Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > A223 > BY3339 > A224 > FGC33468

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
229652
FGC
LBLUN
13344195-G-C 11188519-G-C FGC33467 +
23497872-C-A 21335986-C-A FGC33472 YY++
22545246-T-C 20383360-T-C FGC33470 Y+
22879648-A-G 20717762-A-G FGC33471 Y+
13343262-A-C 11187586-A-C FGC33466 +
28577941-CACACATTAT-C 26431794-CACACATTAT-C **
8277185-A-C 8409144-A-C **
21997966-G-T 19836080-G-T **
4871188-T-G 5003147-T-G **
10065908-TA-T 10228299-TA-T **
25633786-A-G 23487639-A-G P1_b3 **
26260586-G-T 24114439-G-T P1_Y1 **
6451089-T-G 6583048-T-G **
7004354-A-G 7136313-A-G **
58882402-C-T 56708469-G-A **
13711041-T-G 11555365-T-G **
14771285-G-A 12659354-G-A CTS3257 **
18767108-G-A 16655228-G-A **
4862550-G-A 4994509-G-A **
19937283-CG-C 17825403-CG-C P5_Prx **
5275834-T-C 5407793-T-C **
5275872-A-C 5407831-A-C Y60647 **
22641039-T-A 20479153-T-A **
13869547-C-A 11748841-C-A **
22780298-T-A 20618412-T-A **
13452845-CCTCCTTTT-C 11297169-CCTCCTTTT-C **
6451091-T-C 6583050-T-C **
13308872-T-C 11153196-T-C **
13268061-A-C 11112385-A-C **
23517097-G-T 21355211-G-T **
8277192-T-G 8409151-T-G **
20334325-C-A 18172439-C-A P5_Dst ***
20326058-C-T 18164172-C-T P5_Dst ***
20128808-C-T 18016928-C-T P5_Dst ***
13466611-G-A 11310935-G-A ***
20001983-G-A 17890103-G-A P5_Prx ***
19997215-G-T 17885335-G-T P5_Prx ***
19845452-G-T 17733572-G-T P5_Prx ***
19758640-G-T 17646760-G-T P5_Prx ***
13466594-G-C 11310918-G-C ***
20376284-T-A 18214398-T-A P5_Dst ***
19746929-C-T 17635049-C-T P5_Prx ***
19691898-A-G 17580018-A-G P5_Prx ***
19611249-G-T 17499369-G-T P5_Prx ***
19325748-G-T 17213868-G-T ***
19753693-C-T 17641813-C-T P5_Prx 25×T***
20895060-G-T 18733174-G-T P4_Dst ***
20510937-G-T 18349051-G-T P5_Dst ***
21745972-A-T 19584086-A-T ***
22838805-A-G 20676919-A-G ***
22692190-C-A 20530304-C-A ***
22343095-G-A 20181209-G-A DYZ19 ***
22262569-C-T 20100683-C-T DYZ19 ***
22249615-A-T 20087729-A-T DYZ19 ***
22224548-T-A 20062662-T-A DYZ19 ***
22150018-T-C 19988132-T-C ***
21949662-T-C 19787776-T-C ***
21945055-C-T 19783169-C-T ***
21417370-G-T 19255484-G-T ***
20516638-G-T 18354752-G-T P5_Dst ***
21387200-T-G 19225314-T-G ***
21387190-C-A 19225304-C-A ***
21238252-C-A 19076366-C-A ***
21208259-A-G 19046373-A-G ***
21029732-G-A 18867846-G-A P4_Dst ***
19001090-G-C 16889210-G-C ***
20645894-A-T 18484008-A-T P4_Prx ***
20569138-T-C 18407252-T-C P5_Dst ***
20554824-C-A 18392938-C-A P5_Dst ***
19040406-T-A 16928526-T-A ***
18511265-C-A 16399385-C-A P6_Dst ***
18879438-G-A 16767558-G-A ***
