Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z198 > ZS312 > FGC39101

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFGC
QCYUW
4091955-A-G 4223914-A-G FGC39089 +
23314867-C-T 21152981-C-T FGC39126 YY+
21757125-T-C 19595239-T-C FGC39122 YY+
26761117-C-A 24614970-C-A FGC39129 P1_g2 +
19997547-A-G 17885667-A-G FGC39117 P5_Prx +
21621458-C-T 19459572-C-T FGC39121 YY+
6756385-G-A 6888344-G-A FGC39094 Y+
28033880-T-C 25887733-T-C FGC39130 P1_Y2 +
24473559-A-T 22327412-A-T FGC39128 Y+
24426538-C-T 22280391-C-T FGC39127 Y+
14504110-A-C 12392315-A-C FGC39104 YY+
5676984-C-T 5808943-C-T FGC39092 +
6587519-G-C 6719478-G-C FGC39093 +
14487936-G-A 12367205-G-A FGC39103 YY+
21595910-T-G 19434024-T-G FGC39120 YY+
21447806-G-A 19285920-G-A FGC39119 YY+
14096276-G-T 11975570-G-T FGC39102 YY+
16035133-T-C 13923253-T-C FGC39107 Y+
21269487-C-T 19107601-C-T FGC39118 Y+
4115940-G-C 4247899-G-C FGC39090 +
23183718-C-A 21021832-C-A FGC39125 Y+
8069759-G-A 8201718-G-A FGC39096 YY+
8789215-CT-C 8921174-CT-C FGC39132 +
19203058-T-G 17091178-T-G FGC39116 YY+
22219713-G-C 20057827-G-C FGC39124 DYZ19 +
18724520-A-T 16612640-A-T FGC39113 YY+
3760749-T-A 3892708-T-A FGC39088 +
9931934-G-A 10094325-G-A FGC39099 Y+
13610060-GT-G 11454384-GT-G FGC39133 +
19145120-C-T 17033240-C-T FGC39115 YY+
13208010-C-T 11052334-C-T FGC39100 +
2887539-C-G 3019498-C-G PR4304 YY+
2764554-G-A 2896513-G-A FGC39087 YY+
14902080-AG-A 12790147-AG-A FGC39134 +
18677422-A-T 16565542-A-T FGC39112 YY+
15167770-T-C 13055856-T-C FGC39105 YY+
22145859-T-G 19983973-T-G FGC39123 YY+
25160962-CG-C 23014815-CG-C FGC39135 g1 +
5069604-A-G 5201563-A-G FGC39091 +
17414687-G-A 15302807-G-A FGC39109 YY+
9086069-C-G 9248460-C-G FGC39098 Y+
9079861-G-T 9242252-G-T FGC39097 +
23072701-C-T 20910815-C-T S25094 YY+
18058352-C-T 15946472-C-T FGC39111 Y+
16503615-C-G 14391735-C-G FGC39108 YY*
15462759-C-G 13350879-C-G FGC39106 YY*
13383525-C-G 11227849-C-G FGC39086 *
15628373-A-G 13516493-A-G **
9472009-A-G 9634400-A-G **
21790398-G-C 19628512-G-C **
58912879-A-G 56677992-T-C **
17701110-C-T 15589230-C-T **
17523369-C-T 15411489-C-T **
3790878-GTA-G 3922837-GTA-G 21×TA**
13261590-A-G 11105914-A-G **
13261300-G-A 11105624-G-A **
18723955-C-G 16612075-C-G **
6065112-TTTTTA-T 6197071-TTTTTA-T 8×TTTTA**
19177803-C-T 17065923-C-T **
4781445-T-C 4913404-T-C **
19101360-C-T 16989480-C-T **
17162833-C-T 15050953-C-T **
17162829-C-T 15050949-C-T **
19098981-C-T 16987101-C-T **
19412014-A-AAG 17300134-A-AAG **
5701751-TA-T 5833710-TA-T **
17826442-G-A 15714562-G-A **
18042501-A-T 15930621-A-T **
17826454-G-T 15714574-G-T **
17826459-A-T 15714579-A-T **
6160699-G-T 6292658-G-T IR3_Dst **
18133563-T-A 16021683-T-A **
21335393-A-T 19173507-A-T **
21350630-A-G 19188744-A-G **
13459266-C-T 11303590-C-T **
18135749-A-G 16023869-A-G **
13427569-C-T 11271893-C-T **
21633382-A-T 19471496-A-T **
21599139-A-C 19437253-A-C **
18228034-G-A 16116154-G-A **
6726417-G-A 6858376-G-A **
25654310-G-T 23508163-G-T P1_b3 **
7003147-C-T 7135106-C-T **
6015664-T-C 6147623-T-C **
6015656-C-T 6147615-C-T **
18133526-G-A 16021646-G-A **
13705971-A-G 11550295-A-G **
17162822-C-T 15050942-C-T **
23096754-G-A 20934868-G-A **
13389943-A-G 11234267-A-G **
17083879-T-C 14971999-T-C **
23521271-G-T 21359385-G-T **
15919455-G-T 13807575-G-T **
7509807-AAAAC-A 7641766-AAAAC-A 4×AAAC**
23448435-G-A 21286549-G-A **
