **
13859229-G-T 11738523-G-T **
13857242-G-T 11736536-G-T **
11651658-A-G **
11664646-G-T **
11651906-G-T **
11651910-G-T **
11651911-G-T **
11651931-T-G **
11663126-A-G **
11664616-G-A **
11664626-G-T **
11664789-T-A **
13857162-G-T 11736456-G-T **
11665360-C-A **
11665474-G-T **
11676204-A-C **
11676552-G-C **
13798661-C-A 11677955-C-A **
13809659-C-A 11688953-C-A **
13833214-T-G 11712508-T-G **
13857156-G-T 11736450-G-T **
17248329-T-G 15136449-T-G **
17598066-C-G 15486186-C-G **
17313523-T-G 15201643-T-G **
22884969-G-T 20723083-G-T **
22882207-T-C 20720321-T-C **
22882236-C-A 20720350-C-A **
22882245-A-C 20720359-A-C **
22883242-G-T 20721356-G-T **
22883285-C-A 20721399-C-A **
22884945-A-G 20723059-A-G 9×T**
22950315-G-T 20788429-G-T **
22880792-C-T 20718906-C-T **
22956057-G-C 20794171-G-C **
22962124-T-G 20800238-T-G **
22991330-G-A 20829444-G-A **
23019952-C-A 20858066-C-A **
23065184-A-C 20903298-A-C **
23065743-G-T 20903857-G-T **
23065759-G-T 20903873-G-T **
22882195-TAACATC-T 20720309-TAACATC-T **
22839213-A-C 20677327-A-C **
23087643-T-G 20925757-T-G **
22787096-C-A 20625210-C-A **
22590807-C-A 20428921-C-A **
22644902-G-T 20483016-G-T **
22655169-A-T 20493283-A-T **
22712961-ACT-A 20551075-ACT-A **
22766597-AT-A 20604711-AT-A **
22779359-C-A 20617473-C-A **
22787219-T-G 20625333-T-G **
22839207-A-C 20677321-A-C **
22787241-T-G 20625355-T-G **
22797891-AT-A 20636005-AT-A **
22801816-G-C 20639930-G-C **
22812706-C-A 20650820-C-A **
22836607-T-G 20674721-T-G **
22836611-C-T 20674725-C-T **
22839190-A-C 20677304-A-C **
23087634-T-G 20925748-T-G **
23104546-C-A 20942660-C-A **
22587110-G-T 20425224-G-T **
23655467-T-G 21493581-T-G **
23563814-C-A 21401928-C-A **
23563823-C-A 21401937-C-A **
23563847-C-A 21401961-C-A **
23625473-G-T 21463587-G-T **
23655458-A-C 21493572-A-C **
23655463-G-T 21493577-G-T **
23745490-G-T 21583604-G-T **
23517514-G-T 21355628-G-T **
23762759-C-A 21600873-C-A **
23762763-C-A 21600877-C-A **
23777734-C-A 21615848-C-A **
23817902-A-T 21656016-A-T **
23825691-T-C 21663805-T-C **
23849710-C-A 21687824-C-A **
23884665-C-A 21722779-C-A **
23518514-T-C 21356628-T-C **
23476238-C-T 21314352-C-T **
23137555-G-T 20975669-G-T **
23315869-C-A 21153983-C-A **
23142133-A-C 20980247-A-C **
23188366-T-G 21026480-T-G **
23211155-G-T 21049269-G-T **
23225665-A-C 21063779-A-C **
23241947-C-T 21080061-C-T 27×T**
23262803-C-G 21100917-C-G **
23310583-T-G 21148697-T-G **
23315870-C-A 21153984-C-A **
23476227-G-A 21314341-G-A **
23343622-C-A 21181736-C-A **
23360641-T-C 21198755-T-C **
23391540-C-A 21229654-C-A **
23434417-T-G 21272531-T-G **
23439935-G-T 21278049-G-T **
23459613-A-C 21297727-A-C **
23468604-C-A 21306718-C-A **
22587849-G-T 20425963-G-T **
22564640-A-C 20402754-A-C **
23884679-C-A 21722793-C-A **
22058141-C-A 19896255-C-A **
22012351-C-A 19850465-C-A **
22023796-C-T 19861910-C-T **
22023803-C-A 19861917-C-A **
22045593-T-G 19883707-T-G **
22056432-C-A 19894546-C-A **
22056433-C-A 19894547-C-A **
22058142-C-A 19896256-C-A 9×A**
21984201-A-G 19822315-A-G **
22058154-A-C 19896268-A-C **
22058155-C-A 19896269-C-A **
22058174-C-A 19896288-C-A **
22065439-A-G 19903553-A-G **
22065454-T-G 19903568-T-G **
22076967-A-C 19915081-A-C **
22077317-G-T 19915431-G-T **
22010363-G-T 19848477-G-T **
21972374-G-T 19810488-G-T **
22079487-G-T 19917601-G-T **
21852531-G-T 19690645-G-T **
21796711-G-T 19634825-G-T **
21821570-T-G 19659684-T-G **
21852345-G-T 19690459-G-T **
21852352-G-T 19690466-G-T **
21852353-C-A 19690467-C-A **
21852411-T-G 19690525-T-G **
21852506-C-T 19690620-C-T **
21874787-C-G 19712901-C-G **
21972334-G-T 19810448-G-T **
21890932-C-G 19729046-C-G **
21911142-G-C 19749256-G-C **
21923994-T-G 19762108-T-G **
21939784-A-C 19777898-A-C **
21939888-T-C 19778002-T-C **
21964158-C-A 19802272-C-A **
21972311-G-T 19810425-G-T **
22079473-G-T 19917587-G-T **
22080619-A-C 19918733-A-C **
22535808-G-T 20373922-G-T **
22352951-G-T 20191065-G-T DYZ19 **
22337342-C-G 20175456-C-G DYZ19 **
22337434-A-G 20175548-A-G DYZ19 **
22337435-G-T 20175549-G-T DYZ19 **
22337473-A-T 20175587-A-T DYZ19 **
22352933-G-T 20191047-G-T DYZ19 **
22352937-C-T 20191051-C-T DYZ19 **
22352964-G-C 20191078-G-C DYZ19 **
22263796-C-A 20101910-C-A DYZ19 **
22352965-C-G 20191079-C-G DYZ19 **
22355132-A-G 20193246-A-G DYZ19 **
22426891-A-C 20265005-A-C DYZ19 **
22442507-G-T 20280621-G-T DYZ19 **
22453077-C-G 20291191-C-G DYZ19 **
22480660-G-C 20318774-G-C DYZ19 **
22520583-T-C 20358697-T-C **
22263815-CC-A 20101929-CC-A DYZ19 **
22252517-G-T 20090631-G-T DYZ19 **
22091366-A-G 19929480-A-G **
22209311-G-C 20047425-G-C **
22130195-T-A 19968309-T-A **
22132481-C-A 19970595-C-A **
22164349-G-C 20002463-G-C **
22165197-C-T 20003311-C-T **
22170578-C-A 20008692-C-A **
22189158-G-T 20027272-G-T **
22208912-A-T 20047026-A-T **
22209424-C-G 20047538-C-G **
22252479-T-G 20090593-T-G DYZ19 **
22209489-A-G 20047603-A-G **
22211449-A-C 20049563-A-C **
22215104-G-T 20053218-G-T **
22215143-G-T 20053257-G-T **
22218873-G-T 20056987-G-T DYZ19 **
22235192-T-G 20073306-T-G DYZ19 **
22235196-T-G 20073310-T-G DYZ19 **
23884667-C-A 21722781-C-A **
23884683-C-A 21722797-C-A **
21771526-G-T 19609640-G-T **
28657425-AC-A 26511278-AC-A **
28625951-G-T 26479804-G-T **
28639724-C-A 26493577-C-A **
28639760-C-A 26493613-C-A **
28639790-C-A 26493643-C-A **
28643860-T-C 26497713-T-C **
28650722-T-C 26504575-T-C **
28667287-C-A 26521140-C-A **
28591352-G-T 26445205-G-T **
28725231-C-A 26579084-C-A **
28727818-T-G 26581671-T-G **
28745139-G-T 26598992-G-T **
28754441-T-G 26608294-T-G **
28755922-C-A 26609775-C-A **
28764317-C-G 26618170-C-G **
28768797-T-G 26622650-T-G **
28621740-G-T 26475593-G-T **
28548635-A-C 26402488-A-C **
28792949-G-T 26646802-G-T **
28500312-C-G 26354165-C-G **
28468609-G-T 26322462-G-T **
28483705-G-T 26337558-G-T **
28492474-T-C 26346327-T-C **
28492482-G-C 26346335-G-C **
28494455-C-A 26348308-C-A **
28500295-G-T 26354148-G-T **
28505164-A-G 26359017-A-G **
28546874-G-T 26400727-G-T **
28517258-C-A 26371111-C-A **
28519522-C-A 26373375-C-A **
28519525-C-A 26373378-C-A **
28520627-T-A 26374480-T-A **
28521831-C-A 26375684-C-A **
28546842-G-T 26400695-G-T **
28546862-G-T 26400715-G-T **
28768860-A-G 26622713-A-G **
28800534-A-C 26654387-A-C **
27982175-T-TATC 25836028-T-TATC P1_Y2 **
56879807-G-T **
56845901-A-C **
56845902-A-T **
56846414-C-A **
56847089-T-G **
56847174-G-T **
56858801-T-C **
56879943-G-T **
56845888-A-AG **
56879967-C-G **
8114-C-A **
8160-C-A **
8176-A-C **
8210-C-A **
16792-A-T **
22886-C-G **
56845895-T-C **
56845881-T-G **
56756816-G-T **
56839607-C-A **
56756828-G-T **
56822386-T-G **
56822400-G-T **
56822600-A-G **
56822625-G-T **
56823125-A-C **
56839461-T-AC **
56840396-C-G **
56845770-G-T **
56842314-T-G **
56844708-T-G **
56844897-C-A **
56844911-C-A **
56844929-C-G **
56844964-C-G **
56844968-C-A **
28429474-C-A 26283327-C-A P1_gr2 **
27967276-G-T 25821129-G-T P1_Y2 9×TA**
23884691-C-CAA 21722805-C-CAA **