13743747-T-C 11588071-T-C ***
14741381-G-T 12629449-G-T ***
14740210-G-A 12628278-G-A ***
14738856-C-T 12626924-C-T ***
14738848-G-C 12626916-G-C ***
14738847-A-T 12626915-A-T ***
14671689-A-G 12559755-A-G ***
14250819-C-G 12130113-C-G ***
14167247-G-T 12046541-G-T ***
14121067-G-T 12000361-G-T ***
13878295-A-C 11757589-A-C ***
13731621-C-T 11575945-C-T ***
15142120-G-A 13030207-G-A ***
13711116-A-C 11555440-A-C ***
13711103-T-C 11555427-T-C ***
13710542-G-T 11554866-G-T ***
13709604-T-G 11553928-T-G ***
13608610-C-T 11452934-C-T ***
13488159-G-C 11332483-G-C ***
13478672-C-T 11322996-C-T ***
13478364-G-T 11322688-G-T ***
13478302-C-T 11322626-C-T ***
13478294-C-G 11322618-C-G ***
13477364-C-A 11321688-C-A ***
14986629-T-C 12874697-T-C ***
15147855-C-A 13035942-C-A ***
18879432-T-C 16767552-T-C ***
17428771-A-T 15316891-A-T ***
18879423-G-A 16767543-G-A ***
18879422-T-C 16767542-T-C ***
13470955-G-A 11315279-G-A F10781 ***
23169750-G-A 21007864-G-A ***
18231771-A-T 16119891-A-T ***
18139288-G-T 16027408-G-T FGC36288 ***
18138889-C-A 16027009-C-A ***
18121431-C-G 16009551-C-G ***
18054233-T-C 15942353-T-C ***
17994838-C-A 15882958-C-A P7_Prx ***
17372529-T-C 15260649-T-C ***
15148043-C-A 13036130-C-A ***
17160644-C-T 15048764-C-T ***
16976968-C-A 14865088-C-A ***
16976965-T-C 14865085-T-C ***
16665085-C-A 14553205-C-A ***
16432805-G-A 14320925-G-A ***
16152400-A-G 14040520-A-G P8_Dst ***
15769337-G-T 13657457-G-T ***
15685511-G-T 13573631-G-T ***
15641623-A-C 13529743-A-C ***
15595570-G-T 13483690-G-T ***
15595365-T-G 13483485-T-G ***
18275296-T-A 16163416-T-A P6_Prx ***
13452843-C-T 11297167-C-T ***
23223346-G-C 21061460-G-C ***
58904937-A-T 56685934-T-A ***
2984950-C-CTA 3116909-C-CTA 16×TA***
6493953-CAA-C 6625912-CAA-C 19×A***
16729172-GT-G 14617292-GT-G 22×T***
13268061-AG-CA 11112385-AG-CA ***
16679404-A-AT 14567524-A-AT 18×T***
9231698-AACACACAC-A 9394089-AACACACAC-A 22×AC***
58988839-G-T 56842692-G-T ***
58984581-T-C 56838434-T-C ***
58980114-T-C 56833967-T-C ***
58980112-C-A 56833965-C-A ***
58912792-C-G 56678079-G-C ***
58893770-G-C 56697101-C-G ***
3822962-G-GAT 3954921-G-GAT 26×AT***
58893752-T-A 56697119-A-T ***
58888950-C-A 56701921-G-T ***
58885197-A-G 56705674-T-C ***
58882431-T-A 56708440-A-T ***
58876509-C-A 56714362-G-T ***
58876499-C-G 56714372-G-C ***
58866644-T-A 56724227-A-T ***
58862808-G-C 56728063-C-G ***
58862786-T-C 56728085-A-G ***
58860503-G-T 56730368-C-A ***
58855454-A-G 56735417-T-C ***
3240658-A-AT 3372617-A-AT 13×T***
4983174-ATT-A 5115133-ATT-A 28×T***
58843152-T-C 56747719-A-G ***
22520620-C-CTTT 20358734-C-CTTT ***