14514820-G-A 12403025-G-A **
23288708-T-C 21126822-T-C **
17826458-G-T 15714578-G-T PF884 **
22309428-G-T 20147542-G-T DYZ19 **
23211792-T-A 21049906-T-A **
14683546-A-T 12571612-A-T **
23723544-CAT-C 21561658-CAT-C 27×AT**
15862980-G-A 13751100-G-A **
58999137-G-A 56852990-G-A **
22666563-T-C 20504677-T-C **
15862979-T-C 13751099-T-C **
26152168-C-CTTCTTTCTTTCT 24006021-C-CTTCTTTCTTTCT P1_Y1 19×TTCT**
24221822-A-T 22075675-A-T P3_b1 **
26344249-CAAAA-C 24198102-CAAAA-C P1_Y1 14×A**
22309435-T-C 20147549-T-C DYZ19 **
27791980-G-GCTT 25645833-G-GCTT P1_Y2 9×CTT**
22503914-C-T 20342028-C-T DYZ19 **
15247104-G-A 13135190-G-A **
13860371-G-GATGGA 11739665-G-GATGGA 7×ATGGA**
15856105-C-G 13744225-C-G **
15377472-C-A 13265592-C-A **
15797385-C-A 13685505-C-A **
23521300-A-G 21359414-A-G **
13389937-C-T 11234261-C-T **
18877657-A-G 16765777-A-G **
16215260-A-G 14103380-A-G **
18877653-G-A 16765773-G-A **
3207930-C-T 3339889-C-T **
16728946-T-A 14617066-T-A **
16381015-GA-G 14269135-GA-G **
16657877-C-T 14545997-C-T **
16502769-C-G 14390889-C-G **
16500048-C-G 14388168-C-G **
22780078-G-A 20618192-G-A **
5346065-T-C 5478024-T-C **
22261446-A-C 20099560-A-C DYZ19 **
28578944-T-A 26432797-T-A **
22260829-C-G 20098943-C-G DYZ19 **
21182397-CTTTTT-C 19020511-CTTTTT-C 20×T**
14000370-C-T 11879664-C-T **
14134076-T-A 12013370-T-A **
16009054-G-A 13897174-G-A **
22103776-C-CA 19941890-C-CA 10×A**
16082601-G-A 13970721-G-A **
21599121-C-CTTCGACA 19437235-C-CTTCGACA **
26713792-T-A 24567645-T-A P1_g2 ***
27691887-T-A 25545740-T-A P1_Y2 ***
26906688-G-T 24760541-G-T P1_r3 ***
27499181-T-G 25353034-T-G P1_Y2 ***
27686644-G-T 25540497-G-T P1_Y2 ***
27499310-C-A 25353163-C-A P1_Y2 30×A***
27496668-T-G 25350521-T-G P1_Y2 ***
27524875-T-A 25378728-T-A P1_Y2 ***
27464357-C-T 25318210-C-T P1_Y2 ***
27686645-C-G 25540498-C-G P1_Y2 ***
27692047-T-A 25545900-T-A P1_Y2 ***
27633305-C-A 25487158-C-A P1_Y2 ***
26543974-A-T 24397827-A-T P1_g2 ***
27647834-G-C 25501687-G-C P1_Y2 ***
27686647-G-C 25540500-G-C P1_Y2 ***
27298172-C-T 25152025-C-T P1_g3 ***
27686652-A-T 25540505-A-T P1_Y2 ***
27647253-A-C 25501106-A-C P1_Y2 ***
27692031-T-A 25545884-T-A P1_Y2 ***
27691929-T-C 25545782-T-C P1_Y2 ***
26617945-C-T 24471798-C-T P1_g2 ***
26635222-G-A 24489075-G-A P1_g2 ***
26713613-C-T 24567466-C-T P1_g2 ***
26954369-A-T 24808222-A-T P1_r3 ***
26955864-A-G 24809717-A-G P1_r3 ***
58885176-T-C 56705695-A-G ***
26543868-A-C 24397721-A-C P1_g2 ***
24489777-A-T 22343630-A-T ***
24154354-G-T 22008207-G-T P3_b1 ***
24169030-A-T 22022883-A-T P3_b1 ***
24169045-G-T 22022898-G-T P3_b1 ***
24210911-G-T 22064764-G-T P3_b1 ***
24232080-T-G 22085933-T-G P3_b1 ***
24241812-T-C 22095665-T-C P3_b1 ***
24283215-C-A 22137068-C-A P3_t1 ***
24491438-C-T 22345291-C-T ***
23702149-T-C 21540263-T-C ***
24655878-G-T 22509731-G-T P3_b2 ***
24658547-T-C 22512400-T-C P3_b2 ***
24708240-T-A 22562093-T-A P3_b2 ***
24728754-C-T 22582607-C-T P3_b2 ***
24745676-C-T 22599529-C-T P3_b2 ***
24763656-C-T 22617509-C-T P3_b2 ***
24919932-T-C 22773785-T-C g1 ***
24044667-A-T 21898520-A-T ***
23519539-A-G 21357653-A-G ***
25057520-A-G 22911373-A-G g1 ***
22714184-G-A 20552298-G-A ***
22502401-A-C 20340515-A-C DYZ19 ***
22502402-A-T 20340516-A-T DYZ19 ***
22502403-G-T 20340517-G-T DYZ19 ***
22502923-C-T 20341037-C-T DYZ19 ***
22621581-G-T 20459695-G-T ***
22621649-G-A 20459763-G-A ***
