Tree Position

A0-T-YP2191 > P305 > L413/PF1409/V31 > M168/PF1416 > P143 > M89/PF2746 > F1329/M3658 > F929 > L15/M523/S137 > M9 > F549 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
174607
8218120-CTTCT-C 8350079-CTTCT-C 15×TTCT+
23025162-G-T 20863276-G-T Y16339 YY+
27782638-ATGTTGT-A 25636491-ATGTTGT-A P1_Y2 14×TGT+
17570438-T-C 15458558-T-C A917 YY+
13452332-GATTCC-G 11296656-GATTCC-G 12×ATTCC+
17705095-G-A 15593215-G-A A707 YY+
17920941-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 15809061-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 45×A+
25150165-T-G 23004018-T-G BY2347 g1 +
18073057-G-T 15961177-G-T A708 YY+
13661039-G-A 11505363-G-A +
19358849-TTCTATCTA-T 17246969-TTCTATCTA-T 10×TCTA+
7730430-T-TGATAGATA 7862389-T-TGATAGATA 11×GATA+
7717569-A-ACTTTCCTTTC 7849528-A-ACTTTCCTTTC 12×CTTTC+
22477925-T-G 20316039-T-G DYZ19 +
23063698-TTTTATTTA-T 20901812-TTTTATTTA-T 10×TTTA+
22893304-CCTTTCTTTCTTT-C 20731418-CCTTTCTTTCTTT-C 17×CTTT+
13680078-A-C 11524402-A-C +
25885852-AAAGG-A 23739705-AAAGG-A P1_Y1 7×AAGG+
18040350-ATAT-A 15928470-ATAT-A 13×TAT+
14025988-GAGAAAGAAAGAAAGAA-G 11905282-GAGAAAGAAAGAAAGAA-G 13×AGAA+
17030336-T-TA 14918456-T-TA +
19346433-CCTTT-C 17234553-CCTTT-C 15×CTTT+
17196749-TAGAAAGAAAGAA-T 15084869-TAGAAAGAAAGAA-T 14×AGAA+
20648567-A-AAAAGGAAAGG 18486681-A-AAAAGGAAAGG P4_Prx 11×AAAGG+
22091940-A-G 19930054-A-G A918 YY+
9420993-A-G 9583384-A-G A704 YY+
8464879-G-A 8596838-G-A A711 YY+
7643536-AGGAAAGGAAGGGAAG-A 7775495-AGGAAAGGAAGGGAAG-A +
7588541-C-G 7720500-C-G BY42 KMS1634 YY+
22316332-G-T 20154446-G-T DYZ19 +
7415624-T-TGATAGATAGATAGATA 7547583-T-TGATAGATAGATAGATA 10×GATA+
9774442-TTTTC-T 9936833-TTTTC-T 10×TTTC+
23767071-G-A 21605185-G-A A709 Y+
26004178-G-A 23858031-G-A BY6033 P1_Y1 +
16349446-T-C 14237566-T-C A916 YY+
18639018-A-AGT 16527138-A-AGT 26×GT+
22275137-C-A 20113251-C-A BY1926 DYZ19 +
26099313-A-G 23953166-A-G BY2445 P1_Y1 +
14031696-CTCTTTCTTTCTT-C 11910990-CTCTTTCTTTCTT-C 13×TCTT+
14126006-G-C 12005300-G-C L1025 YY+
24107373-AG-A 21961226-AG-A P3_b1 +
18872156-TTTTCTTTCTTTCTTTCTTTCTTTC-T 16760276-TTTTCTTTCTTTCTTTCTTTCTTTC-T 16×TTTC+
14640101-T-G 12528170-T-G A705 YY+
15610361-T-C 13498481-T-C Y4706 YY+
15979950-T-A 13868070-T-A A706 YY+
17817341-TTATCTATC-T 15705461-TTATCTATC-T 11×TATC+
26102537-C-T 23956390-C-T P1_Y1 +
17030339-A-AC 14918459-A-AC +
22275119-T-G 20113233-T-G DYZ19 +
13449737-T-TAAACC 11294061-T-TAAACC ***
14200654-C-A 12079948-C-A YY*
16329294-AT-A 14217414-AT-A 18×T***
58980597-T-C 56834450-T-C ***
22369712-N-G 20207826-N-G DYZ19 **
22369700-N-C 20207814-N-C DYZ19 **
22369706-N-T 20207820-N-T DYZ19 **
22369720-N-T 20207834-N-T DYZ19 **
22369713-N-T 20207827-N-T DYZ19 **
22369705-N-C 20207819-N-C DYZ19 **
22369704-N-A 20207818-N-A DYZ19 **
22369703-N-C 20207817-N-C DYZ19 **
22369702-N-G 20207816-N-G DYZ19 **
22369698-N-T 20207812-N-T DYZ19 **
22369699-N-A 20207813-N-A DYZ19 **
22369721-N-C 20207835-N-C DYZ19 **
22369707-N-T 20207821-N-T DYZ19 **
22369697-N-T 20207811-N-T DYZ19 **
22369696-N-G 20207810-N-G DYZ19 **
22369722-N-C 20207836-N-C DYZ19 **
13140308-A-C 10629794-A-C **
13140307-A-T 10629793-A-T **
13140299-C-T 10629785-C-T **
22369723-N-A 20207837-N-A DYZ19 **
9573712-G-A 9736103-G-A FGC14541 IR3_Prx **
13681088-C-A 11525412-C-A BY993 **
22369708-N-A 20207822-N-A DYZ19 **
13681086-C-G 11525410-C-G **
13681006-A-G 11525330-A-G **
13681022-T-A 11525346-T-A **
22369695-N-T 20207809-N-T DYZ19 **
22369716-N-T 20207830-N-T DYZ19 **
22369717-N-A 20207831-N-A DYZ19 **
22369715-N-T 20207829-N-T DYZ19 **
22369714-N-G 20207828-N-G DYZ19 **
58976766-A-C 56830619-A-C **
13681031-T-G 11525355-T-G **
13681039-A-T 11525363-A-T **
13680892-C-A 11525216-C-A **
22369711-N-G 20207825-N-G DYZ19 **
13681080-C-G 11525404-C-G **
22369718-N-T 20207832-N-T DYZ19 **
13681040-T-G 11525364-T-G **
13732584-T-G 11576908-T-G **
22369710-N-A 20207824-N-A DYZ19 **
22369709-N-A 20207823-N-A DYZ19 **
13230389-C-A 11074713-C-A **
13681063-T-A 11525387-T-A **
22369719-N-G 20207833-N-G DYZ19 **
13681071-A-G 11525395-A-G **
7242049-T-A 7374008-T-A **
22480678-G-A 20318792-G-A DYZ19 **
22369694-N-G 20207808-N-G DYZ19 **
13681108-C-A 11525432-C-A **
20463423-A-AATTT 18301537-A-AATTT P5_Dst 9×ATTT**
22360358-T-C 20198472-T-C DYZ19 **
20875153-CT-C 18713267-CT-C P4_Dst 10×T**
19839616-G-A 17727736-G-A P5_Prx 26×A**
20989908-CT-C 18828022-CT-C P4_Dst 11×T**
13869507-G-A 11748801-G-A **
13854420-C-A 11733714-C-A **
13854421-T-C 11733715-T-C **
22256872-A-T 20094986-A-T DYZ19 **
13858295-A-G 11737589-A-G **
22275128-A-T 20113242-A-T DYZ19 **
13801055-G-A 11680349-G-A **
13801053-T-G 11680347-T-G **
13869378-C-T 11748672-C-T **
19412006-GAGAAAGAA-G 17300126-GAGAAAGAA-G 14×AGAA**
24033676-C-T 21887529-C-T **
13140221-T-C 10629707-T-C **
13681143-G-A 11525467-G-A **
13706502-C-G 11550826-C-G **
13706508-T-G 11550832-T-G **
9371457-CATAT-C 9533848-CATAT-C 22×AT***
26478108-AAAAGAAAGAAAG-A 24331961-AAAAGAAAGAAAG-A P1_Y1 19×AAAG**
28585640-G-T 26439493-G-T CTS12405 **
13860094-T-G 11739388-T-G **
13139020-T-G 10628506-T-G **
13706510-G-C 11550834-G-C BY1009 **
28802746-T-G 26656599-T-G **
