Tree Position

A0-T-YP2191 > P305 > L413/PF1409/V31 > M168/PF1416 > P143 > M89/PF2746 > F1329/M3658 > F929 > L15/M523/S137 > M9 > F549 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POSITION-REF-ALT (hg19) Blocks Names Region McDonald BED combBED STRFTDNA
174607
7415624-T-TGATAGATAGATAGATA10×GATA+
23025162-G-TY16339YY+
17570438-T-CA917YY+
17705095-G-AA707YY+
17920941-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C45×A+
18073057-G-TA708YY+
13452332-GATTCC-G12×ATTCC+
25150165-T-GBY2347g1+
13680078-A-C+
19358849-TTCTATCTA-T10×TCTA+
13661039-G-A+
7717569-A-ACTTTCCTTTC12×CTTTC+
23767071-G-AA709Y+
22477925-T-GDYZ19+
23063698-TTTTATTTA-T10×TTTA+
22893304-CCTTTCTTTCTTT-C17×CTTT+
26004178-G-ABY6033P1_Y1+
25885852-AAAGG-AP1_Y17×AAGG+
18040350-ATAT-A13×TAT+
14025988-GAGAAAGAAAGAAAGAA-G13×AGAA+
17030336-T-TA+
19346433-CCTTT-C15×CTTT+
17196749-TAGAAAGAAAGAA-T14×AGAA+
20648567-A-AAAAGGAAAGGP4_Prx11×AAAGG+
22091940-A-GA918YY+
8218120-CTTCT-C15×TTCT+
9420993-A-GA704YY+
8464879-G-AA711YY+
7643536-AGGAAAGGAAGGGAAG-A+
7588541-C-GBY42 KMS1634YY+
22316332-G-TDYZ19+
9774442-TTTTC-T10×TTTC+
7730430-T-TGATAGATA11×GATA+
26099313-A-GBY2445P1_Y1+
17030339-A-AC+
18639018-A-AGT26×GT+
22275137-C-ABY1926DYZ19+
14031696-CTCTTTCTTTCTT-C13×TCTT+
17817341-TTATCTATC-T11×TATC+
14126006-G-CL1025YY+
14640101-T-GA705YY+
15610361-T-CY4706YY+
18872156-TTTTCTTTCTTTCTTTCTTTCTTTC-T16×TTTC+
24107373-AG-AP3_b1+
15979950-T-AA706YY+
26102537-C-TP1_Y1+
16349446-T-CA916YY+
27782638-ATGTTGT-AP1_Y214×TGT+
22275119-T-GDYZ19+
14200654-C-AYY*
13681088-C-ABY993**
22369722-N-CDYZ19**
9573712-G-AFGC14541IR3_Prx**
22369707-N-TDYZ19**
22369706-N-TDYZ19**
13140299-C-T**
13140307-A-T**
22369705-N-CDYZ19**
13140308-A-C**
22369698-N-TDYZ19**
22369704-N-ADYZ19**
22369724-N-GDYZ19**
13664766-C-ABY982**
22367113-T-ADYZ19**
22369702-N-GDYZ19**
13681063-T-A**
22369701-N-ADYZ19**
22369697-N-TDYZ19**
22369700-N-CDYZ19**
22369723-N-ADYZ19**
22369699-N-ADYZ19**
13681071-A-G**
13681031-T-G**
13681053-T-A**
7242049-T-A**
13681080-C-G**
13681086-C-G**
22369715-N-TDYZ19**
22369716-N-TDYZ19**
13680892-C-A**
22369717-N-ADYZ19**
22369718-N-TDYZ19**
22369713-N-TDYZ19**
22369712-N-GDYZ19**
22369719-N-GDYZ19**
22369711-N-GDYZ19**
58976766-A-C**
22369710-N-ADYZ19**
13732584-T-G**
13681006-A-G**
13681022-T-A**
22369709-N-ADYZ19**
22369720-N-TDYZ19**
22369714-N-GDYZ19**
13681039-A-T**
13681040-T-G**
22369721-N-CDYZ19**
13230389-C-A**
22480679-T-GDYZ19**
22369687-N-GDYZ19**
22369696-N-GDYZ19**
13801055-G-A**
8426377-GCTTCTT-G22×CTT**
20463423-A-AATTTP5_Dst9×ATTT**
22360358-T-CDYZ19**
20875153-CT-CP4_Dst10×T**
19839616-G-AP5_Prx26×A**
20989908-CT-CP4_Dst11×T**
13869507-G-A**
13854420-C-A**
13854421-T-C**
22256872-A-TDYZ19**
13858295-A-G**
13869378-C-T**
22275128-A-TDYZ19**
13139020-T-G**
13801053-T-G**
24033676-C-T**
13860094-T-G**
13681143-G-A**
13706502-C-G**
13706508-T-G**
26478108-AAAAGAAAGAAAG-AP1_Y119×AAAG**
13140221-T-C**
28585640-G-TCTS12405**
13706510-G-CBY1009**
13869361-C-A**
28802746-T-G**
20203507-A-ATGTP5_Dst10×TGT**
13680931-T-G**
13869344-A-G**
19412006-GAGAAAGAA-G14×AGAA**
13681108-C-A**
58974096-A-C**
22360385-T-GDYZ19**
22369695-N-TDYZ19**
22369685-N-CDYZ19**
22369694-N-GDYZ19**
22369693-N-ADYZ19**
4075885-C-A**
2864284-T-AY3041**
2864283-G-AY3040**
2864281-T-AY3039**
22369692-N-GDYZ19**
22369691-N-TDYZ19**
22369690-N-GDYZ19**
22369689-N-GDYZ19**
17278273-CGAAAGAAA-C16×GAAA**
22369688-N-TDYZ19**
13839833-ATCGGG-A**
22369686-N-ADYZ19**
22369684-N-TDYZ19**
13817992-GGCAAT-G**
5409728-TTTTCTTTCTTTCTTTC-T18×TTTC**
13732202-T-A**
22452635-A-GDYZ19**
22369703-N-CDYZ19**
20582532-AAATAAT-AP5_Dst12×AAT**
5415286-T-TTATCDF1048×TATC**
22273540-T-CDYZ19**
22341581-A-GDYZ19**
22369683-N-TDYZ19**
13801234-A-G**
13801229-T-G**
22369681-N-ADYZ19**
13732591-A-C**
13732590-C-G**
13732586-G-C**
22369725-N-ADYZ19**
22369708-N-ADYZ19**
22369726-N-GDYZ19**
22369789-N-CDYZ19**
22369824-N-ADYZ19**
22369796-N-GDYZ19**
22369795-N-TDYZ19**
22477957-A-CDYZ19**
22477956-A-CDYZ19**
22369794-N-ADYZ19**
22369793-N-ADYZ19**
22503337-T-GDYZ19**
22369792-N-GDYZ19**
22369825-N-CDYZ19**
22369791-N-ADYZ19**
13854406-T-C**
7508355-T-TTTCCTTCC13×TTCC**
22369790-N-ADYZ19**
22369788-N-TDYZ19**
22369823-N-TDYZ19**
13833199-A-TBY1036**
13732577-T-A**
22369782-N-TDYZ19**
22369783-N-TDYZ19**
22369784-N-CDYZ19**
22369785-N-ADYZ19**
13833197-G-A**
13833200-T-A**
27178495-A-GP1_g3**
22429692-T-ADYZ19**
9936836-T-TCTAG**
13681013-G-A**
22369786-N-CDYZ19**
22369787-N-TDYZ19**
22475878-G-ADYZ19**
22369727-N-TDYZ19**
22369797-N-ADYZ19**
13732582-C-A**
25929999-G-AP1_Y1**
13854413-T-G**
22369810-N-TDYZ19**
22369811-N-ADYZ19**