22624010-A-T 20462124-A-T ***
22883537-C-T 20721651-C-T ***
23332495-G-A 21170609-G-A ***
22972072-C-T 20810186-C-T ***
23102464-T-C 20940578-T-C ***
23228291-C-A 21066405-C-A ***
23228411-C-A 21066525-C-A ***
23228718-C-T 21066832-C-T ***
23311440-T-C 21149554-T-C ***
23320269-G-T 21158383-G-T ***
23332494-T-C 21170608-T-C ***
24933041-C-T 22786894-C-T g1 ***
25090763-T-C 22944616-T-C g1 ***
26538177-C-T 24392030-C-T P1_g2 ***
26060032-T-A 23913885-T-A P1_Y1 ***
25964029-C-A 23817882-C-A P1_Y1 ***
25971211-A-T 23825064-A-T P1_Y1 ***
25972225-T-G 23826078-T-G P1_Y1 ***
26023201-G-A 23877054-G-A P1_Y1 ***
26024262-T-C 23878115-T-C P1_Y1 ***
26038914-C-A 23892767-C-A P1_Y1 ***
26059756-A-T 23913609-A-T P1_Y1 ***
26060085-T-A 23913938-T-A P1_Y1 ***
25845110-C-A 23698963-C-A P1_b3 ***
26201136-C-T 24054989-C-T P1_Y1 ***
26329153-G-A 24183006-G-A P1_Y1 ***
26391120-A-T 24244973-A-T P1_Y1 ***
26426696-C-T 24280549-C-T P1_Y1 ***
26436882-G-A 24290735-G-A P1_Y1 ***
26487295-A-T 24341148-A-T P1_Y1 ***
26527260-C-T 24381113-C-T P1_g2 ***
25964023-G-A 23817876-G-A P1_Y1 ***
25807083-A-G 23660936-A-G P1_b3 ***
25106877-G-T 22960730-G-T g1 ***
25466253-C-A 23320106-C-A P2_r2 ***
25207653-C-A 23061506-C-A P2_r1 ***
25207685-T-A 23061538-T-A P2_r1 ***
25207696-G-A 23061549-G-A P2_r1 ***
25268550-G-A 23122403-G-A P2_r1 ***
25287969-G-T 23141822-G-T P2_r1 ***
25323068-C-T 23176921-C-T P2_r1 ***
25323089-C-T 23176942-C-T P2_r1 ***
25466329-C-A 23320182-C-A P2_r2 ***
25805547-T-A 23659400-T-A P1_b3 ***
25606868-G-A 23460721-G-A P1_gr1 ***
25630959-C-T 23484812-C-T P1_b3 ***
25717284-C-A 23571137-C-A P1_b3 ***
25717301-C-T 23571154-C-T P1_b3 ***
25717380-G-A 23571233-G-A P1_b3 ***
25717408-T-A 23571261-T-A P1_b3 ***
25724021-G-A 23577874-G-A P1_b3 ***
25724418-G-A 23578271-G-A P1_b3 ***
25724441-T-G 23578294-T-G P1_b3 ***
58819457-C-A 56771414-G-T ***
27733384-A-G 25587237-A-G P1_Y2 ***
13865969-C-CGAATGGAATGGAATGGAATGGAATGGAATG 11745263-C-CGAATGGAATGGAATGGAATGGAATGGAATG 12×GAATG***
13485891-CCA-GCC 11330215-CCA-GCC ***
13535639-GTATA-G 11379963-GTATA-G 21×TA***
13684788-CATGGAATGAAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATACAATGGAATGGAGTGGAATGGAATGGAATGGAGTGTAATGGA-C 11529112-CATGGAATGAAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATACAATGGAATGGAGTGGAATGGAATGGAATGGAGTGTAATGGA-C ***
13717236-GAATG-CAATT 11561560-GAATG-CAATT ***
13717299-TGGAAT-CGGAAC 11561623-TGGAAT-CGGAAC ***
13740952-CAAA-GAAC 11585276-CAAA-GAAC ***
13746612-CTCG-TTCC 11590936-CTCG-TTCC ***
13845538-GTCA-ATGG 11724832-GTCA-ATGG ***
14080035-GATATATAT-G 11959329-GATATATAT-G 29×AT***
13478218-GTAGCTC-ACAGTTA 11322542-GTAGCTC-ACAGTTA ***
15862979-TG-CA 13751099-TG-CA ***
15862986-A-AC 13751106-A-AC ***
15866268-CAAAAAAAAAAAAAAAAAAAAAAA-C 13754388-CAAAAAAAAAAAAAAAAAAAAAAA-C 43×A***
17081286-TAA-AAT 14969406-TAA-AAT ***
17162829-CATTC-TATTT 15050949-CATTC-TATTT ***
17826454-GCAGGA-TCAGTT 15714574-GCAGGA-TCAGTT ***
18626582-CTTTTTTT-C 16514702-CTTTTTTT-C 25×T***
18877653-GATGA-AATGG 16765773-GATGA-AATGG ***
13485882-TC-T 11330206-TC-T ***
13473408-CAGT-GAGG 11317732-CAGT-GAGG ***
19520845-TAA-T 17408965-TAA-T 21×A***
13459274-T-TCCGCA 11303598-T-TCCGCA ***
10017491-T-TTGAGACAAAGCGAGACTCTGTCTCAATAATAATCACAATATTGTTATAAGA 10179882-T-TTGAGACAAAGCGAGACTCTGTCTCAATAATAATCACAATATTGTTATAAGA ***
13203875-CAT-GAG 11048199-CAT-GAG ***