20203507-A-ATGT 18041621-A-ATGT P5_Dst 10×TGT**
13680931-T-G 11525255-T-G **
13869344-A-G 11748638-A-G **
13869361-C-A 11748655-C-A **
8426377-GCTTCTT-G 8558336-GCTTCTT-G 22×CTT**
58974096-A-C 56827949-A-C **
22369693-N-A 20207807-N-A DYZ19 **
22369690-N-G 20207804-N-G DYZ19 **
13664766-C-A 11509090-C-A BY982 **
22369685-N-C 20207799-N-C DYZ19 **
22369686-N-A 20207800-N-A DYZ19 **
22369687-N-G 20207801-N-G DYZ19 **
22369688-N-T 20207802-N-T DYZ19 **
22369689-N-G 20207803-N-G DYZ19 **
17278273-CGAAAGAAA-C 15166393-CGAAAGAAA-C 16×GAAA**
13732586-G-C 11576910-G-C **
22369691-N-T 20207805-N-T DYZ19 **
2864281-T-A 2996240-T-A Y3039 **
2864283-G-A 2996242-G-A Y3040 **
2864284-T-A 2996243-T-A Y3041 **
4075885-C-A 4207844-C-A **
22369692-N-G 20207806-N-G DYZ19 **
22369684-N-T 20207798-N-T DYZ19 **
13732590-C-G 11576914-C-G **
22360385-T-G 20198499-T-G DYZ19 **
22273540-T-C 20111654-T-C DYZ19 **
13817992-GGCAAT-G 11697286-GGCAAT-G **
22452635-A-G 20290749-A-G DYZ19 **
13732202-T-A 11576526-T-A **
22369701-N-A 20207815-N-A DYZ19 **
20582532-AAATAAT-A 18420646-AAATAAT-A P5_Dst 12×AAT**
5415286-T-TTATC 5547245-T-TTATC DF104 8×TATC**
5409728-TTTTCTTTCTTTCTTTC-T 5541687-TTTTCTTTCTTTCTTTC-T 18×TTTC**
13732591-A-C 11576915-A-C **
22341581-A-G 20179695-A-G DYZ19 **
22367113-T-A 20205227-T-A DYZ19 **
13801234-A-G 11680528-A-G **
13801229-T-G 11680523-T-G **
22369681-N-A 20207795-N-A DYZ19 **
22369683-N-T 20207797-N-T DYZ19 **
22369724-N-G 20207838-N-G DYZ19 **
13681053-T-A 11525377-T-A **
13839833-ATCGGG-A 11719127-ATCGGG-A **
22477956-A-C 20316070-A-C DYZ19 **
22369788-N-T 20207902-N-T DYZ19 **
22369789-N-C 20207903-N-C DYZ19 **
22369825-N-C 20207939-N-C DYZ19 **
22369790-N-A 20207904-N-A DYZ19 **
22369791-N-A 20207905-N-A DYZ19 **
22369792-N-G 20207906-N-G DYZ19 **
22503337-T-G 20341451-T-G DYZ19 **
13681013-G-A 11525337-G-A **
22477957-A-C 20316071-A-C DYZ19 **
22369824-N-A 20207938-N-A DYZ19 **
22369823-N-T 20207937-N-T DYZ19 **
22369822-N-T 20207936-N-T DYZ19 **
22369821-N-G 20207935-N-G DYZ19 **
22369820-N-C 20207934-N-C DYZ19 **
7508355-T-TTTCCTTCC 7640314-T-TTTCCTTCC 13×TTCC**
13854406-T-C 11733700-T-C **
22369793-N-A 20207907-N-A DYZ19 **
13833197-G-A 11712491-G-A **
22369781-N-G 20207895-N-G DYZ19 **
22369782-N-T 20207896-N-T DYZ19 **
22369783-N-T 20207897-N-T DYZ19 **
13732582-C-A 11576906-C-A **
13732578-G-A 11576902-G-A **
13732577-T-A 11576901-T-A **
13833199-A-T 11712493-A-T BY1036 **
22369787-N-T 20207901-N-T DYZ19 **
13833200-T-A 11712494-T-A **
22429692-T-A 20267806-T-A DYZ19 **
22369784-N-C 20207898-N-C DYZ19 **
22369785-N-A 20207899-N-A DYZ19 **
27178494-T-A 25032347-T-A P1_g3 **
22475878-G-A 20313992-G-A DYZ19 **
22369725-N-A 20207839-N-A DYZ19 **
22369794-N-A 20207908-N-A DYZ19 **
22369779-N-T 20207893-N-T DYZ19 **
22369813-N-T 20207927-N-T DYZ19 **
22369808-N-A 20207922-N-A DYZ19 **
13854413-T-G 11733707-T-G **
22369809-N-T 20207923-N-T DYZ19 **
22369815-N-G 20207929-N-G DYZ19 **
22369814-N-G 20207928-N-G DYZ19 **
25761832-TAG-T 23615685-TAG-T P1_b3 **
28621301-C-A 26475154-C-A **
22369806-N-A 20207920-N-A DYZ19 **
25929999-G-A 23783852-G-A P1_Y1 **
27937678-C-CA 25791531-C-CA P1_Y2 11×A**
22369810-N-T 20207924-N-T DYZ19 **
22369811-N-A 20207925-N-A DYZ19 **
27178495-A-G 25032348-A-G P1_g3 **
22369812-N-G 20207926-N-G DYZ19 **
22369807-N-C 20207921-N-C DYZ19 **
22369805-N-G 20207919-N-G DYZ19 **
22369795-N-T 20207909-N-T DYZ19 **
22369799-N-G 20207913-N-G DYZ19 **
22369819-N-G 20207933-N-G DYZ19 **
22506592-C-G 20344706-C-G DYZ19 **
22369796-N-G 20207910-N-G DYZ19 **
22369797-N-A 20207911-N-A DYZ19 **
13141200-C-T 10630686-C-T **
22369798-N-A 20207912-N-A DYZ19 **
22369800-N-C 20207914-N-C DYZ19 **
22369804-N-A 20207918-N-A DYZ19 **
22369818-N-A 20207932-N-A DYZ19 **
22369817-N-G 20207931-N-G DYZ19 **
22369801-N-T 20207915-N-T DYZ19 **
22369802-N-G 20207916-N-G DYZ19 **
22369816-N-T 20207930-N-T DYZ19 **
22369803-N-C 20207917-N-C DYZ19 **
22369780-N-T 20207894-N-T DYZ19 **
22369786-N-C 20207900-N-C DYZ19 **
22369778-N-C 20207892-N-C DYZ19 **
22369744-N-G 20207858-N-G DYZ19 **
22369738-N-A 20207852-N-A DYZ19 **
22369739-N-G 20207853-N-G DYZ19 **
22369740-N-A 20207854-N-A DYZ19 **
22369741-N-A 20207855-N-A DYZ19 **
22369742-N-G 20207856-N-G DYZ19 **
22369743-N-T 20207857-N-T DYZ19 **
13858367-ATGGAATCACATAGAACGGAT-A 11737661-ATGGAATCACATAGAACGGAT-A **
9936836-T-TCTAG 10099227-T-TCTAG **
22369736-N-T 20207850-N-T DYZ19 **
22369745-N-T 20207859-N-T DYZ19 **
13855120-A-T 11734414-A-T **
22369777-N-T 20207891-N-T DYZ19 **
22369747-N-C 20207861-N-C DYZ19 **
20848244-AT-A 18686358-AT-A P4_Dst 19×T**
20885466-TA-T 18723580-TA-T P4_Dst 12×A**
22369748-N-A 20207862-N-A DYZ19 **
22369737-N-C 20207851-N-C DYZ19 **
22369735-N-T 20207849-N-T DYZ19 **
22369749-N-G 20207863-N-G DYZ19 **
22369732-N-T 20207846-N-T DYZ19 **
22369726-N-G 20207840-N-G DYZ19 **
22369727-N-T 20207841-N-T DYZ19 **
22369728-N-T 20207842-N-T DYZ19 **
22369729-N-T 20207843-N-T DYZ19 **
22369730-N-G 20207844-N-G DYZ19 **
22502171-G-T 20340285-G-T DYZ19 **
22369731-N-T 20207845-N-T DYZ19 **
15839573-C-A 13727693-C-A **
22369734-N-C 20207848-N-C DYZ19 **
22369733-N-C 20207847-N-C DYZ19 **