22369817-N-GDYZ19**
25761832-TAG-TP1_b3**
22369816-N-TDYZ19**
22369815-N-GDYZ19**
22369809-N-TDYZ19**
22369812-N-GDYZ19**
28621301-C-A**
27937678-C-CAP1_Y211×A**
22369813-N-TDYZ19**
22369814-N-GDYZ19**
27178493-A-CP1_g3**
22369818-N-ADYZ19**
22369808-N-ADYZ19**
22506592-C-GDYZ19**
22369802-N-GDYZ19**
22369798-N-ADYZ19**
22369799-N-GDYZ19**
13141200-C-T**
22369822-N-TDYZ19**
22369800-N-CDYZ19**
22369801-N-TDYZ19**
22369821-N-GDYZ19**
22369807-N-CDYZ19**
22369803-N-CDYZ19**
22369804-N-ADYZ19**
22369820-N-CDYZ19**
22369805-N-GDYZ19**
22369819-N-GDYZ19**
22369806-N-ADYZ19**
13732578-G-A**
27178494-T-AP1_g3**
22369781-N-GDYZ19**
22369749-N-GDYZ19**
16689382-A-T**
16689381-A-AC**
20848244-AT-AP4_Dst19×T**
20885466-TA-TP4_Dst12×A**
16689379-A-T**
22480678-G-ADYZ19**
13854402-T-G**
16689387-A-C**
22369734-N-CDYZ19**
15839573-C-A**
22369750-N-ADYZ19**
22369733-N-CDYZ19**
22369737-N-CDYZ19**
22369751-N-GDYZ19**
22369780-N-TDYZ19**
22369748-N-ADYZ19**
22369752-N-TDYZ19**
22369743-N-TDYZ19**
22369739-N-GDYZ19**
22369740-N-ADYZ19**
22369741-N-ADYZ19**
13858367-ATGGAATCACATAGAACGGAT-A**
22369742-N-GDYZ19**
22369736-N-TDYZ19**
13855120-A-T**
16689388-A-T**
22369735-N-TDYZ19**
16689390-A-C**
22369744-N-GDYZ19**
22369745-N-TDYZ19**
22369746-N-CDYZ19**
22369747-N-CDYZ19**
22369732-N-TDYZ19**
24171782-TA-TP3_b1**
22369753-N-TDYZ19**
22369771-N-TDYZ19**
22369766-N-CDYZ19**
22369767-N-ADYZ19**
22369768-N-GDYZ19**
22369769-N-GDYZ19**
22369728-N-TDYZ19**
22369770-N-TDYZ19**
22369772-N-CDYZ19**
22369765-N-GDYZ19**
22369773-N-ADYZ19**
22369774-N-TDYZ19**
22369775-N-GDYZ19**
22369776-N-GDYZ19**
22369777-N-TDYZ19**
22369778-N-CDYZ19**
22369779-N-TDYZ19**
22369754-N-TDYZ19**
22369738-N-ADYZ19**
22369764-N-GDYZ19**
22369756-N-TDYZ19**
22369763-N-TDYZ19**
22369762-N-CDYZ19**
22502171-G-TDYZ19**
22369761-N-TDYZ19**
22369729-N-TDYZ19**
22369730-N-GDYZ19**
22369755-N-CDYZ19**
22369760-N-TDYZ19**
22369731-N-TDYZ19**
22369759-N-CDYZ19**
22369758-N-CDYZ19**
22369757-N-TDYZ19**
28787372-A-T***
28800229-G-A***
58974795-A-C***
28803749-G-A***
9987855-T-C***
58980642-C-T***
13850417-C-G***
10016080-TA-T,TT***
58975308-G-T***
13868331-C-G***
28786046-A-G***
13842277-A-G***
13489681-C-T***
13686887-G-A***
13801973-A-T***
13818837-A-G***
13818838-A-G***
13838000-G-T***
13839915-A-G***
13489570-G-A***
13474253-C-A***
13868310-G-GGATTA***
13842227-A-C***
13846184-A-T***
28784368-A-G***
13853015-C-AFGC26142***
13853823-C-G***
13865894-C-G***
13868508-C-A***
13474204-GT-G***
13868879-C-T***
13869320-A-C,G***
22243099-T-ADYZ19***
22243103-C-GDYZ19***
22243105-G-CDYZ19***
22364275-C-TDYZ19***
22490739-G-ADYZ19***
13702572-C-A***
13818026-A-T***
13447568-C-G***
58975692-C-T***
13705325-G-C***
13740768-A-G4×AATGG***
13451910-A-C***
13805301-G-A***
13844692-ATGG-A***
22249318-T-ADYZ19***
22490030-C-TDYZ19***
58975577-T-C,G***
58976651-A-G***
13450023-C-CACTCT***
20984748-TTATCTATC-TP4_Dst12×TATC***
10017755-C-T***
28808553-C-T***
13652120-G-A***
13801561-G-A***
13810051-C-A***
13827131-C-G***
13844689-C-CTAA***
13850409-C-A***
13850426-T-G***
13862036-C-G***
13868869-C-T***
22502563-G-TDYZ19***
58974046-A-G***
13455461-C-T***
13705317-A-T***
28807604-G-C***
13805380-T-G***
13819089-A-C***
13805381-C-A***
13805396-T-A11×GAATG***
13868316-A-G***
19795144-C-CAP5_Prx16×A***
22475127-T-GDYZ19***
28784343-G-A***
58978479-G-T***
3279660-C-A***
3279661-C-G***
13732243-A-G***
13819083-G-C***
13821157-T-A***
25971912-T-CP1_Y1***
28784720-C-G***
13138391-A-ACCATT8×CCATT***
13445760-T-G***
13454914-C-T***
13457786-G-GATTCC4×ATTCC***
13470466-G-A***
13478992-G-A***
13693305-T-G***
13801216-A-T***
13801220-A-T***
13817980-C-A***
13861673-C-G***
13464357-G-C***
13866449-C-CAAATG***
13454748-T-A4×TTCCA***
13843413-A-T***
13868350-A-G***
13865900-A-G***
13859914-G-C***
13858618-C-T***
13857973-G-A***
13857608-C-A***
13853183-C-G***
13853058-T-G***
13853032-A-G***
13852126-C-G***
13847274-T-G***
13847263-C-G***
13847257-A-T***
13839855-A-G***
13868999-T-G***
13839648-T-A***
13839639-T-A***
13839008-C-A***
13833786-T-G***
13830162-G-A***
13827207-G-T***
13826049-T-A***
13819126-T-A***
13819114-A-T***
13819112-G-T***
13819078-A-G***
13819075-T-C***
13819063-T-A***
13868355-C-G***
13869000-T-G***
13819032-G-C***
28813024-T-G***
9985577-C-T***
58982866-C-T***
58982793-C-A***
58979425-C-T***
58975451-C-G***
58975331-C-G***
58975294-G-T***
58974883-G-T***
58974030-C-G***
58972861-A-T***
58883603-A-C,T***
28818194-G-A5×TGGAA***
28813935-A-AT***
28800209-G-A***
13869454-T-C***
28800154-A-G***
28796095-G-C***
28795430-T-A***
28795428-A-G***
28786023-G-A***
25727324-AT-AP1_b315×T***