13239526-TTTTTG-A 11083850-TTTTTG-A ***
13261588-TCA-CCG 11105912-TCA-CCG ***
13329987-CTT-C 11174311-CTT-C 15×T***
13375723-TGC-CGT 11220047-TGC-CGT ***
13383810-CT-C 11228134-CT-C 9×T***
13389943-AAGAT-GAGAC 11234267-AAGAT-GAGAC ***
13459310-CCAT-GCAC 11303634-CCAT-GCAC ***
13472386-TAG-CAA 11316710-TAG-CAA ***
13470099-CCTGGAACACCA-GCTGAAACTCTC 11314423-CCTGGAACACCA-GCTGAAACTCTC ***
13470137-AACTC-CACTT 11314461-AACTC-CACTT ***
13470543-CCAG-TCGA 11314867-CCAG-TCGA ***
13470559-AGTGTCCATCC-CGTATCTGTCT 11314883-AGTGTCCATCC-CGTATCTGTCT ***
13472333-TG-CA 11316657-TG-CA ***
13472345-CA-TG 11316669-CA-TG ***
13472367-GT-CC 11316691-GT-CC ***
13472373-CT-AC 11316697-CT-AC ***
19059747-CT-C 16947867-CT-C 25×T***
19720709-ATTTTTTTTT-A 17608829-ATTTTTTTTT-A P5_Prx 23×T***
9221706-TATATATATAC-T 9384097-TATATATATAC-T ***
24646621-CTG-TTT 22500474-CTG-TTT P3_b2 ***
22360059-GGC-TGT 20198173-GGC-TGT DYZ19 ***
22435744-TGA-CGC 20273858-TGA-CGC DYZ19 ***
22435750-C-CA 20273864-C-CA DYZ19 ***
23127414-CAAAAAAA-C 20965528-CAAAAAAA-C 24×A***
23831252-CT-C 21669366-CT-C 26×T***
24388084-A-ATC 22241937-A-ATC ***
24388085-T-TAC 22241938-T-TAC ***
24388086-A-ATT 22241939-A-ATT ***
24910853-CATAT-C 22764706-CATAT-C g1 26×AT***
22344142-CTTCA-TTTCC 20182256-CTTCA-TTTCC DYZ19 ***
25201080-G-GAGAA 23054933-G-GAGAA g1 ***
25201093-A-AGGAG 23054946-A-AGGAG g1 ***
27644243-C-CA 25498096-C-CA P1_Y2 10×A***
27791995-T-TCTA 25645848-T-TCTA P1_Y2 ***
27792005-C-CTTT 25645858-C-CTTT P1_Y2 ***
28076518-CCTTC-TCTTT 25930371-CCTTC-TCTTT P1_Y2 ***
58874758-GCA-CCT 56716111-TGC-AGG ***
58892570-CTTC-TTTG 56698298-GAAG-CAAA ***
22345994-G-GTC 20184108-G-GTC DYZ19 ***
22344125-TG-AT 20182239-TG-AT DYZ19 ***
20063941-TAAAAAAA-T 17952061-TAAAAAAA-T P5_Gap 18×A***
22258294-GGTGTG-AGTTTT 20096408-GGTGTG-AGTTTT DYZ19 ***
21050864-A-ATCTG 18888978-A-ATCTG ***
21146425-ATT-A 18984539-ATT-A 16×T***
21617605-CAAAAAAAA-C 19455719-CAAAAAAAA-C 23×A***
21779282-A-AAAAC 19617396-A-AAAAC ***
21779285-A-ACAAAC 19617399-A-ACAAAC ***
22240893-GAAGA-AAAGG 20079007-GAAGA-AAAGG DYZ19 ***
22258266-C-CTT 20096380-C-CTT DYZ19 ***
22258269-GGT-G 20096383-GGT-G DYZ19 ***
22267246-TG-CT 20105360-TG-CT DYZ19 ***
22344103-GTTC-TTTT 20182217-GTTC-TTTT DYZ19 ***
22292746-TGATAAGTCT-AGATGTGTCC 20130860-TGATAAGTCT-AGATGTGTCC DYZ19 ***
22292778-TC-CT 20130892-TC-CT DYZ19 ***
22297208-GTTACAGCA-ATTAGAGCC 20135322-GTTACAGCA-ATTAGAGCC DYZ19 ***
22309435-TACT-CACA 20147549-TACT-CACA DYZ19 ***
22332853-ACT-CAA 20170967-ACT-CAA DYZ19 ***
22332888-GA-AG 20171002-GA-AG DYZ19 ***
22341180-GC-TT 20179294-GC-TT DYZ19 ***
22341719-TTTGTTCT-ATTTTTCC 20179833-TTTGTTCT-ATTTTTCC DYZ19 ***
22341738-CCAC-ACAG 20179852-CCAC-ACAG DYZ19 ***
9942043-ATTTTTTTTTTTT-A 10104434-ATTTTTTTTTTTT-A 28×T***
8125067-A-AAGAGC 8257026-A-AAGAGC ***
27837944-C-T 25691797-C-T P1_Y2 ***
58845374-T-G 56745497-A-C ***
58829805-T-C 56761066-A-G ***
58830228-A-C 56760643-T-G ***
58830801-T-C 56760070-A-G ***
58832904-A-G 56757967-T-C ***
58833242-A-G 56757629-T-C ***
58838949-G-T 56751922-C-A ***
58839145-G-C 56751726-C-G ***
58839164-C-T 56751707-G-A ***
58850424-G-C 56740447-C-G ***
58828128-G-C 56762743-C-G ***
58854217-C-G 56736654-G-C ***
58854869-A-G 56736002-T-C ***
58856330-A-G 56734541-T-C ***
58857168-A-G 56733703-T-C ***
58860497-C-A 56730374-G-T FGC42760 ***
58862833-T-G 56728038-A-C ***
58862847-G-A 56728024-C-T ***