24422596-G-T 22276449-G-T **
24403267-A-C 22257120-A-C **
24403285-C-A 22257138-C-A **
24404431-C-A 22258284-C-A **
24405917-G-T 22259770-G-T **
24406517-T-C 22260370-T-C **
24420899-T-TG 22274752-T-TG **
24445503-G-T 22299356-G-T **
24385003-C-A 22238856-C-A **
24513680-G-T 22367533-G-T **
24614316-C-G 22468169-C-G P3_t2 **
24875438-G-T 22729291-G-T g1 **
24877633-C-T 22731486-C-T g1 **
25305070-T-G 23158923-T-G P2_r1 **
25592737-G-T 23446590-G-T P1_gr1 **
25638045-G-T 23491898-G-T P1_b3 **
24385014-C-A 22238867-C-A **
24384980-C-A 22238833-C-A **
25940277-T-C 23794130-T-C P1_Y1 **
24267359-G-T 22121212-G-T P3_b1 **
23884697-C-A 21722811-C-A **
23884701-C-A 21722815-C-A **
21755318-C-G **
23952416-C-G 21806269-C-G **
23981948-TC-A 21835801-TC-A **
24252272-G-T 22106125-G-T P3_b1 **
24264930-C-A 22118783-C-A P3_b1 **
24267382-G-T 22121235-G-T P3_b1 **
24376290-T-G 22230143-T-G **
24342100-T-G 22195953-T-G P3_t1 **
24342110-G-T 22195963-G-T P3_t1 **
24342129-G-T 22195982-G-T P3_t1 **
24342160-G-T 22196013-G-T P3_t1 **
24342178-T-G 22196031-T-G P3_t1 **
24363632-T-C 22217485-T-C **
24363957-T-G 22217810-T-G **
25737130-T-C 23590983-T-C P1_b3 **
25990611-T-C 23844464-T-C P1_Y1 **
27943977-C-A 25797830-C-A P1_Y2 **
27627340-G-T 25481193-G-T P1_Y2 **
26928092-G-C 24781945-G-C P1_r3 **
27127922-A-C 24981775-A-C P1_g3 **
27216717-G-T 25070570-G-T P1_g3 **
27527292-A-C 25381145-A-C P1_Y2 **
27583247-C-A 25437100-C-A P1_Y2 **
27618083-G-T 25471936-G-T P1_Y2 **
27860718-T-G 25714571-T-G P1_Y2 **
26435160-C-A 24289013-C-A P1_Y1 **
27861777-C-A 25715630-C-A P1_Y2 **
27861783-C-A 25715636-C-A P1_Y2 **
27896007-C-CAAA 25749860-C-CAAA P1_Y2 12×A**
27937417-G-T 25791270-G-T P1_Y2 **
27943899-C-A 25797752-C-A P1_Y2 **
27943927-C-A 25797780-C-A P1_Y2 **
27943973-C-CCA 25797826-C-CCA P1_Y2 **
26834931-G-T 24688784-G-T P1_g2 **
26345823-G-T 24199676-G-T P1_Y1 **
26015508-T-G 23869361-T-G P1_Y1 **
26030112-G-T 23883965-G-T P1_Y1 **
26015510-T-G 23869363-T-G P1_Y1 **
26015519-G-T 23869372-G-T P1_Y1 **
26015550-T-G 23869403-T-G P1_Y1 **
26015610-G-T 23869463-G-T P1_Y1 **
26026490-A-C 23880343-A-C P1_Y1 **
26030087-G-T 23883940-G-T P1_Y1 **
26030099-G-T 23883952-G-T P1_Y1 **
26030119-G-T 23883972-G-T P1_Y1 **
26320972-C-G 24174825-C-G P1_Y1 **
26085358-A-C 23939211-A-C P1_Y1 **
26085371-A-C 23939224-A-C P1_Y1 **
26085377-C-A 23939230-C-A P1_Y1 **
26085402-C-A 23939255-C-A P1_Y1 **
26152131-C-CTTCA 24005984-C-CTTCA P1_Y1 **
26228735-TC-T 24082588-TC-T P1_Y1 **
26260546-C-T 24114399-C-T P1_Y1 **
21796701-G-T 19634815-G-T **
21771518-G-T 19609632-G-T **
17313718-G-T 15201838-G-T **
18682890-G-T 16571010-G-T **
18660094-G-T 16548214-G-T **
18660142-G-T 16548262-G-T **
18662360-G-T 16550480-G-T **
18662384-C-A 16550504-C-A **
18682575-C-T 16570695-C-T **
18682576-T-G 16570696-T-G **
18723938-G-T 16612058-G-T **
18652329-T-G 16540449-T-G **
18730330-C-A 16618450-C-A **
18736590-G-T 16624710-G-T **
18753344-C-A 16641464-C-A **
18812148-T-G 16700268-T-G **
18849392-G-T 16737512-G-T **
18855488-C-A 16743608-C-A **
18864885-C-A 16753005-C-A **
18653683-G-T 16541803-G-T **
18651690-G-T 16539810-G-T **
18906178-C-A 16794298-C-A **
18411038-C-A 16299158-C-A P6_Gap **
18371878-A-C 16259998-A-C P6_Prx **
18371888-A-C 16260008-A-C P6_Prx **
18371928-C-A 16260048-C-A P6_Prx **
18371933-T-C 16260053-T-C P6_Prx **
18381894-C-A 16270014-C-A P6_Gap **
18411023-C-A 16299143-C-A P6_Gap **
18411094-C-A 16299214-C-A P6_Gap **
18650622-C-A 16538742-C-A **
18411100-A-C 16299220-A-C P6_Gap **
18425233-T-C 16313353-T-C P6_Gap **
18425268-C-A 16313388-C-A P6_Gap **
18491516-T-G 16379636-T-G P6_Dst **
18516298-G-T 16404418-G-T P6_Dst **
18569744-T-G 16457864-T-G **
18628268-C-A 16516388-C-A **
18901014-C-A 16789134-C-A **
18906207-C-A 16794327-C-A **
18354765-C-A 16242885-C-A P6_Prx **
19071344-G-T 16959464-G-T **
19056088-G-T 16944208-G-T **
19056178-G-T 16944298-G-T **
19059821-C-A 16947941-C-A **
19065089-A-C 16953209-A-C **
19071023-A-C 16959143-A-C **
19071317-G-T 16959437-G-T **
19071361-T-G 16959481-T-G **
19053445-G-C 16941565-G-C **
19071379-G-T 16959499-G-T **
19071914-A-G 16960034-A-G **
19137682-A-C 17025802-A-C **
19137686-A-C 17025806-A-C **
19137687-T-C 17025807-T-C **
19138777-G-T 17026897-G-T **
19189686-G-C 17077806-G-C **
19053456-G-T 16941576-G-T **
19053435-T-G 16941555-T-G **
18928811-G-T 16816931-G-T **
18981195-C-G 16869315-C-G **
18928817-G-T 16816937-G-T **
18937432-G-C 16825552-G-C **
18937494-G-T 16825614-G-T **
18949663-C-A 16837783-C-A **
18949674-A-G 16837794-A-G **
18951554-G-T 16839674-G-T **
18972819-C-A 16860939-C-A **
18984041-T-G 16872161-T-G **
19047893-C-A 16936013-C-A **
18990351-C-A 16878471-C-A **
18997329-G-T 16885449-G-T **
19007663-T-C 16895783-T-C **
19020115-T-G 16908235-T-G **
19024913-C-A 16913033-C-A **
19036859-T-A 16924979-T-A **
19040786-C-T 16928906-C-T **
18354777-T-C 16242897-T-C P6_Prx **
18354753-A-C 16242873-A-C P6_Prx **
19211568-T-G 17099688-T-G **
17598090-T-G 15486210-T-G **
17515384-G-T 15403504-G-T **
17518678-T-C 15406798-T-C **
17524065-G-T 15412185-G-T **
17596411-C-A 15484531-C-A **
10798845-T-A **
17598070-T-G 15486190-T-G **
17599070-C-A 15487190-C-A **
17503705-T-G 15391825-T-G **
17619577-A-C 15507697-A-C **
17644433-G-T 15532553-G-T **
17672118-G-T 15560238-G-T **
17707373-T-C 15595493-T-C **
17826410-C-A 15714530-C-A **
17854310-C-A 15742430-C-A **
17860226-T-G 15748346-T-G **
17515339-G-T 15403459-G-T **
17503699-G-T 15391819-G-T **
17882820-A-G 15770940-A-G **
17446863-G-T 15334983-G-T **
31633-G-T **
17346287-T-G 15234407-T-G **
17355606-C-A 15243726-C-A **
17362727-A-G 15250847-A-G **
17377667-G-T 15265787-G-T **
17377903-C-A 15266023-C-A **
17446862-T-G 15334982-T-G **
17461359-C-A 15349479-C-A **
17500960-G-T 15389080-G-T **
17464845-A-C 15352965-A-C **
17466529-A-C 15354649-A-C **
17466556-A-C 15354676-A-C **
17474815-G-C 15362935-G-C **
17480123-C-A 15368243-C-A **
17500494-G-T 15388614-G-T **
17500852-T-G 15388972-T-G **
17870879-A-G 15758999-A-G **
17882844-G-C 15770964-G-C **
18354739-C-A 16242859-C-A P6_Prx **
18184486-G-T 16072606-G-T **
18136199-G-T 16024319-G-T **
18136234-G-T 16024354-G-T **
18159848-TG-T 16047968-TG-T **
18165843-T-G 16053963-T-G **
18174715-T-G 16062835-T-G **
18183446-A-C 16071566-A-C **
18184541-G-T 16072661-G-T **
18097823-T-G 15985943-T-G **
18187310-C-A 16075430-C-A **
18212471-T-G 16100591-T-G **
18223853-G-T 16111973-G-T **
18223873-T-G 16111993-T-G **
18256283-G-A 16144403-G-A **
18337348-T-C 16225468-T-C P6_Prx **
18354428-A-T 16242548-A-T P6_Prx **
18097825-G-T 15985945-G-T **
18097806-A-G 15985926-A-G **
17882853-G-T 15770973-G-T **
18050327-C-A 15938447-C-A **
17912906-C-A 15801026-C-A **
17920889-C-A 15809009-C-A **
17920903-C-A 15809023-C-A **
17926581-A-G 15814701-A-G **
17953928-A-C 15842048-A-C **
18042770-T-G 15930890-T-G **
18042771-G-T 15930891-G-T **
18053420-C-G 15941540-C-G **
18086907-C-A 15975027-C-A **
18071751-G-T 15959871-G-T **