24861640-C-CTP3_b227×T***
23899401-CGT-C17×GT***
23416012-CT-C12×T***
22488991-A-TDYZ19***
22476559-G-ADYZ19***
22456552-T-CDYZ19***
22450447-TC-TDYZ19***
22446107-C-TDYZ19***
13819033-G-A***
13818133-A-G***
13453787-C-A***
13320927-A-G***
13489814-G-A***
13473839-C-G***
13458723-T-C***
13457867-C-A***
13457860-A-C***
13453788-C-A***
13451145-T-C***
13448605-T-A***
13448356-C-A***
13446912-T-A***
13321069-A-T***
13321024-A-G***
13320932-T-C***
13320895-T-C***
13490054-C-A***
13320890-G-A***
13320879-A-T***
13320831-C-T***
13143847-T-C***
13140193-T-C***
13140188-T-C***
13140183-T-C***
13140173-T-C***
13139593-C-T***
10020849-G-C***
10020454-G-A***
10017719-T-C***
9994945-AT-A***
13490011-C-T***
13648909-C-G***
13818132-A-G***
13701442-TTCAA-T***
13818115-T-A***
13817970-G-A***
13815681-G-T***
13815675-G-A***
13815422-C-G***
13810196-C-A***
13808084-A-T***
13808080-T-C***
13808079-A-T***
13808066-G-T***
13805300-A-T***
13803023-C-G***
13704579-G-A***
13681106-C-G***
13658726-C-G***
13681035-G-C***
13681008-A-C***
13680980-G-T***
13680979-T-A***
13680975-G-T***
13680951-G-T***
13680934-T-A***
13680909-A-C,T***
13680865-C-G***
13680850-C-G***
13669572-A-G***
13669477-A-G***
13658932-T-G***
13658750-A-T4×GGAAT***
13433420-G-T***
13455779-G-C***
13451709-A-C***
58973996-GATTCC-C,CATTCT5×ATTCC***
13804738-A-C***
13801191-T-A,C***
13717331-GAATTA-G***
13705333-A-T***
13700317-A-G***
13686881-T-C***
13681069-A-C,T***
13676736-A-G***
13480360-AC-A***
13480246-C-A***
13464360-A-C***
13301679-C-T***
10017726-C-T***
58972845-C-A***
13818678-A-G***
23498080-AT-A19×T***
22296258-A-CDYZ19***
22276040-C-TDYZ19***
17833144-GT-G13×T***
13736065-T-G***
13853046-C-T***
13846215-T-C,G***
13846200-A-G***
13842142-C-G***
13839645-G-A***
13839630-G-T***
13839625-G-T***
13827054-A-G5×AATGG***
13810971-G-A***
13865889-A-G***
13721357-G-T***
13649013-A-G***
13402338-G-C***
28800184-A-G***
25777840-CAAT-CP1_b314×AAT***
13853023-T-G***
13847281-G-A***
13818032-A-G***
13813551-T-G***
13701321-A-T***
13664607-C-T***
9371457-CATAT-C22×AT***
13842605-C-A,G***
13838873-A-G***
13818792-GGAAAC-G***
59004463-AAAAG-A15×AAAG***
13867421-T-G***
23292130-AT-A13×T***
22438246-A-TDYZ19***
17528877-CA-C12×A***
13842630-C-A,G***
13677764-G-C***
13489949-C-TS14199***
28784792-G-A***
26511176-C-AP1_Y1***
13476527-T-A,G***
10019301-CAAA-C***
58974033-T-C***
28808562-G-T***
22769283-CT-C14×T***
22239132-G-CDYZ19***
13721361-G-C***
13721352-C-G***
13489270-C-A***
22490747-T-CDYZ19***
13714057-G-A***
13714054-A-C***
13714052-G-T***
13681046-G-A***
13680995-C-G***
13677777-T-G***
13677738-T-G***
13489849-G-A***
13455964-G-C***
13447154-T-C***
9985602-T-C***
58974806-T-C***
58862447-T-C***
22243107-C-TDYZ19***
13714062-C-G***
22238449-G-ADYZ19***
19967460-AT-AP5_Prx16×T***
16312068-GA-G15×A***
13858510-A-G15×AATGG***
13850246-C-G***
13847297-A-T***
13846210-A-G***
13838271-C-G***
13805349-C-A***
13805340-T-A***
13704442-C-T***
13677751-A-C***
13677733-C-G***
13489505-C-A***
13714061-T-G***
13714070-T-A***
13648906-C-A***
24023832-TA-T13×A***
13489804-C-A,G***
9945458-A-T***
9945416-T-C***
9836888-G-GT20×T***
7534812-CA-C13×A***
58980517-T-C***
58975349-A-T***
58975347-G-T***
58972891-T-G***
28794291-T-C***
28786759-A-G***
28786002-AGTGAC-A***
25971884-G-AP1_Y1***
22336409-G-ADYZ19***
13714071-T-C***
22276072-T-GDYZ19***
20241142-AT-AP5_Dst18×T***
17946635-CT-C20×T***
13868140-G-C***
13868138-A-C***
13867781-G-C***
13849135-A-T***
13849131-A-G***
13847286-G-A***
13846228-T-A***
13827164-A-G***
13821084-C-G***
13714081-A-G***
13714076-A-G***
13729108-T-G***
22249324-C-TDYZ19***
13736073-AGGAAT-A***
13680864-T-A***
13705186-G-A***
13705185-C-T***
13702827-G-C***
13681215-C-G***
13681190-G-T***
13681189-T-C***
13681169-T-C***
13681165-C-G***
13680881-G-T***
13651307-TGGAATAGATTGCAAG-T***
13706921-A-T***
13651301-A-G***
13480430-C-T***
13480428-A-T***
13451052-A-T***
13138462-C-T***
9852981-G-A,GAAAA***
9566676-A-CIR3_Prx***
9361192-CAA-C,CAC***
9353155-A-T***
9228923-G-A***
13705210-A-T***
13706937-T-G***
9188489-GTCT-G***
16157735-G-GAAAGAAAAGAP8_Dst10×AAAGA***
20023965-C-CATAGATAGP5_Prx8×ATAG***
19967465-T-AP5_Prx***
19966724-GA-GP5_Prx***
19899620-AGAAGGAAG-A,AGGAAGGAAP5_Prx14×GAAG***
19646801-A-GP5_Prx***
19606654-G-CP5_Prx***
19372284-TGATAGATAGATA-T,TG11×GATA***
18872248-C-CTCTTTCTTTCTT12×TCTT***
18329724-T-CP6_Prx***
16689376-C-CTTACAGCAAA***
13857610-T-G***
13706947-C-G***
13846194-T-C***
13838156-A-AGAATGGAATG,G11×GAATG***
13804376-C-A***
13709702-A-T***
13709700-G-A***
13709699-G-A***
13709695-G-C***
13709694-G-A***
13706970-C-A,G***
13706950-A-T***
9207088-C-T***
9030423-G-A***