13854402-T-G 11733696-T-G **
16689379-A-T 14577499-A-T **
16689381-A-AC 14577501-A-AC **
16689382-A-T 14577502-A-T **
16689387-A-C 14577507-A-C **
16689388-A-T 14577508-A-T **
16689390-A-C 14577510-A-C **
22480679-T-G 20318793-T-G DYZ19 **
22369746-N-C 20207860-N-C DYZ19 **
24171782-TA-T 22025635-TA-T P3_b1 **
22369767-N-A 20207881-N-A DYZ19 **
22369759-N-C 20207873-N-C DYZ19 **
22369750-N-A 20207864-N-A DYZ19 **
22369761-N-T 20207875-N-T DYZ19 **
22369762-N-C 20207876-N-C DYZ19 **
22369763-N-T 20207877-N-T DYZ19 **
22369764-N-G 20207878-N-G DYZ19 **
22369765-N-G 20207879-N-G DYZ19 **
22369766-N-C 20207880-N-C DYZ19 **
22369768-N-G 20207882-N-G DYZ19 **
22369757-N-T 20207871-N-T DYZ19 **
22369769-N-G 20207883-N-G DYZ19 **
22369770-N-T 20207884-N-T DYZ19 **
22369771-N-T 20207885-N-T DYZ19 **
22369772-N-C 20207886-N-C DYZ19 **
22369773-N-A 20207887-N-A DYZ19 **
22369774-N-T 20207888-N-T DYZ19 **
22369775-N-G 20207889-N-G DYZ19 **
22369776-N-G 20207890-N-G DYZ19 **
22369758-N-C 20207872-N-C DYZ19 **
22369760-N-T 20207874-N-T DYZ19 **
27178493-A-C 25032346-A-C P1_g3 **
22369753-N-T 20207867-N-T DYZ19 **
22369751-N-G 20207865-N-G DYZ19 **
22369756-N-T 20207870-N-T DYZ19 **
22369752-N-T 20207866-N-T DYZ19 **
22369754-N-T 20207868-N-T DYZ19 **
22369755-N-C 20207869-N-C DYZ19 **
13818838-A-G 11698132-A-G ***
13869320-A-C,G 11748614-A-C,G ***
10016080-TA-T,TT 10178471-TA-T,TT ***
13868879-C-T 11748173-C-T ***
13868331-C-G 11747625-C-G ***
13818837-A-G 11698131-A-G ***
13868508-C-A 11747802-C-A ***
22243099-T-A 20081213-T-A DYZ19 ***
13447568-C-G 11291892-C-G ***
13865894-C-G 11745188-C-G ***
13853823-C-G 11733117-C-G ***
13801973-A-T 11681267-A-T ***
13805380-T-G 11684674-T-G ***
9987855-T-C 10150246-T-C ***
22490739-G-A 20328853-G-A DYZ19 ***
13853015-C-A 11732309-C-A FGC26142 ***
13489570-G-A 11333894-G-A ***
28784368-A-G 26638221-A-G ***
28786046-A-G 26639899-A-G ***
13846184-A-T 11725478-A-T ***
28787372-A-T 26641225-A-T ***
13842277-A-G 11721571-A-G ***
13702572-C-A 11546896-C-A ***
28800229-G-A 26654082-G-A ***
13842227-A-C 11721521-A-C ***
22364275-C-T 20202389-C-T DYZ19 ***
28803749-G-A 26657602-G-A ***
22243105-G-C 20081219-G-C DYZ19 ***
58974795-A-C 56828648-A-C ***
58975308-G-T 56829161-G-T ***
13839915-A-G 11719209-A-G ***
22243103-C-G 20081217-C-G DYZ19 ***
58980642-C-T 56834495-C-T ***
13838000-G-T 11717294-G-T ***
13850417-C-G 11729711-C-G ***
13844692-ATGG-A 11723986-ATGG-A ***
13805381-C-A 11684675-C-A ***
13652120-G-A 11496444-G-A ***
13451910-A-C 11296234-A-C ***
13805301-G-A 11684595-G-A ***
13818026-A-T 11697320-A-T ***
22249318-T-A 20087432-T-A DYZ19 ***
22490030-C-T 20328144-C-T DYZ19 ***
58975577-T-C,G 56829430-T-C,G ***
58976651-A-G 56830504-A-G ***
13450023-C-CACTCT 11294347-C-CACTCT ***
20984748-TTATCTATC-T 18822862-TTATCTATC-T P4_Dst 12×TATC***
58975692-C-T 56829545-C-T ***
10017755-C-T 10180146-C-T ***
13801561-G-A 11680855-G-A ***
13705325-G-C 11549649-G-C ***
13810051-C-A 11689345-C-A ***
13827131-C-G 11706425-C-G ***
13844689-C-CTAA 11723983-C-CTAA ***
13850409-C-A 11729703-C-A ***
13850426-T-G 11729720-T-G ***
13862036-C-G 11741330-C-G ***
13868869-C-T 11748163-C-T ***
22502563-G-T 20340677-G-T DYZ19 ***
58974046-A-G 56827899-A-G ***
13868310-G-GGATTA 11747604-G-GGATTA ***
13474253-C-A 11318577-C-A ***
13489681-C-T 11334005-C-T ***
13740768-A-G 11585092-A-G 4×AATGG***
13705317-A-T 11549641-A-T ***
13805396-T-A 11684690-T-A 11×GAATG***
28784720-C-G 26638573-C-G ***
13868316-A-G 11747610-A-G ***
19795144-C-CA 17683264-C-CA P5_Prx 16×A***
22475127-T-G 20313241-T-G DYZ19 ***
28784343-G-A 26638196-G-A ***
58978479-G-T 56832332-G-T ***
3279660-C-A 3411619-C-A ***
3279661-C-G 3411620-C-G ***
13732243-A-G 11576567-A-G ***
13819083-G-C 11698377-G-C ***
13819089-A-C 11698383-A-C ***
13821157-T-A 11700451-T-A ***
13138391-A-ACCATT 10627877-A-ACCATT 8×CCATT***
28808553-C-T 26662406-C-T ***
13445760-T-G 11290084-T-G ***
13454914-C-T 11299238-C-T ***
13457786-G-GATTCC 11302110-G-GATTCC 4×ATTCC***
13470466-G-A 11314790-G-A ***
13478992-G-A 11323316-G-A ***
13693305-T-G 11537629-T-G ***
13801216-A-T 11680510-A-T ***
13801220-A-T 11680514-A-T ***
13817980-C-A 11697274-C-A ***
13861673-C-G 11740967-C-G ***
25971912-T-C 23825765-T-C P1_Y1 ***
28807604-G-C 26661457-G-C ***
13686887-G-A 11531211-G-A ***
17833144-GT-G 15721264-GT-G 13×T***
13474204-GT-G 11318528-GT-G ***
13847274-T-G 11726568-T-G ***
13869000-T-G 11748294-T-G ***
13868999-T-G 11748293-T-G ***
13868355-C-G 11747649-C-G ***
13868350-A-G 11747644-A-G ***
13865900-A-G 11745194-A-G ***
13859914-G-C 11739208-G-C ***
13858618-C-T 11737912-C-T ***
13857973-G-A 11737267-G-A ***
13857608-C-A 11736902-C-A ***
13853183-C-G 11732477-C-G ***
13853058-T-G 11732352-T-G ***
13853032-A-G 11732326-A-G ***
13852126-C-G 11731420-C-G ***
13847263-C-G 11726557-C-G ***
22446107-C-T 20284221-C-T DYZ19 ***
13847257-A-T 11726551-A-T ***
13843413-A-T 11722707-A-T ***
13839855-A-G 11719149-A-G ***
13839648-T-A 11718942-T-A ***
13839639-T-A 11718933-T-A ***
13839008-C-A 11718302-C-A ***
13833786-T-G 11713080-T-G ***
13830162-G-A 11709456-G-A ***
13827207-G-T 11706501-G-T ***