58863084-A-G 56727787-T-C ***
58828905-G-C 56761966-C-G ***
58828096-T-C 56762775-A-G ***
58868947-C-A 56721924-G-T ***
28062672-A-C 25916525-A-C A3630 P1_Y2 ***
27837952-T-G 25691805-T-G P1_Y2 ***
27837960-T-G 25691813-T-G P1_Y2 ***
27839939-C-G 25693792-C-G P1_Y2 ***
27869646-G-A 25723499-G-A P1_Y2 ***
27872075-A-G 25725928-A-G P1_Y2 ***
27872079-T-A 25725932-T-A P1_Y2 ***
27918818-G-A 25772671-G-A P1_Y2 11×A***
27988403-C-T 25842256-C-T P1_Y2 ***
28062987-T-A 25916840-T-A P1_Y2 ***
22502375-G-T 20340489-G-T DYZ19 ***
28114969-C-G 25968822-C-G P1_b4 ***
28117238-G-T 25971091-G-T P1_b4 ***
28207368-G-A 26061221-G-A P1_b4 ***
28336652-G-A 26190505-G-A P1_b4 ***
28357150-C-T 26211003-C-T P1_gr2 15×T***
28397221-C-A 26251074-C-A P1_gr2 ***
28550202-A-T 26404055-A-T ***
28602109-C-T 26455962-C-T ***
28750580-T-A 26604433-T-A ***
58868922-C-T 56721949-G-A ***
58872796-G-A 56718075-C-T ***
8125064-G-GAGAAA 8257023-G-GAGAAA ***
5354739-TATATATAC-T 5486698-TATATATAC-T ***
2775124-ATT-A 2907083-ATT-A 14×T***
2859987-CTTT-C 2991946-CTTT-C 16×T***
3350514-CA-C 3482473-CA-C 15×A***
3532330-CT-C 3664289-CT-C 14×T***
4636108-T-AA 4768067-T-AA ***
5036589-TATAT-C 5168548-TATAT-C ***
5036583-CAT-C 5168542-CAT-C 27×AT***
5088451-CTTTT-C 5220410-CTTTT-C 27×T***
5434003-A-AAT 5565962-A-AAT 8×AT***
5270693-CT-C 5402652-CT-C 22×T***
5785651-TG-AA 5917610-TG-AA ***
6106060-AC-A 6238019-AC-A ***
6199622-TTTTAGCA-ATGTAGTG 6331581-TTTTAGCA-ATGTAGTG IR3_Dst ***
6199645-CAG-AAA 6331604-CAG-AAA IR3_Dst ***
6199653-GGAA-AAAAC 6331612-GGAA-AAAAC IR3_Dst ***
6199671-AC-TA 6331630-AC-TA IR3_Dst ***
6791511-C-CACTTTATTTCTTACATCAGTAATAAATCATTTATTTACTTTTATTTTTTATT 6923470-C-CACTTTATTTCTTACATCAGTAATAAATCATTTATTTACTTTTATTTTTTATT ***
7106797-C-CAACTTGGACAAACTTACTTGTAATTTTAATCAGTGGTGACTAAGCAAAGACCTAGATT 7238756-C-CAACTTGGACAAACTTACTTGTAATTTTAATCAGTGGTGACTAAGCAAAGACCTAGATT ***
24895683-CT-C 22749536-CT-C g1 18×T***
13433435-G-AAGA 11277759-G-AAGA ***
58874760-A-T 56716111-T-A ***
6983589-C-CTG 7115548-C-CTG 20×TG***
58884552-C-T 56706319-G-A ***
58887550-T-C 56703321-A-G ***
58888529-C-A 56702342-G-T ***
58893627-A-G 56697244-T-C ***
58903246-C-G 56687625-G-C ***
58904762-A-C 56686109-T-G ***
7927087-C-CG 8059046-C-CG ***
13205596-ATAT-A 11049920-ATAT-A ***
13472402-TA-GC 11316726-TA-GC ***
13375826-ATTT-A 11220150-ATTT-A 12×T***
25038012-G-GA 22891865-G-GA g1 ***
4878260-A-AG 5010219-A-AG ***
13267772-T-TCC 11112096-T-TCC ***
25995492-G-GTA 23849345-G-GTA P1_Y1 24×TA***
5570209-AT-A 5702168-AT-A 14×T***
28602208-TT-C 26456061-TT-C ***
3086257-G-GA 3218216-G-GA 12×A***
17203327-CT-C 15091447-CT-C 21×T***
16978999-G-GAA 14867119-G-GAA 14×A***
22502384-A-G 20340498-A-G DYZ19 ***
22248476-T-G 20086590-T-G DYZ19 ***
22488469-G-T 20326583-G-T DYZ19 ***
7119834-C-T 7251793-C-T ***
6366147-A-G 6498106-A-G ***
6366150-T-C 6498109-T-C ***
6366158-G-C 6498117-G-C ***
6366159-C-T 6498118-C-T ***
6468904-A-G 6600863-A-G ***
6618096-A-T 6750055-A-T ***
7023402-A-T 7155361-A-T ***
7142520-G-T 7274479-G-T ***
6366120-A-G 6498079-A-G ***
7276201-T-C 7408160-T-C ***
8003006-C-T 8134965-C-T ***
8003016-C-T 8134975-C-T ***
8178510-A-G 8310469-A-G ***
8371654-A-T 8503613-A-T ***
8814961-T-C 8946920-T-C ***
9191075-T-A 9353466-T-A ***
6366130-G-T 6498089-G-T ***
6366117-A-G 6498076-A-G ***
9351270-G-A 9513661-G-A ***
6157271-G-C 6289230-G-C IR3_Dst ***