20194878-AT-AP5_Dst10×T***
13447311-G-C***
22475507-G-TDYZ19***
13859872-G-A,C***
13450298-C-G***
13707925-C-A,T***
17781481-ATTTTTTATTTTATT-A***
17781497-TA-T***
14566770-CAA-C13×A***
22310928-A-TDYZ19***
22255418-C-ADYZ19***
22502697-G-AA4403DYZ19***
22360484-A-TDYZ19***
9177951-G-T***
22421538-G-CDYZ19***
22360572-C-GDYZ19***
18255155-C-CA12×A***
14379561-TGATA-T10×GATA***
10019286-GAAAAAAC-G***
10018585-A-ATTCT4×TTCT***
22249401-C-TDYZ19***
22452561-G-ADYZ19***
13489995-A-C***
22200355-C-CA13×A***
16514304-A-ATG18×TG***
8747696-TGAGA-T,TG18×GA***
2842214-T-A,TA***
8125076-GA-G***
8125054-AGAGAAGAGAG-A***
7671306-T-G***
7588523-A-TSUR82***
7588519-T-A***
7588517-T-G***
6347814-G-GAAAGAGAAAGAAAGAAAGAA12×AGAA***
6148741-A-CIR3_Dst***
6130992-ACATGT-A***
5976683-GTC-G,GT11×TC***
24022786-C-A***
13470053-G-A***
22463728-T-CDYZ19***
24673369-TA-TP3_b210×A***
28792457-G-A***
22439015-A-ACDYZ19***
22298805-A-CDYZ19***
58831777-C-A***
22476548-C-TDYZ19***
22476546-T-ADYZ19***
22267670-T-CDYZ19***
19337633-C-CT22×T***
20105742-TTATCTATC-T,TTP5_Dst14×TATC***
20213047-CT-CP5_Dst***
13681023-C-A,T***
23665478-T-C***
25252288-C-CATTATTATTP2_r113×ATT***
24799440-G-TP3_b2***
24522166-ATC-A,AT14×TC***
24346412-G-AP3_t1***
24298024-A-CP3_t1***
24278290-G-AP3_b1***
24079251-C-AP3_b1***
24072624-G-CP3_b1***
24042843-CT-C***
23311204-TTTCC-T11×TTCC***
25410382-G-GTP2_r2***
22511615-G-TDYZ19***
22503322-G-ADYZ19***
22479507-G-ADYZ19***
22479464-T-GDYZ19***
22476550-G-TDYZ19***
22476401-A-CDYZ19***
22476400-A-CDYZ19***
22476395-A-CDYZ19***
22476394-C-ADYZ19***
22476388-C-ADYZ19***
25255436-C-GP2_r1***
25417535-G-GTP2_r2***
22456817-C-A,GDYZ19***
13833390-G-A,C***
16718718-CAT-C,CAC***
16132304-AGATT-A,AGATA***
16108702-C-CTTTCTTTTCT,CTTTCTTTTCTTTTCTP8_Prx10×TTTCT***
14612382-TAGAC-T,TAGAT6×AGAC***
13705233-T-A,C***
6670460-TG-T,TT***
13862071-A-AAATGG,G11×AATGG***
13846299-A-G,T***
13865779-C-CGAATG,G10×GAATG***
13817976-C-A,T***
24417136-G-GAAA***
25791627-T-GP1_b3***
22282824-AAGCTGCAT-ADYZ19***
17794253-GT-G10×TTCT***
13681178-GTCGAA-G***
13658867-A-AAATGG***
9231646-T-TA10×A***
58973015-A-T***
58830345-T-A***
27087622-TC-TP1_r4***
26190685-GAA-G,GAP1_Y118×A***
26179746-AAAC-A,AAP1_Y113×AAC***
22476386-G-TDYZ19***
22454140-A-GDYZ19***
20280146-TC-TP5_Dst***
22264213-G-ADYZ19***
22291870-C-GDYZ19***
22289754-T-GDYZ19***
22284622-G-ADYZ19***
22280999-C-ADYZ19***
22267775-T-ADYZ19***
22267763-T-GDYZ19***
22267750-G-ADYZ19***
22267712-GTTCTTTCAGACGTGTCCAGAGTTTC-GDYZ19***
22267662-G-TDYZ19***
22267643-C-ADYZ19***
22257704-A-GDYZ19***
22297624-T-GDYZ19***
22250457-G-ADYZ19***
22240939-C-TDYZ19***
22240033-C-TDYZ19***
22238283-C-TDYZ19***
22230596-T-CZ4971DYZ19***
22226634-A-GDYZ19***
20892284-C-AFGC14545P4_Dst9×A***
20733873-G-AP4_Prx***
20732594-G-AP4_Prx***
20704726-T-CP4_Prx***
22294800-G-AFGC44700DYZ19***
22299555-C-ADYZ19***
22442620-G-TDYZ19***
22360431-G-CDYZ19***
22429056-AC-A,AGDYZ19***
22421560-C-TDYZ19***
22421537-A-TDYZ19***
22421045-A-TDYZ19***
22368060-C-ADYZ19***
22366595-T-GDYZ19***
22366067-A-TDYZ19***
22361416-C-ADYZ19***
22360477-T-CDYZ19***
22360476-G-TDYZ19***
22360414-C-TDYZ19***
22303787-A-GDYZ19***
22359820-C-TDYZ19***
22359793-G-TDYZ19***
22346365-G-ADYZ19***
22342274-C-ADYZ19***
22336612-T-CDYZ19***
22328908-G-ADYZ19***
22321769-T-TCDYZ19***
22310918-G-CDYZ19***
22310064-TA-TDYZ19***
22305235-T-GDYZ19***
13489984-T-G***
13717322-A-C***
13846223-A-C***
13701313-G-A***
13869459-C-G***
13817892-C-A***
13740071-T-C***
13714087-G-A***
28799138-C-G***
28785980-T-G***
13861686-A-T***
13833726-C-G***
13706630-C-A***
13464351-G-C***
21112410-TACAC-T17×AC***
20213005-TTTC-TP5_Dst26×TTC***
28796394-T-G***
13802897-G-T***
13447642-C-T***
13323517-A-T***
13323512-A-T***
25441211-AT-AP2_r222×T***
20700677-CCA-CP4_Prx12×CA***
17463321-TTA-T14×TA***
13852997-T-G***
20211758-AT-AP5_Dst14×T***
24669478-CT-CP3_b210×T***
13680924-C-G,T***
13680891-T-C,G***
13681146-G-T***
13681117-A-T***
13681105-G-C***
13681095-G-C***
13458412-ATTCCC-A***
28784721-T-A***
25200987-GAAGAAAGAAAGA-Gg114×AAGA***
13846185-A-G***
13842235-A-T***
13698409-C-T***
17198461-A-AAG18×AG***
13833425-T-C,G***
24050849-GA-GP3_b111×A***
13801992-A-T***
13801981-A-G***
13459208-TTCCAACTGAC-T***
10039472-A-T***
27791860-T-GP1_Y2***
26170524-AGAG-AP1_Y1***
7387396-A-AT22×T***
58819368-C-G***
13869243-C-A,T***
13852996-A-T***
13680916-A-C,G***
13810889-C-CAATGG,G9×AATGG***
13320307-A-G***
18354164-T-TAGAAAGAAP6_Prx13×AGAA***
13869517-C-T***
13820775-T-TATCGA11×ATGGA***
13808125-C-G***
13680853-A-G***
13677744-G-C***
13677718-A-G***
13489885-C-A***
13869907-C-T***