13826049-T-A 11705343-T-A ***
13819126-T-A 11698420-T-A ***
13819114-A-T 11698408-A-T ***
13819112-G-T 11698406-G-T ***
13869454-T-C 11748748-T-C ***
22450447-TC-T 20288561-TC-T DYZ19 ***
13819075-T-C 11698369-T-C ***
28818194-G-A 26672047-G-A 5×TGGAA***
13453787-C-A 11298111-C-A ***
13433420-G-T 11277744-G-T ***
9985577-C-T 10147968-C-T ***
58982866-C-T 56836719-C-T ***
58982793-C-A 56836646-C-A ***
58979425-C-T 56833278-C-T ***
58975451-C-G 56829304-C-G ***
58975331-C-G 56829184-C-G ***
58975294-G-T 56829147-G-T ***
58974883-G-T 56828736-G-T ***
58974030-C-G 56827883-C-G ***
58972861-A-T 56826714-A-T ***
58883603-A-C,T 56707268-T-A,G ***
28813935-A-AT 26667788-A-AT ***
22456552-T-C 20294666-T-C DYZ19 ***
28813024-T-G 26666877-T-G ***
28800209-G-A 26654062-G-A ***
28800154-A-G 26654007-A-G ***
28796095-G-C 26649948-G-C ***
28795430-T-A 26649283-T-A ***
28795428-A-G 26649281-A-G ***
28786023-G-A 26639876-G-A ***
25727324-AT-A 23581177-AT-A P1_b3 15×T***
24861640-C-CT 22715493-C-CT P3_b2 27×T***
23899401-CGT-C 21737515-CGT-C 17×GT***
23416012-CT-C 21254126-CT-C 12×T***
22488991-A-T 20327105-A-T DYZ19 ***
22476559-G-A 20314673-G-A DYZ19 ***
13819078-A-G 11698372-A-G ***
13819063-T-A 11698357-T-A ***
13489270-C-A 11333594-C-A ***
13321024-A-G 11165348-A-G ***
13658726-C-G 11503050-C-G ***
13648909-C-G 11493233-C-G ***
13490054-C-A 11334378-C-A ***
13473839-C-G 11318163-C-G ***
13458723-T-C 11303047-T-C ***
13457867-C-A 11302191-C-A ***
13457860-A-C 11302184-A-C ***
13453788-C-A 11298112-C-A ***
13451145-T-C 11295469-T-C ***
13448605-T-A 11292929-T-A ***
13448356-C-A 11292680-C-A ***
13446912-T-A 11291236-T-A ***
13321069-A-T 11165393-A-T ***
13320932-T-C 11165256-T-C ***
13658932-T-G 11503256-T-G ***
13320927-A-G 11165251-A-G ***
13320895-T-C 11165219-T-C ***
13320890-G-A 11165214-G-A ***
13320879-A-T 11165203-A-T ***
13320831-C-T 11165155-C-T ***
13143847-T-C 10633333-T-C ***
13140193-T-C 10629679-T-C ***
13140188-T-C 10629674-T-C ***
13140183-T-C 10629669-T-C ***
13140173-T-C 10629659-T-C ***
13139593-C-T 10629079-C-T ***
10020849-G-C 10183240-G-C ***
10020454-G-A 10182845-G-A ***
13658750-A-T 11503074-A-T 4×GGAAT***
13669477-A-G 11513801-A-G ***
13819033-G-A 11698327-G-A ***
13805300-A-T 11684594-A-T ***
13819032-G-C 11698326-G-C ***
13818133-A-G 11697427-A-G ***
13818132-A-G 11697426-A-G ***
13818115-T-A 11697409-T-A ***
13817970-G-A 11697264-G-A ***
13815681-G-T 11694975-G-T ***
13815675-G-A 11694969-G-A ***
13815422-C-G 11694716-C-G ***
13810196-C-A 11689490-C-A ***
13808084-A-T 11687378-A-T ***
13808080-T-C 11687374-T-C ***
13808079-A-T 11687373-A-T ***
13808066-G-T 11687360-G-T ***
13803023-C-G 11682317-C-G ***
13669572-A-G 11513896-A-G ***
13704579-G-A 11548903-G-A ***
13701442-TTCAA-T 11545766-TTCAA-T ***
13681106-C-G 11525430-C-G ***
13681035-G-C 11525359-G-C ***
13681008-A-C 11525332-A-C ***
13680980-G-T 11525304-G-T ***
13680979-T-A 11525303-T-A ***
13680975-G-T 11525299-G-T ***
13680951-G-T 11525275-G-T ***
13680934-T-A 11525258-T-A ***
13680909-A-C,T 11525233-A-C,T ***
13680865-C-G 11525189-C-G ***
13680850-C-G 11525174-C-G ***
13455779-G-C 11300103-G-C ***
13489505-C-A 11333829-C-A ***
13464357-G-C 11308681-G-C ***
13301679-C-T 11146003-C-T ***
13818678-A-G 11697972-A-G ***
13810971-G-A 11690265-G-A ***
13804738-A-C 11684032-A-C ***
13801191-T-A,C 11680485-T-A,C ***
13717331-GAATTA-G 11561655-GAATTA-G ***
13705333-A-T 11549657-A-T ***
13700317-A-G 11544641-A-G ***
13686881-T-C 11531205-T-C ***
13681069-A-C,T 11525393-A-C,T ***
13676736-A-G 11521060-A-G ***
13480360-AC-A 11324684-AC-A ***
13480246-C-A 11324570-C-A ***
13464360-A-C 11308684-A-C ***
10017726-C-T 10180117-C-T ***
13867421-T-G 11746715-T-G ***
58973996-GATTCC-C,CATTCT 56827849-GATTCC-C,CATTCT 5×ATTCC***
58972845-C-A 56826698-C-A ***
23498080-AT-A 21336194-AT-A 19×T***
22296258-A-C 20134372-A-C DYZ19 ***
22276040-C-T 20114154-C-T DYZ19 ***
13736065-T-G 11580389-T-G ***
13866449-C-CAAATG 11745743-C-CAAATG ***
13853046-C-T 11732340-C-T ***
13846215-T-C,G 11725509-T-C,G ***
13846200-A-G 11725494-A-G ***
13842142-C-G 11721436-C-G ***
13839645-G-A 11718939-G-A ***
13839630-G-T 11718924-G-T ***
13865889-A-G 11745183-A-G ***
22239132-G-C 20077246-G-C DYZ19 ***
13827054-A-G 11706348-A-G 5×AATGG***
13838873-A-G 11718167-A-G ***
13455461-C-T 11299785-C-T ***
13454748-T-A 11299072-T-A 4×TTCCA***
13451709-A-C 11296033-A-C ***
13402338-G-C 11246662-G-C ***
28800184-A-G 26654037-A-G ***
25777840-CAAT-C 23631693-CAAT-C P1_b3 14×AAT***
13853023-T-G 11732317-T-G ***
13847281-G-A 11726575-G-A ***
13818032-A-G 11697326-A-G ***
13813551-T-G 11692845-T-G ***
13701321-A-T 11545645-A-T ***
13664607-C-T 11508931-C-T ***
13842605-C-A,G 11721899-C-A,G ***
13818792-GGAAAC-G 11698086-GGAAAC-G ***
22769283-CT-C 20607397-CT-C 14×T***
13649013-A-G 11493337-A-G ***
59004463-AAAAG-A 56858316-AAAAG-A 15×AAAG***
23292130-AT-A 21130244-AT-A 13×T***
22438246-A-T 20276360-A-T DYZ19 ***
17528877-CA-C 15416997-CA-C 12×A***
13842630-C-A,G 11721924-C-A,G ***
13677764-G-C 11522088-G-C ***
28784792-G-A 26638645-G-A ***
26511176-C-A 24365029-C-A P1_Y1 ***
13476527-T-A,G 11320851-T-A,G ***
