Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > A223 > BY3339 > A224 > FGC33468

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
229652
FGC
LBLUN
22545246-T-C 20383360-T-C FGC33470 Y+
23497872-C-A 21335986-C-A FGC33472 YY++
13343262-A-C 11187586-A-C FGC33466 +
22879648-A-G 20717762-A-G FGC33471 Y+
13344195-G-C 11188519-G-C FGC33467 +
4871188-T-G 5003147-T-G **
58882402-C-T 56708469-G-A **
25633786-A-G 23487639-A-G P1_b3 **
6451089-T-G 6583048-T-G **
4862550-G-A 4994509-G-A **
10065908-TA-T 10228299-TA-T **
58998125-A-G 56851978-A-G **
18767108-G-A 16655228-G-A **
14771285-G-A 12659354-G-A CTS3257 **
26260586-G-T 24114439-G-T P1_Y1 **
13268061-A-C 11112385-A-C **
13869547-C-A 11748841-C-A **
19937283-CG-C 17825403-CG-C P5_Prx **
6451091-T-C 6583050-T-C **
7004354-A-G 7136313-A-G **
5275834-T-C 5407793-T-C **
28577941-CACACATTAT-C 26431794-CACACATTAT-C **
22780298-T-A 20618412-T-A **
5275872-A-C 5407831-A-C **
13308872-T-C 11153196-T-C **
13452845-CCTCCTTTT-C 11297169-CCTCCTTTT-C **
13711041-T-G 11555365-T-G **
23517097-G-T 21355211-G-T **
21997966-G-T 19836080-G-T **
8277192-T-G 8409151-T-G **
8277185-A-C 8409144-A-C **
22641039-T-A 20479153-T-A **
19753693-C-T 17641813-C-T P5_Prx 25×T***
19040406-T-A 16928526-T-A ***
19691898-A-G 17580018-A-G P5_Prx ***
19611249-G-T 17499369-G-T P5_Prx ***
19325748-G-T 17213868-G-T ***
19746929-C-T 17635049-C-T P5_Prx ***
18511265-C-A 16399385-C-A P6_Dst ***
19001090-G-C 16889210-G-C ***
18879438-G-A 16767558-G-A ***
18275296-T-A 16163416-T-A P6_Prx ***
18138889-C-A 16027009-C-A ***
18139288-G-T 16027408-G-T FGC36288 ***
18879423-G-A 16767543-G-A ***
18879422-T-C 16767542-T-C ***
18231771-A-T 16119891-A-T ***
18879432-T-C 16767552-T-C ***
20376284-T-A 18214398-T-A P5_Dst ***
19758640-G-T 17646760-G-T P5_Prx ***
21029732-G-A 18867846-G-A P4_Dst ***
22249615-A-T 20087729-A-T DYZ19 ***
22224548-T-A 20062662-T-A DYZ19 ***
22150018-T-C 19988132-T-C ***
21949662-T-C 19787776-T-C ***
21945055-C-T 19783169-C-T ***
21745972-A-T 19584086-A-T ***
21417370-G-T 19255484-G-T ***
21387200-T-G 19225314-T-G ***
21387190-C-A 19225304-C-A ***
21238252-C-A 19076366-C-A ***
21208259-A-G 19046373-A-G ***
20895060-G-T 18733174-G-T P4_Dst ***
19845452-G-T 17733572-G-T P5_Prx ***
20645894-A-T 18484008-A-T P4_Prx ***
20569138-T-C 18407252-T-C P5_Dst ***
20554824-C-A 18392938-C-A P5_Dst ***
20516638-G-T 18354752-G-T P5_Dst ***
20510937-G-T 18349051-G-T P5_Dst ***
18054233-T-C 15942353-T-C ***
20334325-C-A 18172439-C-A P5_Dst ***
20326058-C-T 18164172-C-T P5_Dst ***