13320303-T-G***
22293443-G-ADYZ19***
8431924-CT-C11×T***
6861230-T-TTTTCTTTCTTTC17×TTTC***
58974901-A-C***
22420968-A-GDYZ19***
9994937-A-T***
22307480-C-GDYZ19***
17309026-TA-T11×A***
13868884-C-T***
13861646-G-A***
13853025-G-A***
22293442-A-TDYZ19***
8447182-GA-G11×A***
13481285-C-A***
13861669-G-GA***
13481282-C-A***
13819067-G-T***
58975514-G-T***
28818619-CG-C***
13861286-T-A***
13802907-A-C***
13802892-G-C***
58982803-T-G***
22293444-T-CDYZ19***
20326007-C-CTP5_Dst29×T***
13677842-G-A,T***
10017737-T-C***
13451336-T-C***
58985570-A-G***
58829649-C-G***
13827053-C-G***
13474235-A-T***
22255331-G-ADYZ19***
13819070-A-T***
13819068-G-A***
13811279-A-G***
13480314-T-A***
13681154-T-C***
13680855-G-T***
10020511-CAAAAGAAAAG-C,GAAAAGAAAAG10×AAAAG***
13448360-T-C***
6313301-TAC-TIR3_Dst***
13709358-C-G***
13707964-G-C***
6303382-GCA-GIR3_Dst***
28587726-AT-A***
13818002-A-G,T***
58975699-T-C***
13461907-C-T***
13735381-A-ATKMS160***
58975459-T-A***
22242475-T-GDYZ19***
58975361-C-G***
28588105-A-T***
13706960-A-T***
13706957-G-A***
13706956-G-C***
22240962-C-ADYZ19***
25500566-A-ATP2_r210×T***
13652130-G-A,GTGGAA11×TGGAA***
13476676-A-C,T***
13867732-C-G***
16146479-A-AAAAGAAAGP8_Dst12×AAAG***
24278282-G-AP3_b1***
13693318-A-T***
13664701-A-G***
28784683-A-G***
22481481-G-ADYZ19***
13818192-T-C,TGAATG10×GAATG***
9191008-C-A***
13681178-G-A***
16548363-T-TA15×A***
13664708-G-GGACAC***
15007104-TA-T11×A***
10039469-G-A***
10039468-T-C***
13821177-A-AGGAAT,T10×GGAAT***
13677728-G-C***
13449752-TCAACC-T,TCCATT***
24278286-C-AP3_b18×AG***
13446635-T-A,C***
22479298-T-GDYZ19***
13447314-T-A8×TCCAC***
22502629-G-TA4401DYZ19***
25241040-AG-AP2_r1***
13445753-ATT-A***
13470018-C-T***
24760630-TA-TP3_b215×A***
13867711-A-G***
22276240-A-TDYZ19***
13680859-T-A***
10019470-A-G***
13451712-T-C***
28808563-T-A***
25201091-AAAGG-Ag115×AAGG***
13802896-T-C***
13677729-T-A***
9977745-GGT-G***
58820143-C-TF14085***
25734047-G-GTP1_b311×T***
13680945-C-G***
22282793-C-GDYZ19***
25587242-CT-CP1_gr114×T***
24033715-GTTTA-G4×TTTA***
13658887-A-G***
25832899-CT-CP1_b39×T***
13740767-C-G***
13736130-C-G***
13474267-C-G***
28787551-T-A***
28787550-G-A***
13818005-C-A,T***
13706972-C-G***
13664783-T-C,G***
15436097-GT-G13×T***
13820793-G-C***
58975664-T-TTCCATTCCATTCCCG***
16063171-G-GTTTCTTTC14×TTTC***
13706495-C-A***
6133969-A-C***
13852980-C-A***
22484858-G-TDYZ19***
13853045-A-G***
13853040-A-T***
13853038-G-A***
13853003-G-A***
13852983-C-G***
13852982-C-G***
22228222-C-TDYZ19***
17923746-A-AAAAG11×AAAG***
13681093-C-A,T***
58983145-T-C***
22359716-A-CDYZ19***
22336298-C-TA4144DYZ19***
13448841-T-C***
58975453-G-T***
13476758-A-C***
58974058-T-C***
22762820-GA-G12×A***
58973100-ATTCCATTCCATTAGT-A,ATTCCATTCGATTCCATTCCATGGCATTCCA***
9994944-A-T***
21365422-CA-C17×A***
9987817-A-G***
13842863-C-G***
13846524-G-C***
13846520-G-A***
13846397-A-C***
13843693-A-T***
13843678-A-T***
13843675-A-G***
13843479-GGTAAA-G***
13842872-T-G***
13842870-C-A***
13842865-G-A***
13842856-C-T***
13846543-C-TFGC41107***
13839863-G-A***
13839844-C-T***
13839755-C-G***
13838585-C-T***
13838272-A-G***
13838266-A-G***
13838256-C-G***
13838239-G-A***
13838146-T-G***
13833776-T-G***
13833480-C-G***
13846527-T-A,G***
13846550-G-A***
13833418-A-T***
13851290-T-C***
13851440-C-T***
13851429-G-A***
13851428-T-A***
13851421-C-G***
13851416-C-G***
13851407-A-G***
13851405-G-A***
13851404-C-A***
13851314-A-G***
13851310-T-C***
13851305-T-G***
13851261-A-G***
13847276-C-A***
13851097-A-G***
13851083-A-C***
13851071-G-C***
13851069-A-T***
13850400-A-T***
13850353-T-A***
13850260-A-T***
13850245-T-A***
13850244-C-A***
13850234-G-A***
13847298-A-G***
13833421-G-A***
13832592-A-G***
13851526-T-G***
13722163-A-G***
13804912-T-G***
13804910-A-T***
13804760-T-A***
13804742-G-A***
13804741-G-C***
13804736-T-G***
13803040-C-AFGC46658***
13801203-A-G***
13801193-C-G***
13745371-C-A***
13722121-A-T***
13805465-A-T***
13721382-A-C***
13721381-C-G***
13721377-G-C***
13721375-T-G***
13721373-C-A***
13721369-G-A***
13721368-T-A***
13721366-A-G***
13721362-C-A***
13715589-GGAATT-G***
13704451-C-A***
13804920-G-T***
13808682-A-G***
13832590-A-G***
13818189-C-A***
13823284-G-A***
13822123-A-G***
13821152-A-T***
13820859-A-G***
13820833-C-G***
13820831-T-A***
13819953-A-T***
13819940-C-G***
13818817-T-G***
13818728-G-T***
13818727-T-G***
13817923-G-A***
13810173-A-G***
13817915-A-G***
13817913-G-C***
13817900-A-G***
13817878-G-T***
13817875-A-G***
13817868-T-G***
13817847-A-G***
13813531-A-G***
13810793-C-G***
13810792-A-T***
13810782-A-T***
13851524-T-A***
13851531-G-C***
13704431-A-G***
13868111-A-G***