18071919-G-C 15960039-G-C **
18079244-A-C 15967364-A-C **
18079264-G-C 15967384-G-C **
18080462-G-T 15968582-G-T **
18085559-G-T 15973679-G-T **
18086160-A-C 15974280-A-C **
19201007-T-G 17089127-T-G **
19213721-A-C 17101841-A-C **
21745897-A-G 19584011-A-G **
21317585-A-C 19155699-A-C **
21279735-C-A 19117849-C-A **
21281469-C-A 19119583-C-A **
21281556-C-A 19119670-C-A **
21281725-C-G 19119839-C-G **
21283280-C-A 19121394-C-A **
21315248-G-T 19153362-G-T **
21317586-C-A 19155700-C-A **
21265185-A-C 19103299-A-C **
21324307-C-A 19162421-C-A **
21324311-T-C 19162425-T-C **
21324323-T-C 19162437-T-C **
21336387-C-A 19174501-C-A **
21340352-G-T 19178466-G-T **
21340358-T-G 19178472-T-G **
21380452-T-C 19218566-T-C **
21270365-G-T 19108479-G-T **
21265183-C-A 19103297-C-A **
21386614-C-A 19224728-C-A **
21120358-T-A 18958472-T-A **
21109446-C-A 18947560-C-A **
21109476-C-A 18947590-C-A **
21109517-C-A 18947631-C-A **
21115621-C-A 18953735-C-A **
21115713-A-C 18953827-A-C **
21115735-T-G 18953849-T-G **
21127525-A-C 18965639-A-C **
21262490-C-A 19100604-C-A **
21141421-C-T 18979535-C-T **
21149635-G-T 18987749-G-T **
21153832-T-G 18991946-T-G **
21155259-G-T 18993373-G-T **
21164694-G-T 19002808-G-T **
21201167-C-A 19039281-C-A **
21240563-G-C 19078677-G-C **
21386601-G-C 19224715-G-C **
21387227-G-T 19225341-G-T **
21073148-C-A 18911262-C-A **
21569954-TC-T 19408068-TC-T **
21512251-G-T 19350365-G-T **
21512273-T-G 19350387-T-G **
21512286-G-T 19350400-G-T **
21541005-T-C 19379119-T-C **
21554345-G-T 19392459-G-T **
21555608-T-G 19393722-T-G **
21573927-C-A 19412041-C-A **
21457930-T-C 19296044-T-C **
21588495-G-T 19426609-G-T **
21602610-G-T 19440724-G-T **
21602638-G-T 19440752-G-T **
21624765-G-T 19462879-G-T **
21679683-A-C 19517797-A-C **
21692008-G-T 19530122-G-T **
21699150-A-C 19537264-A-C **
21476876-C-T 19314990-C-T **
21457922-A-C 19296036-A-C **
21391549-C-A 19229663-C-A **
21412261-CTTTTT-C 19250375-CTTTTT-C 36×T**
21391553-G-C 19229667-G-C **
21391556-C-A 19229670-C-A **
21391701-T-C 19229815-T-C **
21407904-G-T 19246018-G-T **
21408633-A-G 19246747-A-G **
21408661-A-C 19246775-A-C **
21408703-C-A 19246817-C-A **
21419874-A-C 19257988-A-C **
21457909-A-C 19296023-A-C **
21419881-C-A 19257995-C-A **
21435265-G-T 19273379-G-T **
21446309-A-C 19284423-A-C **
21447898-T-C 19286012-T-C **
21448094-A-C 19286208-A-C **
21455752-T-G 19293866-T-G **
21457277-G-T 19295391-G-T **
21087206-A-G 18925320-A-G **
21015123-A-G 18853237-A-G P4_Dst **
19218080-C-A 17106200-C-A **
19736782-A-C 17624902-A-C P5_Prx **
19558146-T-G 17446266-T-G **
19558264-G-T 17446384-G-T **
19563323-A-G 17451443-A-G **
19709600-C-A 17597720-C-A P5_Prx **
19709604-G-C 17597724-G-C P5_Prx **
19736757-G-T 17624877-G-T P5_Prx **
19736823-A-C 17624943-A-C P5_Prx **
19539737-C-A 17427857-C-A **
19736831-A-C 17624951-A-C P5_Prx **
19736832-C-A 17624952-C-A P5_Prx **
19739295-C-A 17627415-C-A P5_Prx **
19739300-C-A 17627420-C-A P5_Prx **
19739313-G-T 17627433-G-T P5_Prx **
19739318-A-C 17627438-A-C P5_Prx **
19789022-G-T 17677142-G-T P5_Prx **
19544603-A-G 17432723-A-G **
19531529-G-T 17419649-G-T **
19818761-T-C 17706881-T-C P5_Prx **
19302794-G-T 17190914-G-T **
19246186-A-C 17134306-A-C **
19254561-T-G 17142681-T-G **
19270574-G-T 17158694-G-T **
19286383-G-T 17174503-G-T **
19298768-G-T 17186888-G-T **
19302300-G-T 17190420-G-T **
19302306-G-T 17190426-G-T **
19326160-C-A 17214280-C-A **
19510371-G-T 17398491-G-T **
19373832-C-A 17261952-C-A **
19449359-G-T 17337479-G-T **
19464083-G-T 17352203-G-T **
19464778-T-G 17352898-T-G **
19472525-T-C 17360645-T-C **
19487003-C-T 17375123-C-T **
19510369-G-T 17398489-G-T **
19789058-G-T 17677178-G-T P5_Prx **
19979744-A-C 17867864-A-C P5_Prx **
21015107-A-ATG 18853221-A-ATG P4_Dst **
20724127-A-C 18562241-A-C P4_Prx **
20685087-G-T 18523201-G-T P4_Prx **
20698738-C-A 18536852-C-A P4_Prx **
20698740-C-A 18536854-C-A P4_Prx **
20698761-T-C 18536875-T-C P4_Prx **
20707508-G-T 18545622-G-T P4_Prx **
20707516-T-G 18545630-T-G P4_Prx **
20758775-C-A 18596889-C-A P4_Prx **
20665781-TG-T 18503895-TG-T P4_Prx **
20758793-A-C 18596907-A-C P4_Prx **
20758808-C-A 18596922-C-A P4_Prx **
20840823-C-A 18678937-C-A P4_Gap **
20868425-T-TC 18706539-T-TC P4_Dst **
20989901-A-C 18828015-A-C P4_Dst **
21015100-A-T 18853214-A-T P4_Dst **
21015103-A-AGG 18853217-A-AGG P4_Dst **
20685073-G-T 18523187-G-T P4_Prx **
20652996-A-AAG 18491110-A-AAG P4_Prx **
19979754-A-C 17867874-A-C P5_Prx **
20022577-A-G 17910697-A-G P5_Prx **
19979766-C-A 17867886-C-A P5_Prx **
19979770-C-A 17867890-C-A P5_Prx **
19979773-C-A 17867893-C-A P5_Prx **
19979783-A-C 17867903-A-C P5_Prx **
19979809-G-T 17867929-G-T P5_Prx **
19979820-T-G 17867940-T-G P5_Prx **
19979834-G-T 17867954-G-T P5_Prx **
20022582-C-T 17910702-C-T P5_Prx **
20631853-G-A 18469967-G-A P4_Prx **
20214074-T-C 18052188-T-C P5_Dst **
20332029-G-A 18170143-G-A P5_Dst **
20332047-G-T 18170161-G-T P5_Dst **
20335044-C-A 18173158-C-A P5_Dst **
20433689-G-A 18271803-G-A P5_Dst **
20440393-T-G 18278507-T-G P5_Dst **
20569455-A-C 18407569-A-C P5_Dst **
10800280-A-G **
17343614-A-G 15231734-A-G **
10796821-C-T **
3648609-C-A 3780568-C-A **
16428617-C-A 14316737-C-A **
15746110-G-T 13634230-G-T **
19272140-C-A 17160260-C-A **
10887375-T-A **
10655833-T-G **
10655831-G-A **
10655764-C-T **
16059-G-A **
10667186-C-A **
15126949-C-A 13015036-C-A **
4700876-C-A 4832835-C-A **
22734348-G-T 20572462-G-T **
15202554-G-T 13090640-G-T **
17128596-A-C 15016716-A-C **
14738816-C-A 12626884-C-A **
13218533-C-A 11062857-C-A **
24264955-C-A 22118808-C-A P3_b1 **
24264918-C-A 22118771-C-A P3_b1 **
21317593-C-A 19155707-C-A **
17187565-TCAA-T 15075685-TCAA-T **
14071466-C-A 11950760-C-A **
56844959-G-A **
6682075-C-A 6814034-C-A **
22130215-A-G 19968329-A-G **
15495134-C-A 13383254-C-A **
4209001-C-A 4340960-C-A **
14076633-C-A 11955927-C-A **
14345048-C-A 12224343-C-A **
15904099-G-A 13792219-G-A **
13697104-G-T 11541428-G-T **
10648022-C-A **
7019091-T-C 7151050-T-C **
2649571-G-A 2781530-G-A **
2813696-T-C 2945655-T-C **
2803961-C-A 2935920-C-A **
2795599-T-G 2927558-T-G **
2784383-C-A 2916342-C-A **
2708719-G-T 2840678-G-T **
2708701-G-T 2840660-G-T **
2708683-G-T 2840642-G-T **
2699589-C-A 2831548-C-A **
2695529-C-A 2827488-C-A **
2695511-C-A 2827470-C-A **
2689639-A-G 2821598-A-G **
2684459-G-T 2816418-G-T **
2649587-G-T 2781546-G-T **
2649568-C-A 2781527-C-A **
15202563-T-G 13090649-T-G **
21596976-C-A 19435090-C-A **
4209041-C-A 4341000-C-A **
23953022-T-G 21806875-T-G **
22914640-G-T 20752754-G-T **
16602835-G-A 14490955-G-A **
28478280-C-A 26332133-C-A **
2909234-C-CAA 3041193-C-CAA 16×A**
17503669-G-T 15391789-G-T **
14357739-C-A 12237034-C-A **
23837614-G-T 21675728-G-T **
6064207-C-A 6196166-C-A **
28546875-G-T 26400728-G-T **
16016920-C-A 13905040-C-A **
18628060-C-A 16516180-C-A **
14660334-C-A 12548399-C-A **
18628050-C-A 16516170-C-A **
2839863-A-C 2971822-A-C **
9511741-C-A 9674132-C-A **