20128808-C-T 18016928-C-T P5_Dst ***
20001983-G-A 17890103-G-A P5_Prx ***
19997215-G-T 17885335-G-T P5_Prx ***
18121431-C-G 16009551-C-G ***
13452843-C-T 11297167-C-T ***
17994838-C-A 15882958-C-A P7_Prx ***
13466594-G-C 11310918-G-C ***
13709604-T-G 11553928-T-G ***
13608610-C-T 11452934-C-T ***
13488159-G-C 11332483-G-C ***
13478672-C-T 11322996-C-T ***
13478364-G-T 11322688-G-T ***
13478302-C-T 11322626-C-T ***
13478294-C-G 11322618-C-G ***
13477364-C-A 11321688-C-A ***
13472176-C-T 11316500-C-T ***
13472123-G-C 11316447-G-C ***
13470955-G-A 11315279-G-A F10781 ***
13466611-G-A 11310935-G-A ***
13466589-G-A 11310913-G-A ***
13711103-T-C 11555427-T-C ***
13459331-C-G 11303655-C-G ***
13440938-G-A 11285262-G-A ***
13342091-G-T 11186415-G-T ***
13334896-G-A 11179220-G-A ***
13315375-G-T 11159699-G-T ***
13313546-A-T 11157870-A-T ***
13312671-C-T 11156995-C-T ***
13254554-G-T 11098878-G-T ***
13222365-A-G 11066689-A-G ***
13213824-T-C 11058148-T-C ***
10065915-G-T 10228306-G-T ***
10065899-G-A 10228290-G-A ***
10065897-C-T 10228288-C-T ***
13710542-G-T 11554866-G-T ***
13711116-A-C 11555440-A-C ***
17428771-A-T 15316891-A-T ***
15148043-C-A 13036130-C-A ***
17372529-T-C 15260649-T-C ***
17160644-C-T 15048764-C-T ***
16976968-C-A 14865088-C-A ***
22262569-C-T 20100683-C-T DYZ19 ***
16665085-C-A 14553205-C-A ***
16432805-G-A 14320925-G-A ***
16152400-A-G 14040520-A-G P8_Dst ***
15769337-G-T 13657457-G-T ***
15685511-G-T 13573631-G-T ***
15641623-A-C 13529743-A-C ***
15595570-G-T 13483690-G-T ***
15595365-T-G 13483485-T-G ***
15147855-C-A 13035942-C-A ***
13731621-C-T 11575945-C-T ***
15142120-G-A 13030207-G-A ***
14986629-T-C 12874697-T-C ***
14741381-G-T 12629449-G-T ***
14740210-G-A 12628278-G-A ***
14738856-C-T 12626924-C-T ***
14738848-G-C 12626916-G-C ***
14738847-A-T 12626915-A-T ***
14671689-A-G 12559755-A-G ***
14250819-C-G 12130113-C-G ***
14167247-G-T 12046541-G-T ***
14121067-G-T 12000361-G-T ***
13878295-A-C 11757589-A-C ***
13743747-T-C 11588071-T-C ***
16976965-T-C 14865085-T-C ***
23169750-G-A 21007864-G-A ***
22343095-G-A 20181209-G-A DYZ19 ***
58980114-T-C 56833967-T-C ***
2984950-C-CTA 3116909-C-CTA 16×TA***
6493953-CAA-C 6625912-CAA-C 19×A***
20025443-CT-C 17913563-CT-C P5_Prx ***
16729172-GT-G 14617292-GT-G 22×T***
13268061-AG-CA 11112385-AG-CA ***
9040169-ATG-A 9202560-ATG-A 14×TG***
19411175-T-TA 17299295-T-TA 13×A***
16679404-A-AT 14567524-A-AT 18×T***
28602505-AT-A 26456358-AT-A 19×T***
9231698-AACACACAC-A 9394089-AACACACAC-A 22×AC***
58988839-G-T 56842692-G-T ***