5883342-G-T 6015301-G-T ***
5883347-T-G 6015306-T-G ***
5883353-C-T 6015312-C-T ***
6045543-C-T 6177502-C-T ***
6148683-A-C 6280642-A-C IR3_Dst ***
6156101-C-T 6288060-C-T IR3_Dst ***
6157203-A-G 6289162-A-G IR3_Dst ***
6157277-G-A 6289236-G-A IR3_Dst ***
6366110-C-A 6498069-C-A ***
6157299-T-G 6289258-T-G IR3_Dst ***
6160561-C-T 6292520-C-T IR3_Dst ***
6199614-C-T 6331573-C-T IR3_Dst ***
6199636-G-A 6331595-G-A IR3_Dst ***
6200784-A-T 6332743-A-T IR3_Dst ***
6201049-C-T 6333008-C-T IR3_Dst ***
6366109-C-T 6498068-C-T YP2449 FGC25310 ***
9315950-C-T 9478341-C-T ***
9408666-G-A 9571057-G-A ***
5474784-A-G 5606743-A-G ***
13459340-C-T 11303664-C-T ***
13375642-G-A 11219966-G-A ***
13375725-C-T 11220049-C-T ***
13425275-G-C 11269599-G-C ***
13425405-A-G 11269729-A-G ***
13458992-A-G 11303316-A-G ***
13459300-G-T 11303624-G-T ***
13459328-T-A 11303652-T-A ***
13469991-C-G 11314315-C-G ***
13359142-G-A 11203466-G-A ***
13470107-A-T 11314431-A-T ***
13470443-G-C 11314767-G-C ***
13470475-C-A 11314799-C-A ***
13470543-C-T 11314867-C-T ***
13470546-G-A 11314870-G-A ***
13470552-C-A 11314876-C-A ***
13470632-C-G 11314956-C-G ***
13363277-T-A 11207601-T-A ***
13353287-G-C 11197611-G-C ***
9410022-G-A 9572413-G-A ***
9970673-A-G 10133064-A-G ***
9502345-G-A 9664736-G-A ***
9502351-T-A 9664742-T-A ***
9606046-G-A 9768437-G-A IR3_Prx ***
9673447-A-T 9835838-A-T IR3_Prx ***
9700970-C-T 9863361-C-T IR3_Prx ***
9779288-T-C 9941679-T-C ***
9970623-C-T 10133014-C-T ***
9970683-A-C 10133074-A-C ***
13341696-T-C 11186020-T-C ***
9976389-A-T 10138780-A-T ***
10030829-T-A 10193220-T-A ***
10041726-G-A 10204117-G-A ***
13133214-T-C 10622700-T-C ***
13223173-A-G 11067497-A-G ***
13223177-T-G 11067501-T-G ***
13257525-C-T 11101849-C-T ***
5479118-A-G 5611077-A-G ***
5354751-T-C 5486710-T-C ***
13472291-C-A 11316615-C-A ***
4420080-C-T 4552039-C-T ***
22309956-T-C 20148070-T-C DYZ19 ***
58828125-A-T 56762746-T-A ***
22258242-C-T 20096356-C-T DYZ19 ***
22292169-C-A 20130283-C-A DYZ19 ***
17527354-GTA-G 15415474-GTA-G 10×TA***
22258299-G-T 20096413-G-T DYZ19 ***
13740826-G-A 11585150-G-A ***
5535149-C-CTA 5667108-C-CTA 10×TA***
21012728-T-A 18850842-T-A P4_Dst ***
25207819-T-A 23061672-T-A P2_r1 ***
13714474-T-C 11558798-T-C ***
3053441-A-G 3185400-A-G ***
13262258-G-A 11106582-G-A ***
13375723-T-C 11220047-T-C ***
13720453-A-G 11564777-A-G 6×GAATG***
14101128-CTCT-C 11980422-CTCT-C 5×TCT***
22361261-G-C 20199375-G-C DYZ19 ***
7417561-CT-C 7549520-CT-C 14×T***
22258077-G-T 20096191-G-T DYZ19 ***
59027472-T-TAAA 56881325-T-TAAA 11×A***
22311190-T-G 20149304-T-G DYZ19 ***
25845104-G-A 23698957-G-A P1_b3 ***
7717685-TTTCC-T 7849644-TTTCC-T 13×TTCC***
3899454-A-AT 4031413-A-AT 16×T***
8901076-C-CAT 9033035-C-CAT 15×AT***
7160894-CT-C 7292853-CT-C 16×T***
15290982-C-CT 13179081-C-CT 17×T***
22346882-A-C 20184996-A-C DYZ19 ***
20489565-T-A 18327679-T-A P5_Dst ***
13869149-A-AGAATG 11748443-A-AGAATG 12×GAATG***
8468065-CAAAAAAA-C 8600024-CAAAAAAA-C 24×A***
14363164-ATT-A 12242459-ATT-A 16×T***
58876743-CTCATT-C 56714122-GAATGA-G ***
13726662-A-G 11570986-A-G ***
22311202-G-T 20149316-G-T DYZ19 ***
24388091-T-TAA 22241944-T-TAA ***
58999429-C-T 56853282-C-T ***
20426120-C-A 18264234-C-A P5_Dst ***
5088779-C-G 5220738-C-G ***
4163396-C-T 4295355-C-T ***
22502380-G-T 20340494-G-T DYZ19 ***
9502344-T-G 9664735-T-G ***