13839846-T-C,G 11719140-T-C,G ***
13453613-CTTTTA-C,CATTCCATTCCATTCCATTCC 11297937-CTTTTA-C,CATTCCATTCCATTCCATTCC ***
59002261-AAAA-G 56856114-AAAA-G ***
58973209-GAG-CAA 56827062-GAG-CAA ***
58972018-AT-A 56825871-AT-A ***
58912334-ACTCC-TCTCT 56678533-GGAGT-AGAGA ***
58882400-GGC-TGT 56708469-GCC-ACA ***
27583000-CT-C 25436853-CT-C P1_Y2 22×T***
25964727-CT-C 23818580-CT-C P1_Y1 16×T***
25845058-TGAAT-AGAAA 23698911-TGAAT-AGAAA P1_b3 ***
24096349-C-CA 21950202-C-CA P3_b1 16×A***
21346975-T-TATATATA 19185089-T-TATATATA 29×TA***
6451089-TAT-GAC 6583048-TAT-GAC ***
18395723-TTATATATA-T 16283843-TTATATATA-T P6_Gap 27×TA***
16297330-G-GT 14185450-G-GT 26×T***
15278818-T-TATATC 13166915-TTTATA-ATCATT ***
13739697-AGAATGGAATG-A 11584021-AGAATGGAATG-A 8×GAATG***
13709690-TAATG-GAATC 11554014-TAATG-GAATC ***
13488186-GC-TT 11332510-GC-TT ***
13488169-GCCATC-AACATT 11332493-GCCATC-AACATT ***
13483122-ATCA-GTCG 11327446-ATCA-GTCG ***
13459320-GCAT-TCAC 11303644-GCAT-TCAC 5×CATTC***
13346776-C-CA 11191100-C-CA 13×A***
13279998-CAAAAAAAAA-C 11124322-CAAAAAAAAA-C 26×A***
58845492-C-A 56745379-G-T ***
58833801-T-C 56757070-A-G ***
23464748-G-T 21302862-G-T ***
25099683-C-A 22953536-C-A g1 ***
26133013-C-A 23986866-C-A P1_Y1 ***
26055308-C-G 23909161-C-G P1_Y1 ***
26055294-T-C 23909147-T-C P1_Y1 ***
26055291-T-C 23909144-T-C P1_Y1 ***
26055290-C-T 23909143-C-T P1_Y1 ***
25971325-C-A 23825178-C-A P1_Y1 ***
25722462-T-A 23576315-T-A P1_b3 ***
25628401-G-T 23482254-G-T P1_b3 ***
25207797-T-A 23061650-T-A P2_r1 ***
25176091-C-A 23029944-C-A g1 ***
25151189-G-A 23005042-G-A g1 ***
24966356-A-G 22820209-A-G g1 ***
26334790-A-T 24188643-A-T P1_Y1 ***
24960531-G-T 22814384-G-T g1 ***
24841721-A-T 22695574-A-T P3_b2 ***
24671389-A-T 22525242-A-T P3_b2 ***
24657707-G-A 22511560-G-A P3_b2 ***
24305131-A-T 22158984-A-T P3_t1 ***
24290896-G-A 22144749-G-A P3_t1 ***
24235379-G-A 22089232-G-A P3_b1 ***
24218300-C-T 22072153-C-T P3_b1 ***
13466589-G-A 11310913-G-A ***
24047092-G-T 21900945-G-T ***
23838005-G-A 21676119-G-A ***
26325625-C-T 24179478-C-T P1_Y1 ***
26500152-A-G 24354005-A-G P1_Y1 ***
58827198-T-C 56763673-A-G ***
28117315-A-T 25971168-A-T P1_b4 ***
58827044-A-T 56763827-T-A ***
58823277-C-A 56767594-G-T ***
28694062-G-T 26547915-G-T ***
28639344-A-T 26493197-A-T ***
28491931-G-T 26345784-G-T ***
28489131-T-C 26342984-T-C ***
28428333-C-T 26282186-C-T P1_gr2 ***
28385829-T-C 26239682-T-C P1_gr2 ***
28353238-T-C 26207091-T-C P1_gr2 ***
28239726-C-T 26093579-C-T P1_b4 ***
28210114-T-C 26063967-T-C P1_b4 ***