58984581-T-C 56838434-T-C ***
58980112-C-A 56833965-C-A ***
3822962-G-GAT 3954921-G-GAT 26×AT***
58972071-C-G 56825924-C-G ***
58912792-C-G 56678079-G-C ***
58904937-A-T 56685934-T-A ***
58893770-G-C 56697101-C-G ***
58893752-T-A 56697119-A-T ***
58888950-C-A 56701921-G-T ***
58885197-A-G 56705674-T-C ***
58882431-T-A 56708440-A-T ***
58876509-C-A 56714362-G-T ***
58876499-C-G 56714372-G-C ***
58866644-T-A 56724227-A-T ***
58862808-G-C 56728063-C-G ***
58862786-T-C 56728085-A-G ***
3240658-A-AT 3372617-A-AT 13×T***
4983174-ATT-A 5115133-ATT-A 28×T***
58855454-A-G 56735417-T-C ***
21346975-T-TATATATA 19185089-T-TATATATA 29×TA***
13839846-T-C,G 11719140-T-C,G ***
13453613-CTTTTA-C,CATTCCATTCCATTCCATTCC 11297937-CTTTTA-C,CATTCCATTCCATTCCATTCC ***
59002261-AAAA-G 56856114-AAAA-G ***
58973209-GAG-CAA 56827062-GAG-CAA ***
58972018-AT-A 56825871-AT-A ***
58912334-ACTCC-TCTCT 56678533-GGAGT-AGAGA ***
58882400-GGC-TGT 56708469-GCC-ACA ***
27583000-CT-C 25436853-CT-C P1_Y2 22×T***
25964727-CT-C 23818580-CT-C P1_Y1 16×T***
25845058-TGAAT-AGAAA 23698911-TGAAT-AGAAA P1_b3 ***
24096349-C-CA 21950202-C-CA P3_b1 16×A***
22520620-C-CTTT 20358734-C-CTTT ***
18395723-TTATATATA-T 16283843-TTATATATA-T P6_Gap 27×TA***
6451089-TAT-GAC 6583048-TAT-GAC ***
17791245-CA-C 15679365-CA-C 13×A***
16297330-G-GT 14185450-G-GT 26×T***
15278818-T-TATATC ***
13739697-AGAATGGAATG-A 11584021-AGAATGGAATG-A 8×GAATG***
13709690-TAATG-GAATC 11554014-TAATG-GAATC ***
13488186-GC-TT 11332510-GC-TT ***
13488169-GCCATC-AACATT 11332493-GCCATC-AACATT ***
13483122-ATCA-GTCG 11327446-ATCA-GTCG ***
13459320-GCAT-TCAC 11303644-GCAT-TCAC 5×CATTC***
13346776-C-CA 11191100-C-CA 13×A***
13329879-A-AATAT 11174203-A-AATAT 25×AT***
13279998-CAAAAAAAAA-C 11124322-CAAAAAAAAA-C 26×A***
13213879-CTGGA-C 11058203-CTGGA-C ***
58860503-G-T 56730368-C-A ***
58845492-C-A 56745379-G-T ***
22692190-C-A 20530304-C-A ***
24960531-G-T 22814384-G-T g1 ***
26055308-C-G 23909161-C-G P1_Y1 ***
26055294-T-C 23909147-T-C P1_Y1 ***
26055291-T-C 23909144-T-C P1_Y1 ***
26055290-C-T 23909143-C-T P1_Y1 ***
25971325-C-A 23825178-C-A P1_Y1 ***
25722462-T-A 23576315-T-A P1_b3 ***
25628401-G-T 23482254-G-T P1_b3 ***
25207797-T-A 23061650-T-A P2_r1 ***
25176091-C-A 23029944-C-A g1 ***
25151189-G-A 23005042-G-A g1 ***
25099683-C-A 22953536-C-A g1 ***
24966356-A-G 22820209-A-G g1 ***
24841721-A-T 22695574-A-T P3_b2 ***
26325625-C-T 24179478-C-T P1_Y1 ***
24671389-A-T 22525242-A-T P3_b2 ***
24657707-G-A 22511560-G-A P3_b2 ***
24305131-A-T 22158984-A-T P3_t1 ***