13869052-C-A***
13869049-G-T***
13869024-C-G***
13868480-C-G***
13868478-C-A***
13868367-C-A***
13868209-G-T***
13868150-T-G***
13868148-C-A***
13868121-T-G5×AATGG***
13868101-A-G***
13869065-G-C***
13868095-A-G***
13868091-T-G***
13868090-T-G***
13868085-T-G***
13868083-G-A***
13867970-C-G***
13867476-T-G***
13865949-A-G***
13865759-A-G***
13864535-T-G***
13864530-A-G***
13869054-C-G4×GAATG***
13869067-A-G***
13864510-T-G***
13869368-T-A***
13869439-G-C***
13869437-A-C***
13869436-A-C***
13869433-T-A***
13869426-A-T***
13869425-G-T***
13869424-G-C***
13869419-G-T***
13869388-T-C***
13869383-G-T***
13869374-G-A***
13869365-A-G***
13869079-C-G4×GAATG***
13869345-G-A***
13869332-C-A***
13869330-A-G***
13869323-A-T***
13869317-C-G***
13869313-T-A***
13869304-G-C***
13869291-C-A***
13869236-G-A***
13869224-G-A***
13869222-A-G***
13864511-A-GS15097***
13862774-C-T***
13851540-A-T***
13851766-A-G***
13859844-G-C***
13858480-A-G***
13857563-A-C***
13857545-G-A***
13852105-A-T***
13852006-C-G***
13851977-A-G5×AATGG***
13851976-C-G***
13851961-C-G***
13851772-C-A***
13851767-T-G***
13851756-C-A***
13859873-T-A***
13851755-A-T***
13851747-T-G***
13851746-T-G***
13851741-A-T***
13851740-G-C***
13851710-T-A***
13851594-C-A***
13851585-TA-T,TG***
13851557-G-T***
13851546-G-C***
13851544-A-C***
13859845-G-A***
13859892-A-G***
13862760-A-G***
13862652-T-C***
13862753-C-TBY1046***
13862711-T-A***
13862709-G-A***
13862704-A-G***
13862703-A-T***
13862698-C-T***
13862673-T-A***
13862670-G-C***
13862666-AT-A***
13862660-G-C***
13862654-A-C***
13862651-T-A***
13859903-T-A***
13862646-T-A***
13862640-G-A***
13862638-T-C***
13862180-G-T***
13862068-C-A***
13860164-C-A***
13860012-A-ATGCAG***
13859977-G-A***
13859954-C-G***
13859945-G-A***
13859925-G-A***
13704444-T-G***
13704423-A-T***
13869452-A-C***
13448761-C-T***
13451140-A-C***
13450492-A-T***
13450482-A-T***
13449737-T-TAAACC***
13449676-T-A***
13448796-C-T***
13448786-C-T***
13448781-C-T***
13448776-C-T***
13448766-C-T***
13448756-C-T***
13451903-A-C***
13448711-C-T***
13448345-A-C***
13447711-C-T***
13447709-A-C***
13447668-G-GCATTC4×CATTC***
13447179-C-T***
13447174-C-T***
13446905-G-C***
13446891-T-C***
13446874-A-T***
13446608-C-T***
13451150-T-C***
13451904-C-A***
13320957-CT-C***
13453779-C-AS13811***
13455719-T-C10×ATTCC***
13455709-A-C***
13455639-A-C***
13455619-T-C***
13454809-C-T4×TCCAT***
13454807-T-C***
13454792-T-C***
13454302-A-C***
13454289-C-T***
13454194-TGGCAA-T***
13454179-A-T***
13453728-A-C***
13452959-A-C***
13453618-A-C12×ATTCC***
13453598-A-C***
13453530-T-A***
13453524-A-C***
13453444-A-C***
13453279-A-C,G***
13453276-T-C***
13453196-C-T***
13453013-G-C***
13452994-A-C***
13452979-T-C***
13445757-TAA-T***
13143872-C-T***
13455771-C-T***
9985662-G-T***
10020623-T-TCC***
10020622-C-CT***
10020501-G-A***
10020489-G-A***
10020396-G-C***
10019296-AC-A***
10018589-T-TTTC***
10017702-C-T***
9987980-T-C***
9985752-C-T***
9985631-A-G***
10023268-C-A***
9978388-G-T***
9978354-T-A***
9978346-G-C***
9972748-C-T***
9972726-A-G***
9972722-G-GT***
9955274-T-C***
9942041-G-A***
9942039-C-A***
9942037-T-A***
9937419-G-T***
10020634-G-C***
10032041-A-G***
13143862-C-T***
13140203-T-C***
13143817-T-C***
13141834-T-C***
13141169-T-A***
13141093-CGTTTT-C,CGT***
13140263-C-T***
13140243-C-T***
13140238-C-T***
13140233-T-C***
13140228-C-T***
13140213-T-C***
13140208-T-C***
13140198-T-C***
10032050-A-T8×T***
13140178-T-C***
13140153-C-T12×TCCAT***
13140148-C-T***
13140138-C-T***
13140133-C-T***
13140128-C-T***
13139690-G-C***
13138470-T-C***
13137340-TCCACA-T***
13137308-G-A***
10037247-C-T***
13455724-C-A***
13455784-A-C***
13704418-A-G***
13680834-C-T***
13681005-G-C***
13680993-T-A***
13680978-C-A***
13680965-C-G***
13680918-A-G***
13680905-C-G***
13680869-A-T4×GGAAT***
13680863-G-A***
13680854-A-T***
13680848-C-A***
13680828-G-A***
13681044-C-T***
13680825-T-G***
13677767-A-T***
13677766-C-G***
13677754-C-G***
13677753-G-C***
13676708-C-A***
13676630-C-G***
13664762-A-T***
13664696-A-C***
13658929-T-A***
13658901-T-G***
13681029-T-C***
13681045-G-A***
13658866-C-T***
13702779-A-C***
13704406-C-A***
13704404-T-GA1222***
13702812-G-A***
13702808-G-A***
13702806-A-G***
13702801-A-G***
13702796-T-C***
13702795-T-A***
13702787-C-G***
13702786-T-G***
13702782-G-A***
13702754-A-T***
13681047-A-T***
13701759-C-G***
13701449-A-C***
13701331-A-T***
13701327-G-C***
13701323-G-T***
13701209-A-GA3818***
13699247-T-A***
13696044-G-C***
13691614-A-T***
13686910-C-A***
13686900-A-G***
13658884-C-A***
13658736-G-C***
13458406-C-G***
13458713-C-T9×TCCAT***
13459080-T-C***
13458822-T-A***