10019301-CAAA-C 10181692-CAAA-C ***
58974033-T-C 56827886-T-C ***
28808562-G-T 26662415-G-T ***
13839625-G-T 11718919-G-T ***
13721361-G-C 11565685-G-C ***
13677733-C-G 11522057-C-G ***
58862447-T-C 56728424-A-G ***
13714061-T-G 11558385-T-G ***
13714057-G-A 11558381-G-A ***
13714054-A-C 11558378-A-C ***
13714052-G-T 11558376-G-T ***
13681046-G-A 11525370-G-A ***
13680995-C-G 11525319-C-G ***
13677777-T-G 11522101-T-G ***
13677738-T-G 11522062-T-G ***
13489849-G-A 11334173-G-A ***
13455964-G-C 11300288-G-C ***
13447154-T-C 11291478-T-C ***
9985602-T-C 10147993-T-C ***
58974806-T-C 56828659-T-C ***
22490747-T-C 20328861-T-C DYZ19 ***
13714070-T-A 11558394-T-A ***
22243107-C-T 20081221-C-T DYZ19 ***
22238449-G-A 20076563-G-A DYZ19 ***
19967460-AT-A 17855580-AT-A P5_Prx 16×T***
16312068-GA-G 14200188-GA-G 15×A***
13858510-A-G 11737804-A-G 15×AATGG***
13850246-C-G 11729540-C-G ***
13847297-A-T 11726591-A-T ***
13846210-A-G 11725504-A-G ***
13838271-C-G 11717565-C-G ***
13805349-C-A 11684643-C-A ***
13805340-T-A 11684634-T-A ***
13704442-C-T 11548766-C-T ***
13677751-A-C 11522075-A-C ***
13714062-C-G 11558386-C-G ***
13714071-T-C 11558395-T-C ***
13721357-G-T 11565681-G-T ***
25971884-G-A 23825737-G-A P1_Y1 ***
13721352-C-G 11565676-C-G ***
13648906-C-A 11493230-C-A ***
9945458-A-T 10107849-A-T ***
9945416-T-C 10107807-T-C ***
9836888-G-GT 9999279-G-GT 20×T***
7534812-CA-C 7666771-CA-C 13×A***
58980517-T-C 56834370-T-C ***
58975349-A-T 56829202-A-T ***
58975347-G-T 56829200-G-T ***
58972891-T-G 56826744-T-G ***
28794291-T-C 26648144-T-C ***
28786759-A-G 26640612-A-G ***
28786002-AGTGAC-A 26639855-AGTGAC-A ***
24023832-TA-T 21877685-TA-T 13×A***
13714076-A-G 11558400-A-G ***
22336409-G-A 20174523-G-A DYZ19 ***
22276072-T-G 20114186-T-G DYZ19 ***
20241142-AT-A 18079256-AT-A P5_Dst 18×T***
17946635-CT-C 15834755-CT-C 20×T***
13868140-G-C 11747434-G-C ***
13868138-A-C 11747432-A-C ***
13867781-G-C 11747075-G-C ***
13849135-A-T 11728429-A-T ***
13849131-A-G 11728425-A-G ***
13847286-G-A 11726580-G-A ***
13846228-T-A 11725522-T-A ***
13827164-A-G 11706458-A-G ***
13821084-C-G 11700378-C-G ***
13714081-A-G 11558405-A-G ***
13729108-T-G 11573432-T-G ***
14566770-CAA-C 12454970-CAA-C 13×A***
13736073-AGGAAT-A 11580397-AGGAAT-A ***
13681165-C-G 11525489-C-G ***
13706921-A-T 11551245-A-T ***
13705210-A-T 11549534-A-T ***
13705186-G-A 11549510-G-A ***
13705185-C-T 11549509-C-T ***
13702827-G-C 11547151-G-C ***
13681215-C-G 11525539-C-G ***
13681190-G-T 11525514-G-T ***
13681189-T-C 11525513-T-C ***
13681169-T-C 11525493-T-C ***
13680881-G-T 11525205-G-T ***
13706947-C-G 11551271-C-G ***
13680864-T-A 11525188-T-A ***
13651307-TGGAATAGATTGCAAG-T 11495631-TGGAATAGATTGCAAG-T ***
13651301-A-G 11495625-A-G ***
13480430-C-T 11324754-C-T ***
13480428-A-T 11324752-A-T ***
13451052-A-T 11295376-A-T ***
13138462-C-T 10627948-C-T ***
9852981-G-A,GAAAA 10015372-G-A,GAAAA ***
9566676-A-C 9729067-A-C IR3_Prx ***
9361192-CAA-C,CAC 9523583-CAA-C,CAC ***
13706937-T-G 11551261-T-G ***
13706950-A-T 11551274-A-T ***
9228923-G-A 9391314-G-A ***
18329724-T-C 16217844-T-C P6_Prx ***
20105742-TTATCTATC-T,TT 17993862-TTATCTATC-T,TT P5_Dst 14×TATC***
20023965-C-CATAGATAG 17912085-C-CATAGATAG P5_Prx 8×ATAG***
19967465-T-A 17855585-T-A P5_Prx ***
19966724-GA-G 17854844-GA-G P5_Prx ***
19899620-AGAAGGAAG-A,AGGAAGGAA 17787740-AGAAGGAAG-A,AGGAAGGAA P5_Prx 14×GAAG***
19646801-A-G 17534921-A-G P5_Prx ***
19606654-G-C 17494774-G-C P5_Prx ***
19372284-TGATAGATAGATA-T,TG 17260404-TGATAGATAGATA-T,TG 11×GATA***
18872248-C-CTCTTTCTTTCTT 16760368-C-CTCTTTCTTTCTT 12×TCTT***
16689376-C-CTTACAGCAAA 14577496-C-CTTACAGCAAA ***
13706970-C-A,G 11551294-C-A,G ***
16157735-G-GAAAGAAAAGA 14045855-G-GAAAGAAAAGA P8_Dst 10×AAAGA***
13857610-T-G 11736904-T-G ***
13846194-T-C 11725488-T-C ***
13838156-A-AGAATGGAATG,G 11717450-A-AGAATGGAATG,G 11×GAATG***
13804376-C-A 11683670-C-A ***
13709702-A-T 11554026-A-T ***
13709700-G-A 11554024-G-A ***
13709699-G-A 11554023-G-A ***
13709695-G-C 11554019-G-C ***
13709694-G-A 11554018-G-A ***
9353155-A-T 9515546-A-T ***
9207088-C-T 9369479-C-T ***
20213047-CT-C 18051161-CT-C P5_Dst ***
22255418-C-A 20093532-C-A DYZ19 ***
22360484-A-T 20198598-A-T DYZ19 ***
22200355-C-CA 20038469-C-CA 13×A***
22475507-G-T 20313621-G-T DYZ19 ***
13859872-G-A,C 11739166-G-A,C ***
13450298-C-G 11294622-C-G ***
13707925-C-A,T 11552249-C-A,T ***
17781481-ATTTTTTATTTTATT-A 15669601-ATTTTTTATTTTATT-A ***
17781497-TA-T 15669617-TA-T ***
22310928-A-T 20149042-A-T DYZ19 ***
22249324-C-T 20087438-C-T DYZ19 ***
13470053-G-A 11314377-G-A ***
13447311-G-C 11291635-G-C ***
22502697-G-A 20340811-G-A A4403 DYZ19 ***
9177951-G-T 9340342-G-T ***
22421538-G-C 20259652-G-C DYZ19 ***
22360572-C-G 20198686-C-G DYZ19 ***
18255155-C-CA 16143275-C-CA 12×A***
14379561-TGATA-T 12258857-TGATA-T 10×GATA***
10019286-GAAAAAAC-G 10181677-GAAAAAAC-G ***
10018585-A-ATTCT 10180976-A-ATTCT 4×TTCT***
22249401-C-T 20087515-C-T DYZ19 ***
16514304-A-ATG 14402424-A-ATG 18×TG***
19337633-C-CT 17225753-C-CT 22×T***
9188489-GTCT-G 9350880-GTCT-G ***
6130992-ACATGT-A 6262951-ACATGT-A ***
9030423-G-A 9192814-G-A ***