24290896-G-A 22144749-G-A P3_t1 ***
24235379-G-A 22089232-G-A P3_b1 ***
24218300-C-T 22072153-C-T P3_b1 ***
24080679-C-T 21934532-C-T P3_b1 ***
24047092-G-T 21900945-G-T ***
23838005-G-A 21676119-G-A ***
23464748-G-T 21302862-G-T ***
23223346-G-C 21061460-G-C ***
10065887-T-C 10228278-T-C ***
22838805-A-G 20676919-A-G ***
26133013-C-A 23986866-C-A P1_Y1 ***
26334790-A-T 24188643-A-T P1_Y1 ***
58843152-T-C 56747719-A-G ***
28117315-A-T 25971168-A-T P1_b4 ***
58833801-T-C 56757070-A-G ***
58827198-T-C 56763673-A-G ***
58827044-A-T 56763827-T-A ***
58823277-C-A 56767594-G-T ***
28694062-G-T 26547915-G-T ***
28639344-A-T 26493197-A-T ***
28491931-G-T 26345784-G-T ***
28489131-T-C 26342984-T-C ***
28428333-C-T 26282186-C-T P1_gr2 ***
28385829-T-C 26239682-T-C P1_gr2 ***
28353238-T-C 26207091-T-C P1_gr2 ***
28239726-C-T 26093579-C-T P1_b4 ***
28210114-T-C 26063967-T-C P1_b4 ***
28076495-T-C 25930348-T-C P1_Y2 7×TTCC***
26500152-A-G 24354005-A-G P1_Y1 ***
28024031-T-C 25877884-T-C P1_Y2 ***
28022733-G-T 25876586-G-T P1_Y2 ***
27997471-A-C 25851324-A-C P1_Y2 ***
27861770-G-T 25715623-G-T P1_Y2 ***
27856702-G-C 25710555-G-C P1_Y2 ***
27842662-C-A 25696515-C-A P1_Y2 ***
27835379-C-T 25689232-C-T P1_Y2 ***
27733530-T-A 25587383-T-A P1_Y2 ***
27676650-A-T 25530503-A-T P1_Y2 ***
27543001-G-T 25396854-G-T P1_Y2 ***
27266800-C-A 25120653-C-A P1_g3 ***
27266046-G-A 25119899-G-A P1_g3 ***
27078256-A-G 24932109-A-G P1_r4 ***
10065888-G-A 10228279-G-A ***
9713964-A-T 9876355-A-T IR3_Prx ***
9949430-C-A 10111821-C-A ***
13714765-T-G 11559089-T-G ***
23394952-AT-A 21233066-AT-A 11×T***
23098816-C-T 20936930-C-T 25×A***
22359557-G-C 20197671-G-C DYZ19 ***
22219443-C-T 20057557-C-T DYZ19 ***
19966688-AAAGAAGAAG-A,AAAGAAG 17854808-AAAGAAGAAG-A,AAAGAAG P5_Prx 26×AAG***
19949608-GT-G 17837728-GT-G P5_Prx 16×T***
13866079-C-T 11745373-C-T ***
13858479-C-G 11737773-C-G ***
13846549-C-A 11725843-C-A ***
13833422-G-C 11712716-G-C ***
13728881-A-C 11573205-A-C ***
13714804-C-T 11559128-C-T ***
13713797-G-A 11558121-G-A ***
25257713-G-A 23111566-G-A P2_r1 ***
13711079-G-C 11555403-G-C ***
13711050-C-G 11555374-C-G ***
13705872-T-A 11550196-T-A ***
13459640-T-A 11303964-T-A ***
13455112-T-C 11299436-T-C ***
13454223-T-A,TTTCCATTCCATTCCA 11298547-T-A,TTTCCATTCCATTCCA 12×TTCCA***
13452944-C-G 11297268-C-G ***
13452730-G-C 11297054-G-C ***
13452727-T-A 11297051-T-A ***
13142946-C-T 10632432-C-T ***
7365426-CT-C 7497385-CT-C 11×T***
22247629-G-T 20085743-G-T DYZ19 ***
24915837-C-A 22769690-C-A g1 ***
58858939-C-A 56731932-G-T ***