7862076-G-T 7994035-G-T **
10653284-C-A **
22810901-G-T 20649015-G-T **
3271471-C-A 3403430-C-A **
16044803-C-A 13932923-C-A **
10655991-T-C **
10655968-G-C **
4201687-A-C 4333646-A-C **
10660981-T-G **
10940339-TCCACG-T **
10940295-C-G **
10940273-C-A **
14088849-C-A 11968143-C-A **
21115729-A-C 18953843-A-C **
10752462-T-A **
17070972-G-T 14959092-G-T **
13505057-G-T 11349381-G-T **
16828974-C-A 14717094-C-A **
19720902-C-A 17609022-C-A P5_Prx **
7306684-G-T 7438643-G-T **
23773858-G-T 21611972-G-T **
10961333-G-T **
16462487-C-A 14350607-C-A **
10757060-C-A **
14250559-A-C 12129853-A-C **
15677392-G-T 13565512-G-T **
14187127-C-A 12066421-C-A **
10796779-C-T **
6505633-C-A 6637592-C-A **
14357736-C-A 12237031-C-A **
10752467-T-C **
16146479-A-AAAGG 14034599-A-AAAGG P8_Dst 12×AAAG**
10821932-C-G **
14511909-C-A 12400114-C-A **
16071818-C-A 13959938-C-A **
7650613-C-A 7782572-C-A **
4931109-C-A 5063068-C-A **
9874919-C-A 10037310-C-A **
9764262-C-T 9926653-C-T **
7186206-C-A 7318165-C-A **
13472215-A-ACC 11316539-A-ACC **
10775062-A-G **
23522321-G-T 21360435-G-T **
3545723-CAA-C 3677682-CAA-C 11×A**
28544974-C-A 26398827-C-A **
16623492-G-T 14511612-G-T **
19218289-G-T 17106409-G-T **
13697117-A-C 11541441-A-C **
22715192-G-T 20553306-G-T **
15452253-C-A 13340373-C-A **
23070802-GTA-G 20908916-GTA-G **
17159021-G-T 15047141-G-T **
3686401-G-A 3818360-G-A **
6267852-C-A 6399811-C-A IR3_Dst **
4075794-G-T 4207753-G-T **
23061117-C-A 20899231-C-A **
16277903-C-A 14166023-C-A **
10999996-C-T **
10999986-C-A **
2916307-T-G 3048266-T-G **
3923251-C-A 4055210-C-A **
13697120-T-A 11541444-T-A **
2814927-C-T 2946886-C-T **
2839913-C-A 2971872-C-A **
18955760-C-A 16843880-C-A **
3764852-C-A 3896811-C-A **
3995174-C-A 4127133-C-A **
3991862-T-A 4123821-T-A **
3987827-A-G 4119786-A-G **
3966828-G-T 4098787-G-T **
3926467-G-T 4058426-G-T **
3925267-T-G 4057226-T-G **
3923725-G-T 4055684-G-T **
3923400-C-A 4055359-C-A **
3923387-A-C 4055346-A-C **
3916627-A-C 4048586-A-C **
3849064-A-T 3981023-A-T **
3830866-C-G 3962825-C-G **
3785673-T-G 3917632-T-G **
3762464-G-T 3894423-G-T **
4063116-C-A 4195075-C-A **
3762428-G-T 3894387-G-T **
3761099-C-A 3893058-C-A **
3759439-G-C 3891398-G-C **
3758865-T-G 3890824-T-G **
3731973-T-G 3863932-T-G **
3731957-G-T 3863916-G-T **
3731956-G-T 3863915-G-T **
3731951-G-T 3863910-G-T **
3697056-T-C 3829015-T-C **
3686623-C-A 3818582-C-A **
3625859-C-A 3757818-C-A **
3625828-A-G 3757787-A-G **
3610389-C-A 3742348-C-A **
3610370-G-C 3742329-G-C **
4031772-G-C 4163731-G-C **
4063142-C-A 4195101-C-A **
3546971-C-A 3678930-C-A **
4225958-G-T 4357917-G-T **
4371142-G-T 4503101-G-T **
4351490-G-T 4483449-G-T **
4351440-G-T 4483399-G-T **
4351439-G-T 4483398-G-T **
4351420-G-T 4483379-G-T **
4302311-C-G 4434270-C-G **
4292883-T-G 4424842-T-G **
4282035-C-T 4413994-C-T **
4256916-G-T 4388875-G-T **
4244937-C-A 4376896-C-A **
4244878-A-C 4376837-A-C **
4240956-A-C 4372915-A-C **
4225964-G-T 4357923-G-T **
4224852-G-T 4356811-G-T **
4063402-G-T 4195361-G-T **
4209059-C-A 4341018-C-A **
4209028-C-A 4340987-C-A **
4201711-C-A 4333670-C-A **
4159675-T-G 4291634-T-G **
4138863-C-G 4270822-C-G **
4123901-GA-G 4255860-GA-G **
4100934-G-T 4232893-G-T **
4100926-A-G 4232885-A-G **
4100916-T-G 4232875-T-G **
4093335-T-G 4225294-T-G **
4088501-A-C 4220460-A-C **
4078481-C-A 4210440-C-A **
4065883-C-A 4197842-C-A **
4063945-C-A 4195904-C-A **
3605990-T-G 3737949-T-G **
3546946-A-G 3678905-A-G **
2839937-C-A 2971896-C-A **
2950248-C-A 3082207-C-A **
3089736-G-T 3221695-G-T **
3087525-C-T 3219484-C-T **
3074895-C-A 3206854-C-A **
3073683-G-A 3205642-G-A **
3048083-T-A 3180042-T-A **
3015713-T-G 3147672-T-G **
2976340-C-A 3108299-C-A **
2976330-A-C 3108289-A-C **
2976329-A-G 3108288-A-G **
2976328-C-A 3108287-C-A **
2976311-C-A 3108270-C-A **
2970858-G-T 3102817-G-T **
2950252-C-A 3082211-C-A **
10796789-TTC-T **
3108995-G-T 3240954-G-T **
2950213-C-A 3082172-C-A **
2948394-A-G 3080353-A-G **
2916313-G-T 3048272-G-T **
2909212-T-G 3041171-T-G **
2909211-G-T 3041170-G-T **
2908964-C-A 3040923-C-A **
2908933-C-A 3040892-C-A **
2898825-G-T 3030784-G-T **
2854766-A-C 2986725-A-C **
2853627-G-T 2985586-G-T **
2853403-A-C 2985362-A-C **
2845866-A-C 2977825-A-C **
2839973-T-C 2971932-T-C **
2839966-C-A 2971925-C-A **
3089976-G-T 3221935-G-T **
3112728-A-C 3244687-A-C **
3546895-A-C 3678854-A-C **
3330403-T-G 3462362-T-G **
3546888-A-C 3678847-A-C **
3492185-G-T 3624144-G-T **
3492154-T-G 3624113-T-G **
3492105-G-T 3624064-G-T **
3436375-G-T 3568334-G-T **
3435809-G-T 3567768-G-T **
3389624-G-T 3521583-G-T **
3374324-C-A 3506283-C-A **
3369237-G-T 3501196-G-T **
3341304-G-C 3473263-G-C **
3332120-G-T 3464079-G-T **
3332111-G-T 3464070-G-T **
3330408-G-T 3462367-G-T **
3330366-A-G 3462325-A-G **
3116129-A-G 3248088-A-G **
3329387-C-A 3461346-C-A **
3329379-A-C 3461338-A-C **
3286258-GA-G 3418217-GA-G **
3280119-T-G 3412078-T-G **
3279912-A-C 3411871-A-C **
3276202-C-G 3408161-C-G **
3274329-C-A 3406288-C-A **
3272683-T-G 3404642-T-G **
3272653-T-G 3404612-T-G **
3272645-G-T 3404604-G-T **
3218279-G-T 3350238-G-T **
3218256-G-T 3350215-G-T **
3202579-T-C 3334538-T-C **
3151850-G-A 3283809-G-A **
14041535-T-G 11920829-T-G **
11027061-T-A **
4417483-A-C 4549442-A-C **
22132541-C-A 19970655-C-A **
21515859-T-C 19353973-T-C **
5022222-C-A 5154181-C-A **
13935640-C-A 11814934-C-A **
22240975-G-T 20079089-G-T DYZ19 **
5761596-C-A 5893555-C-A **
13922551-C-A 11801845-C-A **
2970883-G-T 3102842-G-T **
13874078-G-T 11753372-G-T **
10895807-G-T **
22193108-T-A 20031222-T-A **
16667001-C-A 14555121-C-A **
13859232-G-T 11738526-G-T **
16277871-C-A 14165991-C-A **
10992738-C-T **
17374640-G-T 15262760-G-T **
10992709-T-C **
20440399-T-TTGA 18278513-T-TTGA P5_Dst **
13935643-C-A 11814937-C-A **
10861448-C-A **
16598965-G-A 14487085-G-A **
28532606-C-A 26386459-C-A **
17187434-C-A 15075554-C-A **
24405311-G-T 22259164-G-T **
10926695-T-TCCGA **
10926694-A-ACTGCAC **
21505578-GTTT-G 19343692-GTTT-G 13×T**
17095390-C-A 14983510-C-A **
24403298-C-A 22257151-C-A **
10892518-C-CACTAA **
10973628-G-A **
18730489-C-A 16618609-C-A **
10940358-G-T **
10999762-G-T **
28492455-C-A 26346308-C-A **
15323678-AAG-A 13211796-AAG-A **
10683143-C-A **
17500433-G-T 15388553-G-T **
10896442-C-CTTT **
5393273-G-T 5525232-G-T **
16244792-GGTGTGTGT-G 14132912-GGTGTGTGT-G 16×GT**
10973645-T-A **
18753523-C-A 16641643-C-A **
13821263-C-A 11700557-C-A **
17466550-C-A 15354670-C-A **
10659551-C-A **
19206684-A-C 17094804-A-C **
14831851-T-G 12719918-T-G **
14483109-C-A 12362378-C-A **
5359659-C-T 5491618-C-T **
10752496-C-T **
13487776-G-A 11332100-G-A **
10961523-C-T **
10961521-A-C **
10961509-T-TTCCTC **
10961504-C-G **
10961489-T-C **
9438058-C-A 9600449-C-A **
11000007-C-T **
13215387-C-A 11059711-C-A **
16701831-G-T 14589951-G-T **
17713890-G-T 15602010-G-T **
17128573-C-A 15016693-C-A **
10979965-AATTCC-A **
24212257-C-A 22066110-C-A P3_b1 **
4389404-CAAAA-C 4521363-CAAAA-C 21×A**