8747696-TGAGA-T,TG 8879655-TGAGA-T,TG 18×GA***
8125076-GA-G 8257035-GA-G ***
8125054-AGAGAAGAGAG-A 8257013-AGAGAAGAGAG-A ***
7671306-T-G 7803265-T-G ***
7588523-A-T 7720482-A-T SUR82 ***
7588519-T-A 7720478-T-A ***
7588517-T-G 7720476-T-G ***
6347814-G-GAAAGAGAAAGAAAGAAAGAA 6479773-G-GAAAGAGAAAGAAAGAAAGAA 12×AGAA***
6148741-A-C 6280700-A-C IR3_Dst ***
5976683-GTC-G,GT 6108642-GTC-G,GT 11×TC***
22267670-T-C 20105784-T-C DYZ19 ***
2842214-T-A,TA 2974173-T-A,TA ***
24022786-C-A 21876639-C-A ***
22463728-T-C 20301842-T-C DYZ19 ***
24673369-TA-T 22527222-TA-T P3_b2 10×A***
28792457-G-A 26646310-G-A ***
22439015-A-AC 20277129-A-AC DYZ19 ***
22298805-A-C 20136919-A-C DYZ19 ***
58831777-C-A 56759094-G-T ***
22476548-C-T 20314662-C-T DYZ19 ***
22476546-T-A 20314660-T-A DYZ19 ***
20194878-AT-A 18032992-AT-A P5_Dst 10×T***
20280146-TC-T 18118260-TC-T P5_Dst ***
13681023-C-A,T 11525347-C-A,T ***
23665478-T-C 21503592-T-C ***
25252288-C-CATTATTATT 23106141-C-CATTATTATT P2_r1 13×ATT***
24799440-G-T 22653293-G-T P3_b2 ***
24522166-ATC-A,AT 22376019-ATC-A,AT 14×TC***
24346412-G-A 22200265-G-A P3_t1 ***
24298024-A-C 22151877-A-C P3_t1 ***
24278290-G-A 22132143-G-A P3_b1 ***
24079251-C-A 21933104-C-A P3_b1 ***
24072624-G-C 21926477-G-C P3_b1 ***
24042843-CT-C 21896696-CT-C ***
23311204-TTTCC-T 21149318-TTTCC-T 11×TTCC***
25410382-G-GT 23264235-G-GT P2_r2 ***
22511615-G-T 20349729-G-T DYZ19 ***
22503322-G-A 20341436-G-A DYZ19 ***
22479507-G-A 20317621-G-A DYZ19 ***
22479464-T-G 20317578-T-G DYZ19 ***
22476550-G-T 20314664-G-T DYZ19 ***
22476401-A-C 20314515-A-C DYZ19 ***
22476400-A-C 20314514-A-C DYZ19 ***
22476395-A-C 20314509-A-C DYZ19 ***
22476394-C-A 20314508-C-A DYZ19 ***
22476388-C-A 20314502-C-A DYZ19 ***
25255436-C-G 23109289-C-G P2_r1 ***
25417535-G-GT 23271388-G-GT P2_r2 ***
22456817-C-A,G 20294931-C-A,G DYZ19 ***
13833390-G-A,C 11712684-G-A,C ***
16718718-CAT-C,CAC 14606838-CAT-C,CAC ***
16132304-AGATT-A,AGATA 14020424-AGATT-A,AGATA ***
16108702-C-CTTTCTTTTCT,CTTTCTTTTCTTTTCT 13996822-C-CTTTCTTTTCT,CTTTCTTTTCTTTTCT P8_Prx 10×TTTCT***
14612382-TAGAC-T,TAGAT 12500588-TAGAC-T,TAGAT 6×AGAC***
13705233-T-A,C 11549557-T-A,C ***
6670460-TG-T,TT 6802419-TG-T,TT ***
13862071-A-AAATGG,G 11741365-A-AAATGG,G 11×AATGG***
13846299-A-G,T 11725593-A-G,T ***
13865779-C-CGAATG,G 11745073-C-CGAATG,G 10×GAATG***
13817976-C-A,T 11697270-C-A,T ***
24417136-G-GAAA 22270989-G-GAAA ***
25791627-T-G 23645480-T-G P1_b3 ***
22282824-AAGCTGCAT-A 20120938-AAGCTGCAT-A DYZ19 ***
17794253-GT-G 15682373-GT-G 10×TTCT***
13681178-GTCGAA-G 11525502-GTCGAA-G ***
13658867-A-AAATGG 11503191-A-AAATGG ***
9231646-T-TA 9394037-T-TA 10×A***
58973015-A-T 56826868-A-T ***
58830345-T-A 56760526-A-T ***
27087622-TC-T 24941475-TC-T P1_r4 ***
26190685-GAA-G,GA 24044538-GAA-G,GA P1_Y1 18×A***
26179746-AAAC-A,AA 24033599-AAAC-A,AA P1_Y1 13×AAC***
22476386-G-T 20314500-G-T DYZ19 ***
22454140-A-G 20292254-A-G DYZ19 ***
20704726-T-C 18542840-T-C P4_Prx ***
22267643-C-A 20105757-C-A DYZ19 ***
22291870-C-G 20129984-C-G DYZ19 ***
22289754-T-G 20127868-T-G DYZ19 ***
22284622-G-A 20122736-G-A DYZ19 ***
22280999-C-A 20119113-C-A DYZ19 ***
22267775-T-A 20105889-T-A DYZ19 ***
22267763-T-G 20105877-T-G DYZ19 ***
22267750-G-A 20105864-G-A DYZ19 ***
22267712-GTTCTTTCAGACGTGTCCAGAGTTTC-G 20105826-GTTCTTTCAGACGTGTCCAGAGTTTC-G DYZ19 ***
22267662-G-T 20105776-G-T DYZ19 ***
22264213-G-A 20102327-G-A DYZ19 ***
22297624-T-G 20135738-T-G DYZ19 ***
22257704-A-G 20095818-A-G DYZ19 ***
22250457-G-A 20088571-G-A DYZ19 ***
22240939-C-T 20079053-C-T DYZ19 ***
22240033-C-T 20078147-C-T DYZ19 ***
22238283-C-T 20076397-C-T DYZ19 ***
22230596-T-C 20068710-T-C Z4971 DYZ19 ***
22226634-A-G 20064748-A-G DYZ19 ***
20892284-C-A 18730398-C-A FGC14545 P4_Dst 9×A***
20733873-G-A 18571987-G-A P4_Prx ***
20732594-G-A 18570708-G-A P4_Prx ***
22294800-G-A 20132914-G-A FGC44700 DYZ19 ***
22299555-C-A 20137669-C-A DYZ19 ***
22442620-G-T 20280734-G-T DYZ19 ***
22360431-G-C 20198545-G-C DYZ19 ***
22429056-AC-A,AG 20267170-AC-A,AG DYZ19 ***
22421560-C-T 20259674-C-T DYZ19 ***
22421537-A-T 20259651-A-T DYZ19 ***
22421045-A-T 20259159-A-T DYZ19 ***
22368060-C-A 20206174-C-A DYZ19 ***
22366595-T-G 20204709-T-G DYZ19 ***
22366067-A-T 20204181-A-T DYZ19 ***
22361416-C-A 20199530-C-A DYZ19 ***
22360477-T-C 20198591-T-C DYZ19 ***
22360476-G-T 20198590-G-T DYZ19 ***
22360414-C-T 20198528-C-T DYZ19 ***
22303787-A-G 20141901-A-G DYZ19 ***
22359820-C-T 20197934-C-T DYZ19 ***
22359793-G-T 20197907-G-T DYZ19 ***
22346365-G-A 20184479-G-A DYZ19 ***
22342274-C-A 20180388-C-A DYZ19 ***
22336612-T-C 20174726-T-C DYZ19 ***
22328908-G-A 20167022-G-A DYZ19 ***
22321769-T-TC 20159883-T-TC DYZ19 ***
22310918-G-C 20149032-G-C DYZ19 ***
22310064-TA-T 20148178-TA-T DYZ19 ***
22305235-T-G 20143349-T-G DYZ19 ***
22452561-G-A 20290675-G-A DYZ19 ***
13717322-A-C 11561646-A-C ***
13846223-A-C 11725517-A-C ***
13701313-G-A 11545637-G-A ***
13869459-C-G 11748753-C-G ***
13817892-C-A 11697186-C-A ***
13740071-T-C 11584395-T-C ***
13714087-G-A 11558411-G-A ***
28799138-C-G 26652991-C-G ***
28785980-T-G 26639833-T-G ***
13861686-A-T 11740980-A-T ***
13833726-C-G 11713020-C-G ***