23311147-T-TTTTCTTTC 21149261-T-TTTTCTTTC 15×TTTC***
13472186-C-T 11316510-C-T ***
13712907-C-A 11557231-C-A ***
13488148-A-G 11332472-A-G ***
20712287-TAC-T 18550401-TAC-T P4_Prx 16×AC***
15128121-CT-C 13016208-CT-C 18×T***
13440910-CA-AG 11285234-CA-AG ***
6521551-G-GT 6653510-G-GT 17×T***
13470945-C-T 11315269-C-T ***
13470935-T-G 11315259-T-G ***
13470915-A-T 11315239-A-T ***
13470893-C-A 11315217-C-A ***
13214289-A-ATCT 11058613-A-ATCT 19×T***
21146425-A-AT 18984539-A-AT 16×T***
13664693-AGAAAG-A 11509017-AGAAAG-A ***
58973991-CACTCG-C 56827844-CACTCG-C ***
14886399-CA-C 12774465-CA-C 21×A***
22491445-T-G 20329559-T-G DYZ19 ***
13306703-G-T 11151027-G-T ***
13714172-CACTC-TACTG 11558496-CACTC-TACTG ***
14986616-TTCTC-T 12874684-TTCTC-T 17×TC***
22266400-C-G 20104514-C-G DYZ19 ***
13488215-C-G 11332539-C-G ***
58972064-A-T 56825917-A-T ***
13478337-C-T 11322661-C-T ***
59004604-G-A 56858457-G-A ***
58980054-C-T 56833907-C-T ***
58978792-T-A 56832645-T-A ***
58978772-G-A 56832625-G-A ***
13699474-C-T 11543798-C-T ***
58975536-G-C,T 56829389-G-C,T ***
13253182-C-T 11097506-C-T ***
25324285-GT-G 23178138-GT-G P2_r1 11×T***
13810213-C-G 11689507-C-G ***
13705871-C-A 11550195-C-A ***
26169893-TA-T 24023746-TA-T P1_Y1 10×A***
20998343-G-A 18836457-G-A P4_Dst ***
58975532-G-C 56829385-G-C ***
13856353-G-A 11735647-G-A ***
13661234-G-T 11505558-G-T ***
9945373-T-C 10107764-T-C ***
13869339-G-C 11748633-G-C ***
13867261-G-T 11746555-G-T ***
13851405-G-T 11730699-G-T ***
58978661-C-T 56832514-C-T ***
13693019-C-G 11537343-C-G ***
13652249-T-A 11496573-T-A ***
28790460-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G 26644313-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G ***
13715385-C-G 11559709-C-G ***
13692194-A-T 11536518-A-T ***
22440118-C-T 20278232-C-T DYZ19 ***
13869466-A-C 11748760-A-C ***
13869463-T-A 11748757-T-A ***
28076522-C-T 25930375-C-T P1_Y2 13×CTTT***
24222264-CTT-C 22076117-CTT-C P3_b1 15×T***
22360808-G-C 20198922-G-C DYZ19 ***
13714045-T-A 11558369-T-A ***
13712935-G-A 11557259-G-A ***
10024136-G-T 10186527-G-T ***
13691560-CACGAATGGAATGGAG-C 11535884-CACGAATGGAATGGAG-C ***
17145728-G-GA 15033848-G-GA 11×A***
25931592-G-GAAGGAAGA 23785445-G-GAAGGAAGA P1_Y1 14×AAGA***
10038700-G-A 10201091-G-A ***
26991332-G-C 24845185-G-C P1_r4 ***
26902327-G-A 24756180-G-A P1_r3 ***
13839745-G-A 11719039-G-A ***
13817987-G-A 11697281-G-A ***
13817967-G-C 11697261-G-C ***
13817958-G-A 11697252-G-A ***
9985773-T-G 10148164-T-G ***
9985772-G-T 10148163-G-T ***