2698305-G-A 2830264-G-A ***
3097092-A-T 3229051-A-T ***
3482503-G-A 3614462-G-A ***
3576381-C-T 3708340-C-T ***
3995981-T-G 4127940-T-G ***
4219940-A-G 4351899-A-G ***
58854259-A-T 56736612-T-A ***
4219998-T-A 4351957-T-A ***
4298490-C-T 4430449-C-T ***
4521568-C-A 4653527-C-A ***
4910493-C-A 5042452-C-A ***
4914597-T-C 5046556-T-C ***
5043943-G-A 5175902-G-A ***
5088523-C-T 5220482-C-T ***
22337544-T-G 20175658-T-G DYZ19 ***
22337542-T-C 20175656-T-C DYZ19 ***
22292750-A-G 20130864-A-G DYZ19 ***
22332894-G-T 20171008-G-T DYZ19 ***
22292751-A-T 20130865-A-T DYZ19 ***
22292755-T-C 20130869-T-C DYZ19 ***
22311259-T-C 20149373-T-C DYZ19 ***
22357697-T-C 20195811-T-C DYZ19 ***
6346082-T-TTATA 6478041-T-TTATA 21×TA***
22311258-AT-CC 20149372-AT-CC DYZ19 ***
58916176-TGAGTCCATTCCAT-CGAG 56674682-ATGGAATGGACTCA-CTCG ***
13267803-G-A 11112127-G-A ***
58869522-A-T 56721349-T-A ***
9502319-C-T 9664710-C-T ***
13460953-G-C 11305277-G-C ***
13998105-G-T 11877399-G-T ***
22166607-G-A 20004721-G-A ***
13485979-G-T 11330303-G-T ***
58836670-G-T 56754201-C-A ***
13485864-G-T 11330188-G-T ***
13472261-T-C 11316585-T-C ***
13472340-G-A 11316664-G-A ***
22488282-A-G 20326396-A-G DYZ19 ***
22258116-C-A 20096230-C-A DYZ19 ***
22223900-G-T 20062014-G-T DYZ19 ***
22234938-C-T 20073052-C-T DYZ19 ***
22234943-A-C 20073057-A-C DYZ19 ***
22234961-C-G 20073075-C-G DYZ19 ***
22240866-T-A 20078980-T-A DYZ19 ***
22240886-C-T 20079000-C-T DYZ19 ***
13714804-C-T 11559128-C-T ***
22258117-A-G 20096231-A-G DYZ19 ***
22197157-C-A 20035271-C-A ***
22258294-G-A 20096408-G-A DYZ19 ***
22258297-G-T 20096411-G-T DYZ19 ***
22258307-G-C 20096421-G-C DYZ19 ***
22267246-T-C 20105360-T-C DYZ19 ***
22267247-G-T 20105361-G-T DYZ19 ***
22267259-T-C 20105373-T-C DYZ19 ***
22267268-C-A 20105382-C-A DYZ19 ***
22198303-G-T 20036417-G-T ***
22197133-T-C 20035247-T-C ***
22267290-C-G 20105404-C-G DYZ19 ***
20936955-G-T 18775069-G-T P4_Dst ***
20568504-C-T 18406618-C-T P5_Dst ***
20631384-G-T 18469498-G-T P4_Prx ***
20752573-T-A 18590687-T-A P4_Prx ***
20860258-T-C 18698372-T-C P4_Dst ***
20865722-C-T 18703836-C-T P4_Dst ***
20894764-C-G 18732878-C-G P4_Dst ***
20903584-G-A 18741698-G-A P4_Dst ***
20962626-T-A 18800740-T-A P4_Dst ***
21955124-C-T 19793238-C-T ***
21539552-T-A 19377666-T-A ***
21601954-A-G 19440068-A-G ***
21634129-T-G 19472243-T-G ***
21804623-G-T 19642737-G-T ***
21829990-T-A 19668104-T-A ***
21848685-G-T 19686799-G-T ***
21943762-G-A 19781876-G-A ***
22267286-A-G 20105400-A-G DYZ19 ***
22267571-A-G 20105685-A-G DYZ19 ***
20380249-C-A 18218363-C-A P5_Dst ***
22360838-C-T 20198952-C-T DYZ19 ***
22358387-C-T 20196501-C-T DYZ19 ***
22359984-C-T 20198098-C-T DYZ19 ***
22360028-G-A 20198142-G-A DYZ19 ***
22360045-C-G 20198159-C-G DYZ19 ***
22360061-C-T 20198175-C-T DYZ19 ***
22360106-G-A 20198220-G-A DYZ19 ***
22360135-T-A 20198249-T-A DYZ19 ***
22361197-A-T 20199311-A-T DYZ19 ***
22357686-G-C 20195800-G-C DYZ19 ***
22363306-T-C 20201420-T-C DYZ19 ***
22363322-A-G 20201436-A-G DYZ19 ***
22363448-A-C 20201562-A-C DYZ19 ***
22365407-T-A 20203521-T-A DYZ19 ***
22365488-T-G 20203602-T-G DYZ19 ***
22365512-T-G 20203626-T-G DYZ19 ***
22431603-A-G 20269717-A-G DYZ19 ***
22358377-A-T 20196491-A-T DYZ19 ***
22346933-T-C 20185047-T-C DYZ19 ***
22267603-A-C 20105717-A-C DYZ19 ***
22297216-A-C 20135330-A-C DYZ19 ***
22284815-A-T 20122929-A-T DYZ19 ***