13458805-A-C***
13458783-T-C***
13458773-T-C***
13458768-T-C***
13458753-T-C***
13458748-T-C***
13458743-T-C***
13458738-T-C***
13458718-T-C***
13458703-C-T***
13459187-G-A***
13458698-C-T***
13458693-C-T***
13458688-C-T***
13458683-C-T***
13458678-T-C5×TCCAC***
13458506-T-C***
13458502-T-A***
13458497-G-A***
13458490-T-C***
13458485-A-C***
13458410-C-A***
13459175-G-C***
13459196-T-C***
13658731-T-G***
13648907-T-A***
13652200-G-A***
13652111-C-T***
13651438-C-G***
13651423-C-T***
13651414-T-G***
13651408-A-G***
13651407-C-T***
13651402-C-T***
13651401-A-G***
13649011-T-A***
13648937-T-A***
13648897-A-T***
13459202-G-A***
13486013-A-C***
13483240-G-C***
13483239-T-C***
13472715-AG-A***
13472681-C-A***
13470506-C-T***
13463728-G-A***
13459661-G-A***
13459609-G-C***
13459221-A-C***
13459205-G-C***
13869448-T-C***
13869457-C-A***
9510732-CCT-C14×CT***
9981685-G-A***
13453020-C-A***
13451902-C-T***
13451895-T-C***
13448344-A-C***
13140280-T-C***
13140143-C-T***
10026393-A-CPF437***
10017699-T-C***
9994942-T-C***
9983012-A-T***
9981684-A-C***
13454306-A-C***
6222965-AT-AIR3_Dst12×T***
6130300-CAA-C***
2686603-TA-T16×A***
58980722-C-T***
58980687-T-C***
58980647-C-T***
58979480-T-C***
58979380-T-C***
58858911-CCATTG-C***
58822808-T-G***
58819380-A-T***
13453021-C-T***
13454307-A-C***
28785660-A-T***
13699246-A-T***
13842148-C-G***
13839864-C-T***
13839728-G-A***
13833796-C-G***
13833794-C-A***
13821103-T-G***
13745381-A-C***
13735019-A-T***
13722137-TGGAATGAAATGTAATGGAA-T***
13700306-C-G***
13700305-T-G***
13699244-C-A***
13455774-A-C***
13680886-G-C***
13680875-G-C***
13676646-C-G***
13653011-A-T***
13551088-T-C***
13467326-C-T***
13457855-A-C***
13457408-T-A***
13457402-G-C***
13457399-C-T***
13455956-C-T***
28811155-T-G***
28785656-A-G***
13846314-A-G***
25758270-C-AP1_b315×A***
2700292-CT-C11×T***
58983168-A-C***
58975705-A-T***
58844647-ATTCCT-A,ATTCCA***
28795413-A-G***
28795412-C-G***
28795410-G-A***
28787373-C-G***
28785704-G-A***
26953134-T-AP1_r3***
22505621-T-CDYZ19***
9942045-T-A***
22473978-A-TBY186 SUR34DYZ19***
22360426-A-TDYZ19***
20741857-CT-CP4_Prx14×T***
20729664-AT-AP4_Prx12×T***
20707114-CA-CP4_Prx14×A***
19988605-GA-GP5_Prx12×A***
16329294-AT-A18×T***
14887094-CT-C11×T***
13869422-A-C***
13868404-C-T***
13868070-A-G***
6332659-AAC-AIR3_Dst8×AC***
10020474-G-A***
25985430-AT-AP1_Y112×T***
13860218-A-T***
25220651-TA-TP2_r111×A***
22441642-T-GDYZ19***
22343977-TG-TDYZ19***
21142834-CA-C16×A***
20634947-AAT-AP4_Prx9×AT***
19964140-TA-TP5_Prx11×A***
19716310-G-GAATAP5_Prx9×AATA***
13869214-T-C,G***
13868287-C-A***
13867483-C-A***
13866453-C-T***
13818707-C-A***
10020479-G-A***
13815538-CAATGA-C***
13688674-C-T***
13664768-T-A,G***
13651327-T-A***
13649008-T-G***
13484111-T-C,G***
13458795-G-C***
13448751-C-T***
13447097-T-C***
13141313-A-C***
10020484-G-A***
13846282-C-A***
13847255-C-A***
13860120-A-G***
13852117-T-G***
25447269-GGTA-GP2_r29×GTA***
22344013-G-TDYZ19***
18454857-TC-TP6_Dst***
13868362-T-A***
13868103-T-A***
13868088-A-G***
13865834-A-G***
13865824-G-A***
13862768-C-T***
13852124-C-A***
13851713-A-AT,T***
25971895-T-CP1_Y1***
13851712-G-A***
13851711-T-A,G***
13851558-A-G***
13850360-C-T***
13839653-C-A***
13838263-C-A***
13833440-T-C,G***
13832506-A-AGGAAT,T12×GGAAT***
13822130-T-A***
13822129-T-A***
13818810-C-A***
25461433-C-CTTP2_r226×T***
28785669-G-A***
13748477-AGAATG-A6×GAATG***
19692989-CT-CP5_Prx11×T***
9221660-CATATATATAT-C27×AT***
58977495-C-T***
22361051-T-ADYZ19***
13722179-G-A***
13663194-A-C***
13451392-T-C***
13137786-G-C***
13137783-C-A***
10020829-C-A***
9952399-G-A***
3279668-T-C***
14753933-CA-C12×A***
28811158-T-A***
13701318-C-G***
13664774-T-G***
13485915-G-C***
13143705-C-T***
13138440-C-T***
10032046-T-A***
9307398-TTGTG-T,TTGAG15×TG***
58980697-T-C***
58975587-A-C***
58975578-G-A***
58974063-A-T***
13805364-C-A***
13696023-T-C***
13849152-C-G***
13936205-G-GAAGAAAGA14×AAGA***
28784443-G-A***
25501261-CT-CP2_r212×T***
23194817-CT-C24×T***
8702810-GT-G21×T***
22361038-T-CDYZ19***
22256886-A-TDYZ19***
21292579-TA-T15×A***
20958967-CT-CP4_Dst13×T***
20692965-CA-CP4_Prx19×A***
18109358-TA-T23×A***
14379561-T-TGATA10×GATA***
13869328-T-G***
28813933-G-A***
13869294-T-C,G***
13869234-A-C,G***
13868511-G-A***
13866719-G-A***
13863613-A-G***
13863612-C-T***
13859843-A-T5×GGAAT***
13851946-C-G***
13849176-A-G***
13849175-C-T***
13849155-A-T***
28785714-A-G***
58844574-C-T11×CCATT***
13696013-T-C***
10017721-C-T***
13664614-A-G***
13664335-T-AFGC33026***
13454177-A-C***
13449951-C-A***
13140168-T-C***
10020453-A-G***
10020448-A-G***
10020442-G-A***
10020435-A-T***
10020376-G-T***