19792672-CT-C 17680792-CT-C P5_Prx 11×T***
13142948-G-C 10632434-G-C 11×CATTC***
22509435-T-C 20347549-T-C DYZ19 ***
13704469-A-G 11548793-A-G ***
10038697-T-C 10201088-T-C ***
17458930-A-AT 15347050-A-AT 17×T***
10038695-G-A 10201086-G-A ***
13600363-G-GA 11444687-G-GA ***
58974006-C-T 56827859-C-T ***
13700173-C-A,T 11544497-C-A,T ***
13833439-T-A,G 11712733-T-A,G ***
13833435-T-A 11712729-T-A ***
13459238-T-C 11303562-T-C ***
17333371-TA-T 15221491-TA-T 10×A***
13805355-T-C 11684649-T-C ***
9945421-A-G 10107812-A-G ***
13452813-C-T 11297137-C-T ***
13453992-A-G 11298316-A-G ***
13453972-A-G 11298296-A-G ***
3543166-CA-C 3675125-CA-C 14×A***
13708379-T-A 11552703-T-A ***
9949413-A-T 10111804-A-T ***
4421328-T-A 4553287-T-A ***
6015988-G-C 6147947-G-C ***
6015987-G-C 6147946-G-C ***
5992821-T-C 6124780-T-C ***
5841208-C-T 5973167-C-T ***
5684150-C-T 5816109-C-T ***
5683787-C-A 5815746-C-A ***
5155760-G-A 5287719-G-A ***
5148692-T-C 5280651-T-C ***
5112786-G-A 5244745-G-A ***
4932827-G-A 5064786-G-A ***
4727241-G-A 4859200-G-A ***
4438972-G-A 4570931-G-A ***
4289149-T-C 4421108-T-C ***
6118984-G-T 6250943-G-T ***
4288484-A-G 4420443-A-G ***
3663018-C-A 3794977-C-A ***
3611993-G-T 3743952-G-T ***
3576522-A-G 3708481-A-G ***
3457987-A-T 3589946-A-T ***
2758629-C-A 2890588-C-A ***
2688596-A-T 2820555-A-T ***
7028584-C-G 7160543-C-G ***
13222324-A-T 11066648-A-T ***
58916377-G-C 56674494-C-G ***
13711752-C-A 11556076-C-A ***
9929292-T-C 10091683-T-C ***
6015996-T-C 6147955-T-C ***
6158720-C-T 6290679-C-T IR3_Dst ***
16364058-CTATATATA-C 14252178-CTATATATA-C 27×TA***
8277151-G-T 8409110-G-T ***
9949392-G-A 10111783-G-A ***
9949389-C-T 10111780-C-T ***
9949387-C-T 10111778-C-T ***
9949383-G-A 10111774-G-A ***
9927078-C-T 10089469-C-T ***
9923620-T-C 10086011-T-C ***
9779022-C-A 9941413-C-A ***
9725030-T-G 9887421-T-G IR3_Prx ***
9628465-G-T 9790856-G-T IR3_Prx ***
9577350-C-A 9739741-C-A IR3_Prx ***
8293188-A-G 8425147-A-G ***
8277158-C-T 8409117-C-T ***
7996480-A-G 8128439-A-G ***
6200199-C-A 6332158-C-A IR3_Dst ***
7984929-A-G 8116888-A-G ***
7442362-G-T 7574321-G-T ***
7438933-A-T 7570892-A-T ***
7061908-G-T 7193867-G-T ***
6946021-C-T 7077980-C-T ***
6749068-T-A 6881027-T-A ***
6566472-G-C 6698431-G-C ***
6533570-T-C 6665529-T-C ***
6473300-A-G 6605259-A-G ***
6333479-T-C 6465438-T-C IR3_Dst ***
6311925-T-G 6443884-T-G IR3_Dst ***
6250325-A-C 6382284-A-C IR3_Dst ***
6215748-G-T 6347707-G-T IR3_Dst ***
9929301-G-A 10091692-G-A ***
7155780-TA-T 7287739-TA-T 14×A***
22335808-C-T 20173922-C-T DYZ19 ***