13706630-C-A 11550954-C-A ***
13464351-G-C 11308675-G-C ***
21112410-TACAC-T 18950524-TACAC-T 17×AC***
20213005-TTTC-T 18051119-TTTC-T P5_Dst 26×TTC***
28796394-T-G 26650247-T-G ***
13802897-G-T 11682191-G-T ***
13447642-C-T 11291966-C-T ***
13323517-A-T 11167841-A-T ***
13323512-A-T 11167836-A-T ***
25441211-AT-A 23295064-AT-A P2_r2 22×T***
20700677-CCA-C 18538791-CCA-C P4_Prx 12×CA***
17463321-TTA-T 15351441-TTA-T 14×TA***
13852997-T-G 11732291-T-G ***
20211758-AT-A 18049872-AT-A P5_Dst 14×T***
24669478-CT-C 22523331-CT-C P3_b2 10×T***
13680924-C-G,T 11525248-C-G,T ***
13680891-T-C,G 11525215-T-C,G ***
13681146-G-T 11525470-G-T ***
13681117-A-T 11525441-A-T ***
13681105-G-C 11525429-G-C ***
13681095-G-C 11525419-G-C ***
13458412-ATTCCC-A 11302736-ATTCCC-A ***
28784721-T-A 26638574-T-A ***
25200987-GAAGAAAGAAAGA-G 23054840-GAAGAAAGAAAGA-G g1 14×AAGA***
13846185-A-G 11725479-A-G ***
13842235-A-T 11721529-A-T ***
13698409-C-T 11542733-C-T ***
17198461-A-AAG 15086581-A-AAG 18×AG***
13833425-T-C,G 11712719-T-C,G ***
24050849-GA-G 21904702-GA-G P3_b1 11×A***
13801992-A-T 11681286-A-T ***
13801981-A-G 11681275-A-G ***
13459208-TTCCAACTGAC-T 11303532-TTCCAACTGAC-T ***
10039472-A-T 10201863-A-T ***
27791860-T-G 25645713-T-G P1_Y2 ***
26170524-AGAG-A 24024377-AGAG-A P1_Y1 ***
7387396-A-AT 7519355-A-AT 22×T***
58819368-C-G 56771503-G-C ***
13869243-C-A,T 11748537-C-A,T ***
13852996-A-T 11732290-A-T ***
13680916-A-C,G 11525240-A-C,G ***
13810889-C-CAATGG,G 11690183-C-CAATGG,G 9×AATGG***
13320307-A-G 11164631-A-G ***
18354164-T-TAGAAAGAA 16242284-T-TAGAAAGAA P6_Prx 13×AGAA***
13869517-C-T 11748811-C-T ***
13820775-T-TATCGA 11700069-T-TATCGA 11×ATGGA***
13808125-C-G 11687419-C-G ***
13680853-A-G 11525177-A-G ***
13677744-G-C 11522068-G-C ***
13677718-A-G 11522042-A-G ***
13489885-C-A 11334209-C-A ***
13869907-C-T 11749201-C-T ***
13320303-T-G 11164627-T-G ***
22293443-G-A 20131557-G-A DYZ19 ***
8431924-CT-C 8563883-CT-C 11×T***
6861230-T-TTTTCTTTCTTTC 6993189-T-TTTTCTTTCTTTC 17×TTTC***
58974901-A-C 56828754-A-C ***
22420968-A-G 20259082-A-G DYZ19 ***
22307480-C-G 20145594-C-G DYZ19 ***
9994945-AT-A 10157336-AT-A ***
17309026-TA-T 15197146-TA-T 11×A***
13868884-C-T 11748178-C-T ***
13861646-G-A 11740940-G-A ***
13853025-G-A 11732319-G-A ***
22293442-A-T 20131556-A-T DYZ19 ***
8447182-GA-G 8579141-GA-G 11×A***
13481285-C-A 11325609-C-A ***
13861669-G-GA 11740963-G-GA ***
13481282-C-A 11325606-C-A ***
13819067-G-T 11698361-G-T ***
58975514-G-T 56829367-G-T ***
28818619-CG-C 26672472-CG-C ***
13861286-T-A 11740580-T-A ***
13802907-A-C 11682201-A-C ***
13802892-G-C 11682186-G-C ***
58982803-T-G 56836656-T-G ***
22293444-T-C 20131558-T-C DYZ19 ***
20326007-C-CT 18164121-C-CT P5_Dst 29×T***
13677842-G-A,T 11522166-G-A,T ***
10017737-T-C 10180128-T-C ***
13451336-T-C 11295660-T-C ***
58985570-A-G 56839423-A-G ***
58829649-C-G 56761222-G-C ***
13827053-C-G 11706347-C-G ***
13474235-A-T 11318559-A-T ***
22255331-G-A 20093445-G-A DYZ19 ***
13819070-A-T 11698364-A-T ***
13819068-G-A 11698362-G-A ***
13811279-A-G 11690573-A-G ***
13480314-T-A 11324638-T-A ***
13681154-T-C 11525478-T-C ***
13680855-G-T 11525179-G-T ***
10020511-CAAAAGAAAAG-C,GAAAAGAAAAG 10182902-CAAAAGAAAAG-C,GAAAAGAAAAG 10×AAAAG***
13448360-T-C 11292684-T-C ***
6313301-TAC-T 6445260-TAC-T IR3_Dst ***
13709358-C-G 11553682-C-G ***
13707964-G-C 11552288-G-C ***
6303382-GCA-G 6435341-GCA-G IR3_Dst ***
28587726-AT-A 26441579-AT-A ***
13818002-A-G,T 11697296-A-G,T ***
58975699-T-C 56829552-T-C ***
13461907-C-T 11306231-C-T ***
13735381-A-AT 11579705-A-AT KMS160 ***
58975459-T-A 56829312-T-A ***
22242475-T-G 20080589-T-G DYZ19 ***
58975361-C-G 56829214-C-G ***
28588105-A-T 26441958-A-T ***
13706960-A-T 11551284-A-T ***
13706957-G-A 11551281-G-A ***
13706956-G-C 11551280-G-C ***
22240962-C-A 20079076-C-A DYZ19 ***
25500566-A-AT 23354419-A-AT P2_r2 10×T***
13652130-G-A,GTGGAA 11496454-G-A,GTGGAA 11×TGGAA***
13867732-C-G 11747026-C-G ***
13867711-A-G 11747005-A-G ***
16146479-A-AAAAGAAAG 14034599-A-AAAAGAAAG P8_Dst 12×AAAG***
24278282-G-A 22132135-G-A P3_b1 ***
22276240-A-T 20114354-A-T DYZ19 ***
13664701-A-G 11509025-A-G ***
28784683-A-G 26638536-A-G ***
22481481-G-A 20319595-G-A DYZ19 ***
13818192-T-C,TGAATG 11697486-T-C,TGAATG 10×GAATG***
9191008-C-A 9353399-C-A ***
13681178-G-A 11525502-G-A ***
16548363-T-TA 14436483-T-TA 15×A***
13664708-G-GGACAC 11509032-G-GGACAC ***
15007104-TA-T 12895189-TA-T 11×A***
10039469-G-A 10201860-G-A ***
10039468-T-C 10201859-T-C ***
13821177-A-AGGAAT,T 11700471-A-AGGAAT,T 10×GGAAT***
13677728-G-C 11522052-G-C ***
13449752-TCAACC-T,TCCATT 11294076-TCAACC-T,TCCATT ***
24278286-C-A 22132139-C-A P3_b1 8×AG***
13446635-T-A,C 11290959-T-A,C ***
22479298-T-G 20317412-T-G DYZ19 ***
13447314-T-A 11291638-T-A 8×TCCAC***
22502629-G-T 20340743-G-T A4401 DYZ19 ***
25241040-AG-A 23094893-AG-A P2_r1 ***
13445753-ATT-A 11290077-ATT-A ***
13470018-C-T 11314342-C-T ***
24760630-TA-T 22614483-TA-T P3_b2 15×A***
13693318-A-T 11537642-A-T ***
58975664-T-TTCCATTCCATTCCCG 56829517-T-TTCCATTCCATTCCCG ***
13680859-T-A 11525183-T-A ***
10019470-A-G 10181861-A-G ***
28808563-T-A 26662416-T-A ***