28076495-T-C 25930348-T-C P1_Y2 7×TTCC***
27078256-A-G 24932109-A-G P1_r4 ***
28024031-T-C 25877884-T-C P1_Y2 ***
28022733-G-T 25876586-G-T P1_Y2 ***
27997471-A-C 25851324-A-C P1_Y2 ***
27861770-G-T 25715623-G-T P1_Y2 ***
27856702-G-C 25710555-G-C P1_Y2 ***
27842662-C-A 25696515-C-A P1_Y2 ***
27835379-C-T 25689232-C-T P1_Y2 ***
27733530-T-A 25587383-T-A P1_Y2 ***
27676650-A-T 25530503-A-T P1_Y2 ***
27543001-G-T 25396854-G-T P1_Y2 ***
27266800-C-A 25120653-C-A P1_g3 ***
27266046-G-A 25119899-G-A P1_g3 ***
24080679-C-T 21934532-C-T P3_b1 ***
13222365-A-G 11066689-A-G ***
13459331-C-G 11303655-C-G ***
13833422-G-C 11712716-G-C ***
58858939-C-A 56731932-G-T ***
25257713-G-A 23111566-G-A P2_r1 ***
24915837-C-A 22769690-C-A g1 ***
22359557-G-C 20197671-G-C DYZ19 ***
22219443-C-T 20057557-C-T DYZ19 ***
19966688-AAAGAAGAAG-A,AAAGAAG 17854808-AAAGAAGAAG-A,AAAGAAG P5_Prx 26×AAG***
19949608-GT-G 17837728-GT-G P5_Prx 16×T***
13866079-C-T 11745373-C-T ***
13858479-C-G 11737773-C-G ***
13846549-C-A 11725843-C-A ***
13728881-A-C 11573205-A-C ***
58978772-G-A 56832625-G-A ***
13714804-C-T 11559128-C-T ***
13714765-T-G 11559089-T-G ***
13713797-G-A 11558121-G-A ***
13711079-G-C 11555403-G-C ***
13711050-C-G 11555374-C-G ***
13705872-T-A 11550196-T-A ***
13459640-T-A 11303964-T-A ***
13455112-T-C 11299436-T-C ***
13454223-T-A,TTTCCATTCCATTCCA 11298547-T-A,TTTCCATTCCATTCCA 12×TTCCA***
13452944-C-G 11297268-C-G ***
13452730-G-C 11297054-G-C ***
58973991-CACTCG-C 56827844-CACTCG-C ***
58978792-T-A 56832645-T-A ***
13142946-C-T 10632432-C-T ***
13440910-CA-AG 11285234-CA-AG ***
14025618-A-G 11904912-A-G F18353 ***
22343182-T-A 20181296-T-A DYZ19 ***
22297068-A-T 20135182-A-T DYZ19 ***
26344423-C-T 24198276-C-T P1_Y1 28×T***
22335808-C-T 20173922-C-T DYZ19 ***
13708379-T-A 11552703-T-A ***
13253182-C-T 11097506-C-T ***
3543166-CA-C 3675125-CA-C 14×A***
13712907-C-A 11557231-C-A ***
13488148-A-G 11332472-A-G ***
6521551-G-GT 6653510-G-GT 17×T***
58980054-C-T 56833907-C-T ***
13470945-C-T 11315269-C-T ***
13470935-T-G 11315259-T-G ***
13470915-A-T 11315239-A-T ***
13664693-AGAAAG-A 11509017-AGAAAG-A ***
22491445-T-G 20329559-T-G DYZ19 ***
13306703-G-T 11151027-G-T ***
13714172-CACTC-TACTG 11558496-CACTC-TACTG ***
22266400-C-G 20104514-C-G DYZ19 ***
13488215-C-G 11332539-C-G ***
13478337-C-T 11322661-C-T ***
59004604-G-A 56858457-G-A ***
13452727-T-A 11297051-T-A ***
22247629-G-T 20085743-G-T DYZ19 ***
13466547-G-T 11310871-G-T ***
13851405-G-T 11730699-G-T ***
13652249-T-A 11496573-T-A ***
13691560-CACGAATGGAATGGAG-C 11535884-CACGAATGGAATGGAG-C ***
13810213-C-G 11689507-C-G ***