8533315-TTG-T 8665274-TTG-T 12×TG***
13466571-G-T 11310895-G-T ***
13466495-T-A 11310819-T-A ***
13440911-A-G 11285235-A-G ***
13440910-C-A 11285234-C-A ***
13440887-C-A 11285211-C-A ***
13292727-C-T 11137051-C-T ***
13279768-C-T 11124092-C-T ***
13267454-G-A 11111778-G-A ***
13267326-G-A 11111650-G-A ***
13267301-G-A 11111625-G-A ***
13267083-G-A 11111407-G-A ***
13262312-G-A 11106636-G-A ***
7028566-T-G 7160525-T-G ***
17950825-AATAT-A 15838945-AATAT-A 27×AT***
5659707-GTATATATA-G 5791666-GTATATATA-G 28×TA***
13466559-G-T 11310883-G-T ***
13466547-G-T 11310871-G-T ***
13470888-C-G 11315212-C-G ***
22237131-A-T 20075245-A-T DYZ19 ***
14025618-A-G 11904912-A-G ***
22343182-T-A 20181296-T-A DYZ19 ***
14698458-CAA-C 12586524-CAA-C 19×A***
22297068-A-T 20135182-A-T DYZ19 ***
26344423-C-T 24198276-C-T P1_Y1 28×T***
16282398-CA-C 14170518-CA-C 24×A***
9040197-G-A 9202588-G-A Z17893 ***
13569498-G-A 11413822-G-A ***
22366299-A-C 20204413-A-C DYZ19 ***
28577985-C-A 26431838-C-A ***
13709694-G-C 11554018-G-C ***
28577983-A-G 26431836-A-G ***
13478300-C-T 11322624-C-T ***
17474945-C-CT 15363065-C-CT 15×T***
58859102-G-T 56731769-C-A ***
13569580-GGC-AGT 11413904-GGC-AGT ***
14195214-CA-C 12074508-CA-C 17×A***
58840967-A-T 56749904-T-A ***
5017614-AAC-A 5149573-AAC-A 18×AC***
3588094-GTATA-G 3720053-GTATA-G 24×TA***
28253470-T-A 26107323-T-A P1_b4 ***
24235336-G-A 22089189-G-A P3_b1 ***
58848948-C-A 56741923-G-T ***
13440870-A-T 11285194-A-T ***
22876964-TA-T 20715078-TA-T 20×A***
13267382-C-G 11111706-C-G ***
28742512-A-AT 26596365-A-AT 14×T***
58841013-T-C 56749858-A-G ***
28117311-A-T 25971164-A-T P1_b4 ***
28117307-A-T 25971160-A-T P1_b4 ***
26991325-A-T 24845178-A-T P1_r4 ***
14080035-GAT-G 11959329-GAT-G 29×AT***
6630512-C-CT 6762471-C-CT 15×T***
19127645-T-A 17015765-T-A ***
25207819-T-A 23061672-T-A P2_r1 ***
22266383-G-T 20104497-G-T DYZ19 ***
58989309-G-A 56843162-G-A ***
58974788-G-A 56828641-G-A ***
59004622-AGGAA-A,AG 56858475-AGGAA-A,AG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Williams1325141111-13121212131429179-1011112515183015-16-16-17121119-231715171739-40121211915-1681010810111221-231610121217812262013121113111112123315916122426191211121211913121011123012132513101022151914251813152412231910141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 2296521011170172266087280110
Kit: LBLUN*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs31
Variant counts last updated 2017-09-19 23:22:54.

* BED data not available. Using default values.


Big Tree Main Page