22337429-G-T 20175543-G-T DYZ19 **
21624781-G-T 19462895-G-T Z36366 Z22132 **
21382075-G-T 19220189-G-T **
19022484-CTAA-C 16910604-CTAA-C 7×TAA**
17093356-CAT-C 14981476-CAT-C **
10057895-G-A 10220286-G-A Z23410 **
4409081-A-AT 4541040-A-AT 12×T**
4070053-T-C 4202012-T-C **
15865549-C-CTT 13753669-C-CTT 22×T**
13487858-T-A 11332182-T-A **
23415310-ATG-A 21253424-ATG-A **
17170167-C-CT 15058287-C-CT 21×T**
8221228-CTTT-C 8353187-CTTT-C 16×T**
22337438-C-T 20175552-C-T DYZ19 **
22337416-C-G 20175530-C-G DYZ19 **
13480790-C-A 11325114-C-A **
22337415-C-A 20175529-C-A DYZ19 **
22352929-G-T 20191043-G-T DYZ19 **
22352928-A-C 20191042-A-C DYZ19 **
59022350-G-A 56876203-G-A **
13709504-T-C 11553828-T-C **
26834669-A-G 24688522-A-G P1_g2 **
28497282-G-T 26351135-G-T ****
13740621-G-C 11584945-G-C **
13740616-A-T 11584940-A-T **
13298108-C-A 11142432-C-A **
10024365-G-C 10186756-G-C PF6817 **
8094790-C-G 8226749-C-G ****
6763414-T-C 6895373-T-C ****
13143790-CACATCACTCT-C 10633276-CACATCACTCT-C **
22252501-T-A 20090615-T-A DYZ19 **
22355144-T-G 20193258-T-G DYZ19 **
6770010-C-A 6901969-C-A **
28792970-TG-T 26646823-TG-T **
23262585-T-C 21100699-T-C **
14563484-G-T 12451684-G-T **
10961519-T-C **
10961508-G-A **
10961500-A-T **
10961497-A-C **
15332096-GA-G 13220214-GA-G 10×A**
10656021-A-T **
10656016-A-C **
10656011-C-A **
10656008-C-G **
10655993-C-G **
10655951-C-T **
28792970-T-A 26646823-T-A **
8387571-A-AAGAAGG 8519530-A-AAGAAGG 10×AGAAGG**
7704857-C-A 7836816-C-A **
13566011-C-A 11410335-C-A **
10658581-C-T **
10997743-C-A **
10759758-C-T **
10057939-A-G 10220330-A-G **
13487860-G-A 11332184-G-A **
20332015-T-A 18170129-T-A P5_Dst **
16505918-TAA-T 14394038-TAA-T 12×A**
26204654-G-C 24058507-G-C P1_Y1 **
13480740-A-T 11325064-A-T **
13474638-G-A 11318962-G-A **
27484492-TTG-T 25338345-TTG-T P1_Y2 14×TG**
7567870-C-T 7699829-C-T **
23007269-G-T 20845383-G-T **
14527131-C-A 12415332-C-A **
6767740-C-A 6899699-C-A **
21770143-C-A 19608257-C-A **
26123300-C-G 23977153-C-G P1_Y1 **
19531512-C-A 17419632-C-A **
17159008-G-T 15047128-G-T **
27762783-A-AAC 25616636-A-AAC P1_Y2 **
10748161-C-T **
23459608-C-A 21297722-C-A **
14986075-C-A 12874143-C-A **
14718263-C-A 12606331-C-A **
17952623-CTTTT-C 15840743-CTTTT-C 16×T**
13557134-C-A 11401458-C-A **
14712007-C-A 12600074-C-A **
13888464-C-A 11767758-C-A **
14802749-C-A 12690820-C-A **
20332014-G-A 18170128-G-A P5_Dst **
16583340-G-A 14471460-G-A **
10840312-C-A **
2814992-C-T 2946951-C-T **
18195154-A-T 16083274-A-T 29×T**
14552445-C-G 12440646-C-G **
10790052-C-A **
2719074-C-A 2851033-C-A **
27762779-A-C 25616632-A-C P1_Y2 **
22252496-G-T 20090610-G-T DYZ19 **
10789983-T-A **
17707232-C-A 15595352-C-A **
19071453-G-T 16959573-G-T **
7374470-T-C 7506429-T-C **
28560218-C-A 26414071-C-A **
27896033-A-AC 25749886-A-AC P1_Y2 **
16462471-C-A 14350591-C-A **
21823149-T-C 19661263-T-C **
14776948-C-A 12665017-C-A **
10759809-C-A **
10655845-T-C **
13303385-T-G 11147709-T-G **
10940288-C-T **
10940282-T-A **
3491747-C-A 3623706-C-A **
14114893-C-A 11994187-C-A **
28792987-G-C 26646840-G-C **
28792966-G-A 26646819-G-A **
10940338-C-T **
10814694-C-A **
14715480-C-A 12603547-C-A **
11652664-G-T **
22979289-C-A 20817403-C-A **
3850042-C-A 3982001-C-A **
14395269-G-T 12274565-G-T **
16278002-C-A 14166122-C-A **
10999989-A-C **
28568068-C-A 26421921-C-A **
5761601-C-A 5893560-C-A **
19818814-A-AT 17706934-A-AT P5_Prx **
7148100-C-A 7280059-C-A **
11025965-C-T **
10659571-C-A **
14107008-C-A 11986302-C-A **
21334657-C-A 19172771-C-A **
15288092-A-G 13176191-A-G **
5761599-C-A 5893558-C-A **
10997614-T-G **
24376282-T-G 22230135-T-G **
23655470-G-T 21493584-G-T **
13213288-C-A 11057612-C-A **
10999998-A-G **
6926263-C-A 7058222-C-A **
28469312-C-A 26323165-C-A **
19736807-C-CA 17624927-C-CA P5_Prx **
2845851-A-C 2977810-A-C **
10801739-TTCCAC-T **
10984063-C-A **
10991930-C-A **
4473173-G-T 4605132-G-T **
18154613-G-T 16042733-G-T **
11674987-G-T **
10940318-T-A **
9221730-C-A 9384121-C-A **
4270675-C-A 4402634-C-A **
10658575-T-G **
23818399-C-A 21656513-C-A **
16063491-AT-A 13951611-AT-A 9×T**
19671594-C-A 17559714-C-A P5_Prx **
13725938-G-T 11570262-G-T **
18972651-C-A 16860771-C-A **
10999968-G-C **
11000020-A-T **
13487802-G-A 11332126-G-A **
10940320-C-A **
10797729-T-C **
10797705-T-A **
10797702-C-T **
10797699-C-T **
7699268-C-A 7831227-C-A **
2852598-A-C 2984557-A-C **
13824986-C-A 11704280-C-A **
17042820-C-A 14930940-C-A **
10769399-C-T **
26435188-C-A 24289041-C-A P1_Y1 **
28492470-C-A 26346323-C-A **
5562937-C-A 5694896-C-A **
24252250-A-AC 22106103-A-AC P3_b1 **
10940326-C-T **
8043227-C-A 8175186-C-A **
5698723-G-T 5830682-G-T **
15788071-C-A 13676191-C-A **
13952732-C-A 11832026-C-A **
4505245-C-A 4637204-C-A **
13935621-C-A 11814915-C-A **
5189308-C-A 5321267-C-A **
2928677-C-A 3060636-C-A **
28480188-C-A 26334041-C-A **
4159990-C-A 4291949-C-A **
14451074-CT-C 12330347-CT-C **
10769410-C-G **
11034933-C-A **
10763095-C-G **
14715481-C-A 12603548-C-A **
10653277-C-A **
19535702-G-T 17423822-G-T **
15926954-C-A 13815074-C-A **
15533105-C-A 13421225-C-A **
16905706-C-A 14793826-C-A **
10984069-C-A **
10895838-CTCCAT-C **
28500311-G-T 26354164-G-T **
7258536-C-A 7390495-C-A **
56847120-A-T **
4388631-G-T 4520590-G-T **
4389619-C-A 4521578-C-A **
2950221-C-A 3082180-C-A **
4443506-T-G 4575465-T-G **
7572755-T-A 7704714-T-A **
7704864-C-A 7836823-C-A **
7695678-G-T 7827637-G-T **
7695648-G-T 7827607-G-T **
7662698-T-G 7794657-T-G **
7646750-T-G 7778709-T-G **
7633174-G-T 7765133-G-T **
7633162-G-T 7765121-G-T **
7633161-G-T 7765120-G-T **
7623673-G-T 7755632-G-T **
7621122-C-G 7753081-C-G **
7615133-C-A 7747092-C-A **
7579581-T-C 7711540-T-C **
7579110-G-T 7711069-G-T **
7564330-G-A 7696289-G-A **
7704893-C-A 7836852-C-A **
7474526-C-A 7606485-C-A IR1_L **
7467902-T-G 7599861-T-G IR1_L **
7467896-T-G 7599855-T-G IR1_L **
7451186-G-T 7583145-G-T IR1_L **
7425199-G-T 7557158-G-T **
7420745-T-G 7552704-T-G **
7414076-G-A 7546035-G-A **
7384822-A-C 7516781-A-C **
7368827-A-T 7500786-A-T **
7342332-T-C 7474291-T-C **
7342327-G-A 7474286-G-A **
7342315-T-G 7474274-T-G **
7342311-T-C 7474270-T-C **
7704885-C-A 7836844-C-A **
7705611-A-C 7837570-A-C **
7306700-G-T 7438659-G-T **
8077525-G-T 8209484-G-T **
8668504-A-C 8800463-A-C **
8644323-GC-G 8776282-GC-G **
8409065-A-C 8541024-A-C **
8384675-T-C 8516634-T-C **
8321634-C-A 8453593-C-A **
8293399-T-C 8425358-T-C **
8293395-C-A 8425354-C-A **
8293384-A-C 8425343-A-C **
8279986-G-T 8411945-G-T **
8269973-G-T 8401932-G-T **
8171837-A-C 8303796-A-C **
8167136-C-A 8299095-C-A **
8130590-G-C 8262549-G-C **
8057195-G-T 8189154-G-T **
7723051-A-C 7855010-A-C **
7986203-G-T 8118162-G-T **
7923894-A-C 8055853-A-C **
7897623-C-A 8029582-C-A **
7897613-A-C 8029572-A-C **
7897143-T-C 8029102-T-C **
7895355-G-T 8027314-G-T **
7895354-G-T 8027313-G-T **
7895336-G-T 8027295-G-T **
7873885-A-C 8005844-A-C **
4460331-G-T 4592290-G-T **