10020370-G-AA4859***
10017711-C-T***
58844630-G-C4×CATTC***
10017707-C-T***
10017704-T-C***
9961021-C-A***
9942047-T-A***
9937423-G-T***
58980801-T-A***
58980597-T-C***
58980542-C-T***
58980505-T-C***
58974918-G-T***
58972979-G-C***
13861198-C-T***
13859839-C-G***
13869904-T-G***
25073370-CT-Cg113×T***
25971866-G-TP1_Y1***
25971863-G-TP1_Y1***
25971857-T-GP1_Y1***
25971852-C-AP1_Y1***
25307730-TA-TP2_r112×A***
25302951-TA-TP2_r112×A***
25298204-TA-TP2_r118×A***
25265708-AACT-AP2_r19×ACT***
25221549-CT-CP2_r119×T***
25181200-TA-Tg112×A***
25007696-TA-Tg111×A***
25971873-G-AP1_Y1***
24566404-A-ATP3_t214×T***
23897301-T-A***
23897295-A-G***
23897294-T-C***
22804535-CA-C12×A***
22512437-T-CDYZ19***
22511962-C-ADYZ19***
22507179-C-GDYZ19***
22507176-A-GDYZ19***
22503139-C-GDYZ19***
22502705-G-CDYZ19***
25971869-G-AP1_Y1***
25971879-A-GP1_Y1***
22502655-A-TDYZ19***
28785672-T-G***
28786613-T-G***
28786612-C-T***
28786607-A-T***
28786602-A-T***
28786600-G-A***
28786018-T-AA10495***
28785697-A-G***
28785696-A-G***
28785689-T-A***
28785687-T-G***
28785674-A-G***
28785670-A-T***
26262185-CT-CP1_Y121×T***
28785627-A-G***
28785626-C-G***
28784448-G-A***
28784413-A-G***
28784393-G-A***
28784378-G-A***
28784358-G-A***
28784348-G-A***
28784346-C-GS26519***
28587730-TAA-T***
27990599-C-GP1_Y2***
22502698-G-CDYZ19***
22502642-C-TDYZ19***
28786631-G-A***
19645682-CT-CP5_Prx14×T***
21916133-CT-C14×T***
8409442-CA-C11×A***
20798749-GA-GP4_Prx13×A***
20794447-AT-AP4_Prx14×T***
20690178-CT-CP4_Prx12×T***
19930059-AT-AP5_Prx13×T***
19895331-AT-AP5_Prx13×T***
19839042-G-GTP5_Prx15×T***
19831751-GA-GP5_Prx11×A***
19792996-G-GTP5_Prx15×T***
19746883-TTG-TP5_Prx13×TG***
19003405-AT-A14×T***
22231783-A-GDYZ19***
18318839-GA-GP6_Prx11×A***
17755384-T-TA17×A***
17711769-CT-C11×T***
16108786-A-CP8_Prx***
14480737-G-A***
14480736-T-C***
14480730-G-A***
14480729-T-C***
14480725-A-G***
14480724-C-T***
14480679-T-C***
22231759-AATGT-ADYZ19***
22238332-C-ADYZ19***
22491219-C-TDYZ19***
22271914-C-TDYZ19***
22491197-T-ADYZ19***
22490746-G-TDYZ19***
22490719-G-TDYZ19***
22476295-T-CDYZ19***
22476294-A-CDYZ19***
22364349-T-GDYZ19***
22358196-G-CDYZ19***
22289510-C-TDYZ19***
22289509-T-GDYZ19***
22271936-C-TDYZ19***
22271921-C-GDYZ19***
22271888-C-TDYZ19***
22238340-G-TDYZ19***
22270568-T-GDYZ19***
22259344-T-GDYZ19***
22259341-C-TA3985DYZ19***
22259340-C-TA3984DYZ19***
22259332-G-ADYZ19***
22259328-T-CDYZ19***
22259324-C-TDYZ19***
22259323-A-GDYZ19***
22255471-G-CDYZ19***
22238400-GA-GDYZ19***
22238369-G-CDYZ19***
28786619-C-G4×AGTGG***
28786652-T-A***
13853082-C-G***
13447169-C-T***
13459586-ATTGCG-A***
13459511-G-A***
13455979-T-C***
13455380-G-A***
13454288-G-A***
13452973-G-C***
13449694-T-G***
13449682-C-A***
13448771-T-C***
13448716-C-T***
13320387-T-A***
13459601-T-A***
13320385-C-G***
13301292-T-TG***
13301285-A-G***
13301284-C-T***
13142456-A-T***
13142452-A-C***
13142229-ATACTT-A***
10023253-G-T***
10023252-T-C***
10023236-G-GTGGTT***
10019575-CTTTT-C10×T***
13459599-T-C***
13461937-G-T***
9992570-C-T***
13817981-T-A***
13849174-G-A***
13842222-A-G***
13838555-C-T***
13838411-T-G***
13838155-A-T***
13838139-C-A***
13833370-A-G,T***
13823258-G-GAATAT***
13821258-A-G***
13821148-C-G***
13821131-G-A***
13801043-G-A***
13463727-C-T***
13801041-A-G***
13717372-C-A***
13714172-C-TFGC26126***
13714165-A-T***
13714029-A-T***
13701341-C-A,G***
13701328-G-A***
13680925-A-G***
13652115-A-G***
13652087-T-G***
13486019-A-G,T***
10018694-G-C***
9192345-G-T***
28786758-C-G***
28803897-T-ABY2545***
58973041-C-T***
58973038-A-C***
58973009-A-C,G***
58972876-G-T4×TCCAT***
58866021-C-T12×CCATT***
58858965-C-T***
58844689-C-T***
28818720-A-G***
28813304-A-TA4542***
28805484-A-C***
28803921-A-G***
28803893-G-C***
58973973-G-T***
28803883-C-A***
28803881-A-G***
28803858-T-G***
28803846-G-A***
28803845-A-T***
28803818-T-ABY2541***
28803782-AT-A***
28800181-T-G***
28800168-G-A***
28800149-G-A***
28786773-T-G***
58973965-A-C***
58973975-G-C***
58980737-T-C***
58979390-C-T***
58980727-C-T***
58980652-C-T***
58980592-T-C***
58980587-T-C***
58980567-T-C***
58980399-C-T***
58980089-C-T***
58980084-T-C***
58979470-C-T***
58979460-T-C***
58979395-T-C***
58979385-C-T***
58973986-C-G***
58979375-T-C***
58979365-T-C***
58979360-C-T***
58975362-T-A***
58975300-T-C***
58974051-A-C***
58974037-A-T***
58974022-A-C***
58974016-C-G***
58974005-C-T***
58973993-C-T***
17794252-CG-C,CT***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1746071044945175666147636925
Used in age calculations1044945175666147636925
Counts of SNPs00
Variant counts lasted updated .



Big Tree Main Page