22292727-G-T 20130841-G-T DYZ19 ***
22292767-C-G 20130881-C-G DYZ19 ***
22297193-A-T 20135307-A-T DYZ19 ***
22297198-A-G 20135312-A-G DYZ19 ***
22297208-G-A 20135322-G-A DYZ19 ***
22297212-C-G 20135326-C-G DYZ19 ***
22297223-G-T 20135337-G-T DYZ19 ***
22341706-G-A 20179820-G-A DYZ19 ***
22304595-T-G 20142709-T-G DYZ19 ***
22309438-T-A 20147552-T-A DYZ19 ***
22310288-A-C 20148402-A-C DYZ19 ***
22322580-G-T 20160694-G-T DYZ19 ***
22332889-A-G 20171003-A-G DYZ19 ***
22341127-C-A 20179241-C-A DYZ19 ***
22341180-G-T 20179294-G-T DYZ19 ***
20426133-C-G 18264247-C-G P5_Dst ***
20326322-C-T 18164436-C-T P5_Dst ***
13472345-C-T 11316669-C-T ***
14634308-C-T 12522377-C-T ***
14114332-A-G 11993626-A-G ***
14160620-T-G 12039914-T-G ***
14251500-C-T 12130794-C-T ***
14304743-G-A 12184037-G-A ***
14492812-C-A 12381009-C-A ***
14625857-A-G 12514126-A-G ***
14632024-T-A 12520093-T-A ***
14690125-C-A 12578191-C-A ***
14114294-A-G 11993588-A-G ***
14738433-G-T 12626501-G-T ***
15117844-A-G 13005931-A-G ***
15117913-A-G 13006000-A-G ***
15245100-T-A 13133186-T-A ***
15377151-C-T 13265271-C-T ***
15450050-C-A 13338170-C-A ***
15676717-C-T 13564837-C-T ***
14114307-G-C 11993601-G-C ***
13979624-T-C 11858918-T-C ***
15863003-A-T 13751123-A-T ***
13716960-T-C 11561284-T-C ***
13473426-G-A 11317750-G-A ***
13480979-A-T 11325303-A-T ***
13485891-C-G 11330215-C-G ***
13485989-A-C 11330313-A-C ***
13598257-A-T 11442581-A-T ***
13714811-G-A 11559135-G-A ***
13715607-C-A 11559931-C-A ***
13720457-T-C 11564781-T-C ***
13878304-C-A 11757598-C-A ***
13723597-G-C 11567921-G-C ***
13723666-G-A 11567990-G-A ***
13723701-C-T 11568025-C-T ***
13729686-A-C 11574010-A-C ***
13740881-T-C 11585205-T-C ***
13741013-G-C 11585337-G-C ***
13746658-T-G 11590982-T-G ***
15862973-C-G 13751093-C-G ***
15889374-A-C 13777494-A-C ***
20124383-T-A 18012503-T-A P5_Dst ***
19425896-A-G 17314016-A-G ***
18710355-G-A 16598475-G-A ***
18767761-T-A 16655881-T-A ***
19017016-C-T 16905136-C-T ***
19176271-G-A 17064391-G-A ***
19201925-C-A 17090045-C-A ***
19425797-T-G 17313917-T-G ***
19425809-T-A 17313929-T-A ***
19553701-G-T 17441821-G-T ***
18480193-G-A 16368313-G-A P6_Dst ***
19583983-C-G 17472103-C-G P5_Prx ***
19605576-T-A 17493696-T-A P5_Prx ***
19740845-G-A 17628965-G-A P5_Prx ***
19740875-C-G 17628995-C-G P5_Prx ***
19740942-T-A 17629062-T-A P5_Prx ***
19803952-A-C 17692072-A-C P5_Prx ***
19845289-A-G 17733409-A-G P5_Prx ***
18518428-A-T 16406548-A-T P6_Dst ***
18317882-T-C 16206002-T-C P6_Prx ***
15889402-G-T 13777522-G-T ***
16973686-C-A 14861806-C-A ***
15889404-T-C 13777524-T-C ***
15889409-A-T 13777529-A-T ***
15958770-G-A 13846890-G-A ***
15958814-G-A 13846934-G-A ***
16131196-G-A 14019316-G-A P8_Prx ***
16344831-T-A 14232951-T-A ***
16701520-T-A 14589640-T-A ***
17025614-C-G 14913734-C-G ***
18281731-C-A 16169851-C-A P6_Prx ***
17036430-A-C 14924550-A-C ***
17262031-A-T 15150151-A-T ***
17321287-A-T 15209407-A-T ***
17826435-A-C 15714555-A-C ***
17997689-T-A 15885809-T-A P7_Gap ***
17997792-C-T 15885912-C-T P7_Gap ***
18016075-C-T 15904195-C-T P7_Dst ***
18279660-A-G 16167780-A-G P6_Prx ***
58972250-C-CACTCG 56826103-C-CACTCG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: QCYUW*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs2724
Variant counts last updated 2017-11-05 23:06:48.

* BED data not available. Using default values.


Big Tree Main Page