7774991-G-T 7906950-G-T **
7774986-G-T 7906945-G-T **
7774122-C-A 7906081-C-A **
7756816-C-A 7888775-C-A **
7322692-C-A 7454651-C-A **
7305701-G-T 7437660-G-T **
8668530-C-A 8800489-C-A **
7035225-G-T 7167184-G-T **
7132788-G-T 7264747-G-T **
7116163-G-T 7248122-G-T **
7111136-C-A 7243095-C-A **
7101176-A-G 7233135-A-G **
10789978-A-C **
7090601-C-A 7222560-C-A **
7081381-A-C 7213340-A-C **
7081260-T-C 7213219-T-C **
7080725-C-A 7212684-C-A **
7045646-T-C 7177605-T-C **
7043558-G-A 7175517-G-A **
7040049-C-T 7172008-C-T **
7038368-C-A 7170327-C-A **
7035205-G-T 7167164-G-T **
7134760-G-T 7266719-G-T **
7029627-C-A 7161586-C-A **
7019110-T-G 7151069-T-G **
7019014-A-C 7150973-A-C **
7019006-C-A 7150965-C-A **
7017935-C-A 7149894-C-A **
7012713-T-G 7144672-T-G **
7005567-G-T 7137526-G-T **
7005526-G-T 7137485-G-T **
7005500-G-T 7137459-G-T **
6976548-T-G 7108507-T-G **
6953409-G-T 7085368-G-T **
6945889-C-A 7077848-C-A **
6930086-C-A 7062045-C-A **
7134712-G-T 7266671-G-T **
7152975-G-T 7284934-G-T **
7296011-C-A 7427970-C-A **
7214343-G-C 7346302-G-C **
7288153-G-T 7420112-G-T **
7285227-C-A 7417186-C-A **
7277724-G-T 7409683-G-T **
7277699-G-T 7409658-G-T **
7258555-A-C 7390514-A-C **
7258535-T-C 7390494-T-C **
7255434-T-G 7387393-T-G **
7248060-A-C 7380019-A-C **
7246143-C-A 7378102-C-A **
7243826-C-A 7375785-C-A **
7233108-G-T 7365067-G-T **
10789977-C-G **
7222207-T-G 7354166-T-G **
7214328-A-C 7346287-A-C **
7167656-C-A 7299615-C-A **
7209985-C-A 7341944-C-A **
7207465-C-A 7339424-C-A **
7207457-A-C 7339416-A-C **
7202191-G-T 7334150-G-T **
7202169-G-T 7334128-G-T **
7202158-G-T 7334117-G-T **
7202156-G-T 7334115-G-T **
7202138-G-T 7334097-G-T **
7202117-G-T 7334076-G-T **
7202109-A-G 7334068-A-G **
7196221-A-C 7328180-A-C **
7185520-G-C 7317479-G-C **
7183812-C-A 7315771-C-A **
7179824-C-A 7311783-C-A **
8668522-C-A 8800481-C-A **
8673283-GT-G 8805242-GT-G **
6917823-G-T 7049782-G-T **
10654764-T-G **
10673811-T-A **
10669132-A-G **
10668920-T-G **
10667179-C-A **
10663463-T-C **
10660342-C-G **
10659562-C-A **
10659561-C-A **
10655971-T-TTACAC **
10655967-T-A **
10655830-G-T **
10655777-C-A **
10655776-C-A **
10630836-C-A **
10676707-C-A **
10630820-C-A **
10624493-G-T **
10624442-A-G **
10059552-C-T 10221943-C-T **
10057886-G-A 10220277-G-A **
10045367-A-G 10207758-A-G **
10037901-C-A 10200292-C-A **
10028344-A-G 10190735-A-G **
10026805-A-C 10189196-A-C **
10025413-A-C 10187804-A-C **
10025385-G-A 10187776-G-A **
10013436-G-A 10175827-G-A **
10010411-C-A 10172802-C-A **
10673817-C-T **
10676719-C-A **
10009433-C-A 10171824-C-A **
10757495-C-A **
10789972-C-T **
10786882-G-T **
10786621-G-C **
10781139-T-G **
10779776-C-A **
10779759-C-G **
10779002-A-G **
10769789-T-C **
10769292-T-G **
10768638-C-A **
10761084-G-T **
10759767-T-C **
10759444-A-G **
10757454-C-A **
10676726-C-A **
10752517-T-G **
10752512-T-G **
10752502-C-G **
10751869-C-A **
10751841-C-A **
10751353-G-T **
10751320-G-T **
10749995-C-A **
10683148-C-A **
10683140-C-A **
10683123-C-A **
10682954-C-T **
10679097-C-A **
10676765-C-A **
10009466-C-A 10171857-C-A **
10006117-C-A 10168508-C-A **
8679428-G-T 8811387-G-T **
8913832-C-A 9045791-C-A **
9040301-G-T 9202692-G-T **
9040271-T-G 9202662-T-G **
9040253-T-C 9202644-T-C **
9040236-C-G 9202627-C-G **
9029848-G-T 9192239-G-T **
9029830-G-T 9192221-G-T **
9025425-T-G 9187816-T-G **
8983076-A-C 9145467-A-C **
9125442-TTTTTC-T **
9112835-G-T **
9112824-G-C **
9056377-T-G **
9056342-C-G **
8865930-G-T 8997889-G-T **
9077344-C-A 9239735-C-A **
8865917-G-T 8997876-G-T **
8865905-C-G 8997864-C-G **
8856961-G-T 8988920-G-T **
8852323-G-T 8984282-G-T **
8852094-A-G 8984053-A-G **
8849960-G-T 8981919-G-T **
8849947-G-T 8981906-G-T **
8849926-G-T 8981885-G-T **
8805809-G-A 8937768-G-A **
8737791-C-A 8869750-C-A **
8737789-T-C 8869748-T-C **
8725168-C-T 8857127-C-T **
8714850-G-T 8846809-G-T **
9047601-G-T 9209992-G-T **
9221741-A-C 9384132-A-C **
9978529-C-G 10140920-C-G **
9874932-A-C 10037323-A-C **
9978526-C-A 10140917-C-A **
9978443-C-G 10140834-C-G **
9969707-C-G 10132098-C-G **
10789976-C-T **
9962422-G-C 10124813-G-C **
9962366-G-C 10124757-G-C **
9953443-G-T 10115834-G-T **
9934834-T-G 10097225-T-G **
9932583-T-G 10094974-T-G **
9923144-A-T 10085535-A-T **
9923082-G-T 10085473-G-T **
9891124-T-C 10053515-T-C **
9887033-G-C 10049424-G-C **
9830591-C-A 9992982-C-A **
9341038-C-T 9503429-C-T **
9823495-G-T 9985886-G-T **
9823490-G-T 9985881-G-T **
9823478-G-T 9985869-G-T **
9675402-A-C 9837793-A-C IR3_Prx **
9675394-A-C 9837785-A-C IR3_Prx **
9675086-T-C 9837477-T-C IR3_Prx **
9618216-C-T 9780607-C-T IR3_Prx **
9500050-G-T 9662441-G-T **
9461782-C-A 9624173-C-A **
9442274-G-T 9604665-G-T **
9440292-A-C 9602683-A-C **
9438060-C-A 9600451-C-A **
9371468-A-C 9533859-A-C **
9371449-G-T 9533840-G-T **
6926264-C-A 7058223-C-A **
7202146-G-T 7334105-G-T **
6911110-A-C 7043069-A-C **
5799912-G-A 5931871-G-A **
4804462-G-T 4936421-G-T **
5844330-G-T 5976289-G-T **
5827198-C-A 5959157-C-A **
4804649-G-T 4936608-G-T **
5817919-G-T 5949878-G-T **
4841670-C-A 4973629-C-A **
5809079-G-T 5941038-G-T **
4872631-G-T 5004590-G-T **
4872636-T-G 5004595-T-G **
4872648-G-T 5004607-G-T **
5809066-G-T 5941025-G-T **
4872656-G-T 5004615-G-T **
5796185-T-G 5928144-T-G **
4788346-G-T 4920305-G-T **
6891980-C-A 7023939-C-A **
5792333-C-A 5924292-C-A **
5761633-C-A 5893592-C-A **
4872686-G-T 5004645-G-T **
5761629-C-A 5893588-C-A **
5761591-C-A 5893550-C-A **
4877703-G-T 5009662-G-T **
5761560-A-C 5893519-A-C **
5755845-A-C 5887804-A-C **
5755838-C-A 5887797-C-A **
5755828-C-A 5887787-C-A **
5742505-G-T 5874464-G-T **
4888481-T-G 5020440-T-G **
4788450-T-G 4920409-T-G **
5845930-C-A 5977889-C-A **
5675471-C-A 5807430-C-A **
4687598-T-G 4819557-T-G **
6028233-T-G 6160192-T-G **
6028211-T-G 6160170-T-G **
4557656-C-A 4689615-C-A **
4959218-A-G 5091177-A-G **
6013703-C-A 6145662-C-A **
6010275-A-G 6142234-A-G **
5999212-G-T 6131171-G-T **
4626310-G-T 4758269-G-T **
4687541-G-T 4819500-G-T **
5967546-G-T 6099505-G-T **
5927457-C-A 6059416-C-A **
5911934-C-A 6043893-C-A **
5911924-G-C 6043883-G-C **
4700846-C-A 4832805-C-A **
5853751-C-A 5985710-C-A **
4769316-T-G 4901275-T-G **
4784841-A-G 4916800-A-G **
5911912-A-C 6043871-A-C **
4784968-C-A 4916927-C-A **
5911332-C-A 6043291-C-A **
5894331-C-A 6026290-C-A **
4788321-G-T 4920280-G-T **
5887616-G-T 6019575-G-T **
5867517-C-A 5999476-C-A **
5863996-T-C 5995955-T-C **
4788327-G-T 4920286-G-T **
5861612-C-A 5993571-C-A **
4788343-T-G 4920302-T-G **
5742482-G-T 5874441-G-T **
5612575-G-T 5744534-G-T **
6034333-A-C 6166292-A-C **
4936653-G-A 5068612-G-A **
5216330-C-A 5348289-C-A **
5200131-C-A 5332090-C-A **
5189510-T-G 5321469-T-G **
5189297-C-A 5321256-C-A **
4930318-G-T 5062277-G-T **
5186822-C-A 5318781-C-A **
5186439-C-A 5318398-C-A **
5127143-G-T 5259102-G-T **
5127128-T-G 5259087-T-G **
5127120-G-T 5259079-G-T **
4931015-A-C 5062974-A-C **
5125309-C-A 5257268-C-A **