13705871-C-A 11550195-C-A ***
26169893-TA-T 24023746-TA-T P1_Y1 10×A***
58975532-G-C 56829385-G-C ***
13661234-G-T 11505558-G-T ***
9945373-T-C 10107764-T-C ***
13869339-G-C 11748633-G-C ***
13867261-G-T 11746555-G-T ***
25324285-GT-G 23178138-GT-G P2_r1 11×T***
13453992-A-G 11298316-A-G ***
28790460-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G 26644313-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G ***
13715385-C-G 11559709-C-G ***
13692194-A-T 11536518-A-T ***
22440118-C-T 20278232-C-T BY32328 DYZ19 ***
13869466-A-C 11748760-A-C ***
13869463-T-A 11748757-T-A ***
24222264-CTT-C 22076117-CTT-C P3_b1 15×T***
22360808-G-C 20198922-G-C DYZ19 ***
13714045-T-A 11558369-T-A ***
13712935-G-A 11557259-G-A BY25678 ***
10024136-G-T 10186527-G-T ***
13453972-A-G 11298296-A-G ***
13452813-C-T 11297137-C-T ***
13699474-C-T 11543798-C-T ***
19792672-CT-C 17680792-CT-C P5_Prx 11×T***
23311147-T-TTTTCTTTC 21149261-T-TTTTCTTTC 15×TTTC***
58975536-G-C,T 56829389-G-C,T ***
25931592-G-GAAGGAAGA 23785445-G-GAAGGAAGA P1_Y1 14×AAGA***
26902327-G-A 24756180-G-A P1_r3 ***
13839745-G-A 11719039-G-A ***
13817987-G-A 11697281-G-A ***
13817967-G-C 11697261-G-C ***
13817958-G-A 11697252-G-A ***
9985773-T-G 10148164-T-G ***
9985772-G-T 10148163-G-T ***
13142948-G-C 10632434-G-C 11×CATTC***
9945421-A-G 10107812-A-G ***
13704469-A-G 11548793-A-G ***
10038700-G-A 10201091-G-A ***
10038697-T-C 10201088-T-C ***
10038695-G-A 10201086-G-A ***
13600363-G-GA 11444687-G-GA ***
58974006-C-T 56827859-C-T ***
13700173-C-A,T 11544497-C-A,T ***
13833439-T-A,G 11712733-T-A,G ***
13833435-T-A 11712729-T-A ***
13459238-T-C 11303562-T-C ***
13805355-T-C 11684649-T-C ***
22237131-A-T 20075245-A-T DYZ19 ***
13466559-G-T 11310883-G-T ***
13440938-G-A 11285262-G-A ***
6473300-A-G 6605259-A-G ***
8277151-G-T 8409110-G-T ***
7996480-A-G 8128439-A-G ***
7984929-A-G 8116888-A-G ***
7442362-G-T 7574321-G-T ***
7438933-A-T 7570892-A-T ***
7061908-G-T 7193867-G-T ***
6946021-C-T 7077980-C-T ***
6749068-T-A 6881027-T-A ***
6566472-G-C 6698431-G-C ***
6533570-T-C 6665529-T-C ***
6333479-T-C 6465438-T-C IR3_Dst ***
8293188-A-G 8425147-A-G ***
6311925-T-G 6443884-T-G IR3_Dst ***
6250325-A-C 6382284-A-C IR3_Dst ***
6215748-G-T 6347707-G-T IR3_Dst ***
6200199-C-A 6332158-C-A IR3_Dst ***
6158720-C-T 6290679-C-T IR3_Dst ***
6118984-G-T 6250943-G-T ***
6015996-T-C 6147955-T-C ***
6015988-G-C 6147947-G-C ***
6015987-G-C 6147946-G-C ***
5992821-T-C 6124780-T-C ***
5841208-C-T 5973167-C-T ***
8277158-C-T 8409117-C-T ***
9577350-C-A 9739741-C-A IR3_Prx ***