4936657-G-A 5068616-G-A **
5246573-G-T 5378532-G-T **
4936662-G-T 5068621-G-T **
5107988-A-C 5239947-A-C **
5080450-G-T 5212409-G-T **
5061015-A-C 5192974-A-C **
4936703-T-G 5068662-T-G **
5022616-A-C 5154575-A-C **
5022526-A-C 5154485-A-C **
5022519-A-C 5154478-A-C **
4999797-G-T 5131756-G-T **
4999783-A-T 5131742-A-T **
4999062-A-C 5131021-A-C **
4961544-C-A 5093503-C-A **
4936704-T-G 5068663-T-G **
4928846-G-T 5060805-G-T **
5249269-T-G 5381228-T-G **
5612566-T-G 5744525-T-G **
5454809-G-T 5586768-G-T **
5609720-C-A 5741679-C-A **
4898075-G-T 5030034-G-T **
4898077-G-T 5030036-G-T **
5609384-C-A 5741343-C-A **
5597631-G-C 5729590-G-C **
4908827-T-G 5040786-T-G **
4908856-G-A 5040815-G-A **
5597583-G-T 5729542-G-T **
5577280-C-A 5709239-C-A **
5560609-T-C 5692568-T-C **
5559141-G-T 5691100-G-T **
4914835-G-T 5046794-G-T **
5494474-T-G 5626433-T-G **
5446458-T-G 5578417-T-G **
4926211-C-A 5058170-C-A **
5426147-G-T 5558106-G-T **
5426079-G-T 5558038-G-T **
5410033-C-A 5541992-C-A **
5387672-C-A 5519631-C-A **
5369114-C-A 5501073-C-A **
5369103-G-T 5501062-G-T **
5337011-C-A 5468970-C-A **
5336961-C-A 5468920-C-A **
5336337-G-T 5468296-G-T **
5336227-C-A 5468186-C-A **
4918849-A-C 5050808-A-C **
5336211-C-A 5468170-C-A **
5276048-G-T 5408007-G-T **
6034315-A-C 6166274-A-C **
4557809-A-C 4689768-A-C **
4547821-C-G 4679780-C-G **
6619504-T-C 6751463-T-C **
6731366-T-G 6863325-T-G **
6731330-G-T 6863289-G-T **
6723368-G-T 6855327-G-T **
6699094-G-C 6831053-G-C **
6671717-T-G 6803676-T-G **
6666277-T-G 6798236-T-G **
6666259-G-T 6798218-G-T **
6648033-C-A 6779992-C-A **
6646598-T-G 6778557-T-G **
6646579-T-G 6778538-T-G **
6601164-G-T 6733123-G-T **
4460714-A-C 4592673-A-C **
6601036-A-G 6732995-A-G **
6601035-G-T 6732994-G-T **
6601001-T-C 6732960-T-C **
6582308-T-G 6714267-T-G **
4540734-T-G 4672693-T-G **
6516354-T-G 6648313-T-G **
6516144-G-T 6648103-G-T 9×T**
6509455-G-T 6641414-G-T **
10796786-C-CG **
6492600-C-A 6624559-C-A **
6491208-C-A 6623167-C-A **
6751926-T-C 6883885-T-C **
6757719-G-T 6889678-G-T **
6379291-C-A 6511250-C-A **
6791366-T-C 6923325-T-C **
6858744-T-G 6990703-T-G **
6830592-G-T 6962551-G-T **
6830589-G-T 6962548-G-T **
6830559-G-T 6962518-G-T **
6826873-T-G 6958832-T-G **
6819011-T-C 6950970-T-C **
6819010-A-C 6950969-A-C **
6808050-G-A 6940009-G-A **
6795246-G-T 6927205-G-T **
6795237-G-T 6927196-G-T **
6791799-C-G 6923758-C-G **
6790142-A-C 6922101-A-C **
6767738-C-A 6899697-C-A **
6786831-G-T 6918790-G-T **
6786828-T-G 6918787-T-G **
6786823-G-T 6918782-G-T **
6776323-C-A 6908282-C-A **
6773232-G-T 6905191-G-T **
6773222-G-T 6905181-G-T **
6770033-C-A 6901992-C-A **
6769997-C-A 6901956-C-A **
10790046-C-A **
10790086-C-A **
6767878-G-T 6899837-G-T **
6478508-G-T 6610467-G-T **
6582245-A-G 6714204-A-G **
6368931-C-A 6500890-C-A **
6119586-T-G 6251545-T-G **
6165777-C-A 6297736-C-A IR3_Dst **
6165776-C-A 6297735-C-A IR3_Dst **
6133667-C-A 6265626-C-A **
6347555-C-A 6479514-C-A **
6129775-T-G 6261734-T-G **
6129769-T-G 6261728-T-G **
6119619-G-T 6251578-G-T **
6119608-G-T 6251567-G-T **
6119592-T-G 6251551-T-G **
6092437-G-T 6224396-G-T **
6213903-C-G 6345862-C-G IR3_Dst **
4505198-C-A 4637157-C-A **
4534116-T-C 4666075-T-C **
4537890-G-T 4669849-G-T **
6091241-T-C 6223200-T-C **
4540271-G-T 4672230-G-T **
6067881-C-A 6199840-C-A **
4540356-G-T 4672315-G-T **
6037540-C-A 6169499-C-A **
6034356-C-A 6166315-C-A **
4540416-G-T 4672375-G-T **
6165782-C-A 6297741-C-A IR3_Dst **
4959343-G-T 5091302-G-T **
6231556-G-T 6363515-G-T IR3_Dst **
4460756-A-C 4592715-A-C **
6321835-G-T 6453794-G-T IR3_Dst **
6321837-G-T 6453796-G-T IR3_Dst **
6321791-G-T 6453750-G-T IR3_Dst **
6321849-G-T 6453808-G-T IR3_Dst **
6231566-G-T 6363525-G-T IR3_Dst **
6321802-G-T 6453761-G-T IR3_Dst **
6293472-A-C 6425431-A-C IR3_Dst **
4473148-T-G 4605107-T-G **
19739338-G-GAA 17627458-G-GAA P5_Prx ***
13846644-A-G 11725938-A-G ***
19739340-A-AC 17627460-A-AC P5_Prx 13×AAC***
24363575-G-T 22217428-G-T ***
13838082-A-G 11717376-A-G ***
13853016-A-T 11732310-A-T ***
19955010-C-G 17843130-C-G P5_Prx ***
13818000-ATAGAC-A,T 11697294-ATAGAC-A,T ***
9307376-G-C 9469767-G-C ***
22229717-A-T 20067831-A-T DYZ19 ***
13846645-G-C 11725939-G-C ***
13820738-C-G 11700032-C-G ***
13851795-A-T 11731089-A-T ***
13804721-G-A 11684015-G-A ***
13832889-A-T 11712183-A-T ***
13851466-C-G 11730760-C-G ***
13851155-C-T 11730449-C-T ***
13822157-T-G 11701451-T-G ***
13822140-C-A 11701434-C-A ***
22247018-A-G 20085132-A-G DYZ19 ***
19411914-A-AG 17300034-A-AG 14×AAAG***
13839140-T-G 11718434-T-G ***
13845538-G-A 11724832-G-A ***
13660517-G-A 11504841-G-A ***
13866047-C-A 11745341-C-A ***
13867411-A-G 11746705-A-G ***
13868906-G-C 11748200-G-C ***
13869384-G-A 11748678-G-A ***
13864566-G-A 11743860-G-A ***
13860310-G-T 11739604-G-T ***
13808651-A-G 11687945-A-G ***
13813136-A-G 11692430-A-G ***
13704311-A-C 11548635-A-C ***
13869515-GA-G 11748809-GA-G ***
13869517-C-A 11748811-C-A ***
13838094-C-A 11717388-C-A ***
13843845-T-G 11723139-T-G ***
13139302-TTCAGTTGGAA-T 10628788-TTCAGTTGGAA-T ***
22229716-T-C 20067830-T-C DYZ19 ***
13815527-G-T 11694821-G-T ***
13859794-C-G 11739088-C-G ***
13817884-A-C 11697178-A-C ***
18290306-GAA-G 16178426-GAA-G P6_Prx ***
18518797-ATT-A 16406917-ATT-A P6_Dst ***
19411913-G-GAAAAGAA 17300033-G-GAAAAGAA ***
13838111-C-G 11717405-C-G ***
13805326-G-T 11684620-G-T ***
13701304-T-G 11545628-T-G ***
13802920-A-C 11682214-A-C ***
13454955-A-C 11299279-A-C ***
28785789-A-G 26639642-A-G ***
13453618-A-C,G 11297942-A-C,G 12×ATTCC***
28622298-G-T 26476151-G-T ***
13858737-A-C 11738031-A-C ***
58980897-T-C 56834750-T-C ***
22511357-T-G 20349471-T-G DYZ19 ***
13454940-T-C 11299264-T-C ***
13454941-T-A 11299265-T-A ***
13454954-G-C 11299278-G-C A8492 ***
13838132-T-G 11717426-T-G ***
58980637-T-C 56834490-T-C ***
13835244-C-G 11714538-C-G ***
13832625-A-G 11711919-A-G ***
13827201-C-A 11706495-C-A ***
13454969-G-C 11299293-G-C ***
13722474-T-G 11566798-T-G A8031 ***
13452683-T-C 11297007-T-C ***
13455107-C-T 11299431-C-T ***
28534296-C-A 26388149-C-A ***
13458130-CCGGTT-C 11302454-CCGGTT-C ***
13459211-CAACTG-C 11303535-CAACTG-C ***
13450481-T-C 11294805-T-C ***
13450476-T-C 11294800-T-C ***
13461120-C-A 11305444-C-A ***
8702810-G-GT,GTT 8834769-G-GT,GTT 21×T***
9959870-T-C 10122261-T-C ***
9991637-C-CA 10154028-C-CA 20×T***
9936569-A-G 10098960-A-G ***
9307374-C-G 9469765-C-G 10×TG***
9991643-T-C 10154034-T-C ***
10017694-T-TTTCTTTTC 10180085-T-TTTCTTTTC ***
10019304-A-AC,C 10181695-A-AC,C ***
10020578-G-T 10182969-G-T ***
9215342-T-G 9377733-T-G ***
13139347-T-C 10628833-T-C ***
13449889-T-TG 11294213-T-TG ***
13141089-ATTCCGTTTTG-A,ATTCCG 10630575-ATTCCGTTTTG-A,ATTCCG ***
13194832-T-C 11039156-T-C ***
58980489-A-C 56834342-A-C ***
58976407-C-T 56830260-C-T ***
13194939-T-A 11039263-T-A ***
22337969-T-C 20176083-T-C DYZ19 ***
22488101-C-A 20326215-C-A DYZ19 ***
13137968-C-A 10627454-C-A ***
13449888-A-AT 11294212-A-AT ***
13848301-C-T 11727595-C-T ***
13461119-A-T 11305443-A-T ***
13701288-A-G 11545612-A-G ***
13745270-G-C 11589594-G-C ***
13853037-C-G 11732331-C-G ***
13704312-T-A 11548636-T-A ***
13723777-C-G 11568101-C-G ***
13458216-A-C 11302540-A-C ***
13723780-G-A 11568104-G-A ***
13723783-T-G 11568107-T-G ***
13723797-C-G 11568121-C-G ***
13723807-G-A 11568131-G-A ***
13728525-G-T 11572849-G-T ***
13833471-G-C 11712765-G-C ***
13843619-T-G 11722913-T-G ***
13701301-G-A 11545625-G-A ***
13729967-A-G,T 11574291-A-G,T ***
13838091-A-G 11717385-A-G ***
13735946-G-C 11580270-G-C ***
13832645-C-A 11711939-C-A ***
13681125-C-G 11525449-C-G ***
6130283-A-T 6262242-A-T ***
13137270-G-T 10626756-G-T ***
23900658-G-A 21738772-G-A YSC0001228 ***
13489626-C-A 11333950-C-A ***
13745206-A-G 11589530-A-G ***
13458570-A-C 11302894-A-C FGC34645 ***
13701279-A-C 11545603-A-C ***
13465232-T-C 11309556-T-C ***
13650683-A-G 11495007-A-G ***
13465253-A-G 11309577-A-G ***
13459218-C-T 11303542-C-T ***
13468339-C-T 11312663-C-T ***
13471888-G-A 11316212-G-A ***
13472522-A-C,G 11316846-A-C,G ***
13478521-G-T 11322845-G-T ***
10011960-T-C 10174351-T-C ***
28784322-G-A 26638175-G-A ***
13489622-C-A 11333946-C-A ***
13662029-GCAAAC-G 11506353-GCAAAC-G ***
13697797-A-G 11542121-A-G ***
13866960-G-A 11746254-G-A ***
13862243-A-C 11741537-A-C ***
13667150-T-C 11511474-T-C ***
13667161-T-G 11511485-T-G ***
13667162-C-A 11511486-C-A ***
13667259-C-A 11511583-C-A ***
13667280-G-T 11511604-G-T ***
13667281-T-G 11511605-T-G ***
13686927-G-C 11531251-G-C ***
13694387-G-T 11538711-G-T ***
22281998-C-A 20120112-C-A DYZ19 ***
7801069-T-G 7933028-T-G ***
22421406-T-C 20259520-T-C DYZ19 ***
14194905-C-T 12074199-C-T ***
19404042-G-T 17292162-G-T ***
19318150-C-A 17206270-C-A ***
19254637-A-G 17142757-A-G ***
14073575-G-A 11952869-G-A ***
13710031-A-G 11554355-A-G ***
8282355-C-A 8414314-C-A ***
19061330-G-T 16949450-G-T ***
10780669-T-C,G ***
6889090-C-A 7021049-C-A ***
14366244-A-C 12245539-A-C ***
6790066-C-A 6922025-C-A ***
17050098-TC-C,TT 14938218-TC-C,TT ***
6768762-GAAAAAAA-G,GAAAAAA 6900721-GAAAAAAA-G,GAAAAAA 17×A***
14439162-C-A 12318435-C-A ***
14443189-G-T 12322462-G-T ***
13489875-C-A 11334199-C-A ***
7228198-C-A 7360157-C-A ***
18412426-A-G 16300546-A-G P6_Gap ***
7645153-C-A 7777112-C-A ***
10763146-C-T ***
13643117-C-A 11487441-C-A ***
9583457-C-CT 9745848-C-CT IR3_Prx 10×T***
21163295-C-A 19001409-C-A ***
7759978-C-A 7891937-C-A ***
16518593-TAAA-T 14406713-TAAA-T 14×A***
21036037-C-A 18874151-C-A ***
7986190-G-T 8118149-G-T ***
2783708-G-A 2915667-G-A ***
13709436-G-T 11553760-G-T ***
24003035-G-T 21856888-G-T ***
6654207-C-A 6786166-C-A ***
7335517-C-A 7467476-C-A ***
10980740-A-T ***
13849966-C-A 11729260-C-A ***
9892677-G-T 10055068-G-T ***
14517856-G-T 12406057-G-T ***
56833468-C-T ***
16749706-A-G 14637826-A-G ***
14985950-C-A 12874018-C-A ***
17064726-C-A 14952846-C-A ***
5426530-C-T 5558489-C-T ***
17039222-G-T 14927342-G-T ***
5267132-G-T 5399091-G-T ***
16818971-GTATATATATATATATATATATA-G 14707091-GTATATATATATATATATATATA-G 21×TA***
15475468-G-T 13363588-G-T ***
2851036-G-T 2982995-G-T ***
15496498-G-T 13384618-G-T ***
15557898-C-A 13446018-C-A ***
16491262-C-A 14379382-C-A ***
15844958-G-T 13733078-G-T ***
16275246-C-A 14163366-C-A ***
4129195-G-T 4261154-G-T ***
16047727-C-A 13935847-C-A ***
17254670-C-A 15142790-C-A ***
17466501-C-A 15354621-C-A ***
14519662-T-G 12407863-T-G ***
7233196-G-T 7365155-G-T ***
18266117-C-A 16154237-C-A ***
18232351-C-A 16120471-C-A ***
6346123-TA-T 6478082-TA-T ***
14586335-G-T 12474535-G-T ***
14594763-C-A 12482963-C-A ***
14604590-CTT-C,CTTT 12492792-CTT-C,CTTT 21×T***
15363865-C-A 13251985-C-A ***
14287032-G-T 12166326-G-T ***
5911505-G-T 6043464-G-T ***
14698307-A-C 12586373-A-C ***
14714557-C-A 12602624-C-A ***
2685567-C-A 2817526-C-A ***
17536565-C-A 15424685-C-A ***
2741263-G-T 2873222-G-T ***
2817235-G-T 2949194-G-T ***
13624352-GTA-G,GTATA 11468676-GTA-G,GTATA 11×TA***
7896761-T-C 8028720-T-C ***
22421419-G-C 20259533-G-C DYZ19 ***
8486934-CAA-C 8618893-CAA-C 12×A***
58977244-C-T 56831097-C-T ***
58978494-C-T 56832347-C-T ***
58978666-T-C 56832519-T-C ***
58979093-C-T 56832946-C-T ***
58979654-A-C,T 56833507-A-C,T ***
13821248-A-C 11700542-A-C ***
23464719-C-T 21302833-C-T ***
58975176-G-C 56829029-G-C ***
23761603-G-GAAGAA 21599717-G-GAAGAA ***
13701339-AACTCGAATGGAATGC-A 11545663-AACTCGAATGGAATGC-A ***
10776371-C-A ***
23311228-C-A 21149342-C-A ***
13484074-A-C 11328398-A-C ***
23259108-C-A 21097222-C-A ***
23152862-G-T 20990976-G-T ***
58975181-G-C 56829034-G-C ***
58975175-T-C 56829028-T-C ***
13451979-ACACCACTCCACTGCT-A,ACTCCACTCCACTGCT 11296303-ACACCACTCCACTGCT-A,ACTCCACTCCACTGCT ***
22490793-C-A 20328907-C-A DYZ19 ***
22430009-G-A 20268123-G-A DYZ19 ***
22442491-T-A 20280605-T-A DYZ19 ***
22442492-A-G 20280606-A-G DYZ19 ***
22442493-C-T 20280607-C-T DYZ19 ***
22443408-C-A 20281522-C-A DYZ19 ***
22443410-T-C 20281524-T-C DYZ19 ***
22450333-T-G 20288447-T-G DYZ19 ***
26730200-GAAAAGAA-G 24584053-GAAAAGAA-G P1_g2 ***
58975161-G-C 56829014-G-C ***
26730208-AG-A 24584061-AG-A P1_g2 ***
28799136-T-G 26652989-T-G ***
58820458-T-A 56770413-A-T ***
58830512-C-T 56760359-G-A ***
58858906-CCATTCCATTG-C 56731945-GAATGGAATGC-G ***
58866000-A-T 56724871-T-A ***
58908822-A-T 56682049-T-A ***
23138249-G-T 20976363-G-T ***
13817892-C-A,G 11697186-C-A,G ***
7992349-G-T 8124308-G-T ***
8437628-G-T 8569587-G-T ***
13473647-T-A 11317971-T-A ***
13473659-C-A 11317983-C-A ***
13489884-C-A 11334208-C-A ***
14715542-G-T 12603609-G-T ***
13478292-T-G 11322616-T-G ***
8479616-G-T 8611575-G-T ***
8431424-A-G 8563383-A-G ***
13463630-T-C 11307954-T-C ***
56835688-C-CATTCT ***
23824949-C-A 21663063-C-A ***
8172877-C-CA 8304836-C-CA ***
8172856-T-TC 8304815-T-TC ***
8016842-A-C 8148801-A-C ***
21367175-C-A 19205289-C-A ***
8008900-G-A 8140859-G-A ***
10925553-C-T ***
8715223-C-T 8847182-C-T ***
10783762-A-ACCATTCCATT ***
10925555-G-T ***
22768349-A-T 20606463-A-T ***
22766776-G-T 20604890-G-T ***
22527127-C-A 20365241-C-A ***
10028437-G-T 10190828-G-T ***
22441633-C-T 20279747-C-T DYZ19 ***
13484064-G-A 11328388-G-A ***
56826837-CATTCCATTCGATTCCATTCCATTCAATTCC-C,CATTCCATTCGATTCCATTCCATTCGATTAG ***
56833478-C-A ***
56833459-A-ATTCCA,ATTCCT ***
9509900-G-T 9672291-G-T ***
10925500-A-T ***
56829970-CTCCAATCCAT-C,CTCCACTCCAC ***
10899925-GCATTC-G ***
10807238-C-T ***
21902261-T-G 19740375-T-G ***
56833447-C-T ***
58865999-T-A 56724872-A-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Milligan1325141011-13121211131429189-1011112515183015-16-17-18111019-231715191838-41121211915-1681010810101221-231610121216811252013121113111112123615916122426191211121211913121011113012142413101022151913231713152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1355501049670776582947748935
Kit: 135550958016678163207730053
Used in age calculations1049670778163207748935
Counts of SNPs11
Variant counts last updated 2018-02-23 00:38:21.



Big Tree Main Page