5683787-C-A 5815746-C-A ***
10065888-G-A 10228279-G-A ***
13342091-G-T 11186415-G-T ***
13334896-G-A 11179220-G-A ***
13315375-G-T 11159699-G-T ***
13313546-A-T 11157870-A-T ***
13312671-C-T 11156995-C-T ***
13254554-G-T 11098878-G-T ***
13213824-T-C 11058148-T-C ***
10065915-G-T 10228306-G-T ***
10065899-G-A 10228290-G-A ***
10065897-C-T 10228288-C-T ***
10065887-T-C 10228278-T-C ***
9628465-G-T 9790856-G-T IR3_Prx ***
9949430-C-A 10111821-C-A ***
9949413-A-T 10111804-A-T ***
9949392-G-A 10111783-G-A ***
9949389-C-T 10111780-C-T ***
9949387-C-T 10111778-C-T ***
9949383-G-A 10111774-G-A ***
9927078-C-T 10089469-C-T ***
9923620-T-C 10086011-T-C ***
9779022-C-A 9941413-C-A ***
9725030-T-G 9887421-T-G IR3_Prx ***
9713964-A-T 9876355-A-T IR3_Prx ***
5684150-C-T 5816109-C-T ***
5155760-G-A 5287719-G-A ***
5659707-GTATATATA-G 5791666-GTATATATA-G 28×TA***
22876964-TA-T 20715078-TA-T 20×A***
58848948-C-A 56741923-G-T ***
13709694-G-C 11554018-G-C ***
13440870-A-T 11285194-A-T ***
13267382-C-G 11111706-C-G ***
58841013-T-C 56749858-A-G ***
28117311-A-T 25971164-A-T P1_b4 ***
28117307-A-T 25971160-A-T P1_b4 ***
26991325-A-T 24845178-A-T P1_r4 ***
25207819-T-A 23061672-T-A P2_r1 ***
22266383-G-T 20104497-G-T DYZ19 ***
22366299-A-C 20204413-A-C DYZ19 ***
28253470-T-A 26107323-T-A P1_b4 ***
13569498-G-A 11413822-G-A ***
13466571-G-T 11310895-G-T ***
13440911-A-G 11285235-A-G ***
13440910-C-A 11285234-C-A ***
13440887-C-A 11285211-C-A ***
13292727-C-T 11137051-C-T ***
13279768-C-T 11124092-C-T ***
13267454-G-A 11111778-G-A ***
13267083-G-A 11111407-G-A ***
13262312-G-A 11106636-G-A ***
7028566-T-G 7160525-T-G ***
24235336-G-A 22089189-G-A P3_b1 ***
3588094-GTATA-G 3720053-GTATA-G 24×TA***
5148692-T-C 5280651-T-C ***
2758629-C-A 2890588-C-A ***
5112786-G-A 5244745-G-A ***
4932827-G-A 5064786-G-A ***
4727241-G-A 4859200-G-A ***
4438972-G-A 4570931-G-A ***
4421328-T-A 4553287-T-A ***
4289149-T-C 4421108-T-C ***
4288484-A-G 4420443-A-G ***
3663018-C-A 3794977-C-A ***
3611993-G-T 3743952-G-T ***
3576522-A-G 3708481-A-G ***
3457987-A-T 3589946-A-T ***
2688596-A-T 2820555-A-T ***
13569580-GGC-AGT 11413904-GGC-AGT ***
13222324-A-T 11066648-A-T ***
58916377-G-C 56674494-C-G ***
13711752-C-A 11556076-C-A BY40221 ***
9929292-T-C 10091683-T-C ***
9929301-G-A 10091692-G-A ***
7155780-TA-T 7287739-TA-T 14×A***
28577985-C-A 26431838-C-A ***
28577983-A-G 26431836-A-G ***
13478300-C-T 11322624-C-T ***
17474945-C-CT 15363065-C-CT 15×T***
58859102-G-T 56731769-C-A ***
59004622-AGGAA-A,AG 56858475-AGGAA-A,AG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page