25201091-AAAGG-A 23054944-AAAGG-A g1 15×AAGG***
13802896-T-C 11682190-T-C ***
13677729-T-A 11522053-T-A ***
9977745-GGT-G 10140136-GGT-G ***
58820143-C-T 56770728-G-A F14085 ***
25734047-G-GT 23587900-G-GT P1_b3 11×T***
13680945-C-G 11525269-C-G ***
22282793-C-G 20120907-C-G DYZ19 ***
25587242-CT-C 23441095-CT-C P1_gr1 14×T***
15436097-GT-G 13324217-GT-G 13×T***
13658887-A-G 11503211-A-G ***
25832899-CT-C 23686752-CT-C P1_b3 9×T***
13740767-C-G 11585091-C-G ***
13736130-C-G 11580454-C-G ***
13474267-C-G 11318591-C-G ***
28787551-T-A 26641404-T-A ***
28787550-G-A 26641403-G-A ***
13818005-C-A,T 11697299-C-A,T ***
13706972-C-G 11551296-C-G ***
13664783-T-C,G 11509107-T-C,G ***
13451712-T-C 11296036-T-C ***
24033715-GTTTA-G 21887568-GTTTA-G 4×TTTA***
13706495-C-A 11550819-C-A ***
22228222-C-T 20066336-C-T DYZ19 ***
6133969-A-C 6265928-A-C ***
13852980-C-A 11732274-C-A ***
22484858-G-T 20322972-G-T DYZ19 ***
13853045-A-G 11732339-A-G ***
13853040-A-T 11732334-A-T ***
13853038-G-A 11732332-G-A ***
13853003-G-A 11732297-G-A ***
13852983-C-G 11732277-C-G ***
13852982-C-G 11732276-C-G ***
16063171-G-GTTTCTTTC 13951291-G-GTTTCTTTC 14×TTTC***
13681093-C-A,T 11525417-C-A,T ***
13820793-G-C 11700087-G-C ***
58983145-T-C 56836998-T-C ***
22359716-A-C 20197830-A-C DYZ19 ***
22336298-C-T 20174412-C-T A4144 DYZ19 ***
13448841-T-C 11293165-T-C ***
58975453-G-T 56829306-G-T ***
13476758-A-C 11321082-A-C ***
58974058-T-C 56827911-T-C ***
22762820-GA-G 20600934-GA-G 12×A***
58973100-ATTCCATTCCATTAGT-A,ATTCCATTCGATTCCATTCCATGGCATTCCA 56826953-ATTCCATTCCATTAGT-A,ATTCCATTCGATTCCATTCCATGGCATTCCA ***
17923746-A-AAAAG 15811866-A-AAAAG 11×AAAG***
10017719-T-C 10180110-T-C ***
20794447-AT-A 18632561-AT-A P4_Prx 14×T***
9994944-A-T 10157335-A-T ***
13842863-C-G 11722157-C-G ***
13846524-G-C 11725818-G-C ***
13846520-G-A 11725814-G-A ***
13846397-A-C 11725691-A-C ***
13843693-A-T 11722987-A-T ***
13843678-A-T 11722972-A-T ***
13843675-A-G 11722969-A-G ***
13843479-GGTAAA-G 11722773-GGTAAA-G ***
13842872-T-G 11722166-T-G ***
13842870-C-A 11722164-C-A ***
13842865-G-A 11722159-G-A ***
13842856-C-T 11722150-C-T ***
13846543-C-T 11725837-C-T FGC41107 ***
13839863-G-A 11719157-G-A ***
13839844-C-T 11719138-C-T ***
13839755-C-G 11719049-C-G ***
13838585-C-T 11717879-C-T ***
13838272-A-G 11717566-A-G ***
13838266-A-G 11717560-A-G ***
13838256-C-G 11717550-C-G ***
13838239-G-A 11717533-G-A ***
13838146-T-G 11717440-T-G ***
13833776-T-G 11713070-T-G ***
13833480-C-G 11712774-C-G ***
13846527-T-A,G 11725821-T-A,G ***
13846550-G-A 11725844-G-A ***
13833418-A-T 11712712-A-T ***
13851290-T-C 11730584-T-C ***
13851429-G-A 11730723-G-A ***
13851428-T-A 11730722-T-A ***
13851421-C-G 11730715-C-G ***
13851416-C-G 11730710-C-G ***
13851407-A-G 11730701-A-G ***
13851405-G-A 11730699-G-A ***
13851404-C-A 11730698-C-A ***
13851314-A-G 11730608-A-G ***
13851310-T-C 11730604-T-C ***
13851305-T-G 11730599-T-G ***
13851261-A-G 11730555-A-G ***
13847276-C-A 11726570-C-A ***
13851097-A-G 11730391-A-G ***
13851083-A-C 11730377-A-C ***
13851071-G-C 11730365-G-C ***
13851069-A-T 11730363-A-T ***
13850400-A-T 11729694-A-T ***
13850353-T-A 11729647-T-A ***
13850260-A-T 11729554-A-T ***
13850245-T-A 11729539-T-A ***
13850244-C-A 11729538-C-A ***
13850234-G-A 11729528-G-A ***
13847298-A-G 11726592-A-G ***
13833421-G-A 11712715-G-A ***
13832592-A-G 11711886-A-G ***
13851524-T-A 11730818-T-A ***
13722163-A-G 11566487-A-G ***
13804912-T-G 11684206-T-G ***
13804910-A-T 11684204-A-T ***
13804760-T-A 11684054-T-A ***
13804742-G-A 11684036-G-A ***
13804741-G-C 11684035-G-C ***
13804736-T-G 11684030-T-G ***
13803040-C-A 11682334-C-A FGC46658 ***
13801203-A-G 11680497-A-G ***
13801193-C-G 11680487-C-G ***
13745371-C-A 11589695-C-A ***
13722121-A-T 11566445-A-T ***
13805465-A-T 11684759-A-T ***
13721382-A-C 11565706-A-C ***
13721381-C-G 11565705-C-G ***
13721377-G-C 11565701-G-C ***
13721375-T-G 11565699-T-G ***
13721373-C-A 11565697-C-A ***
13721369-G-A 11565693-G-A ***
13721368-T-A 11565692-T-A ***
13721366-A-G 11565690-A-G ***
13721362-C-A 11565686-C-A ***
13715589-GGAATT-G 11559913-GGAATT-G ***
13704451-C-A 11548775-C-A ***
13804920-G-T 11684214-G-T ***
13808682-A-G 11687976-A-G ***
13832590-A-G 11711884-A-G ***
13818189-C-A 11697483-C-A ***
13823284-G-A 11702578-G-A ***
13822123-A-G 11701417-A-G ***
13821152-A-T 11700446-A-T ***
13820859-A-G 11700153-A-G ***
13820833-C-G 11700127-C-G ***
13820831-T-A 11700125-T-A ***
13819953-A-T 11699247-A-T ***
13819940-C-G 11699234-C-G ***
13818817-T-G 11698111-T-G ***
13818728-G-T 11698022-G-T ***
13818727-T-G 11698021-T-G ***
13817923-G-A 11697217-G-A ***
13810173-A-G 11689467-A-G ***
13817915-A-G 11697209-A-G ***
13817913-G-C 11697207-G-C ***
13817900-A-G 11697194-A-G ***
13817878-G-T 11697172-G-T ***
13817875-A-G 11697169-A-G ***
13817868-T-G 11697162-T-G ***
13817847-A-G 11697141-A-G ***
13813531-A-G 11692825-A-G ***
13810793-C-G 11690087-C-G ***
13810792-A-T 11690086-A-T ***
13810782-A-T 11690076-A-T ***
13851440-C-T 11730734-C-T ***
13851526-T-G 11730820-T-G ***
13704431-A-G 11548755-A-G ***
13868095-A-G 11747389-A-G ***
13869024-C-G 11748318-C-G ***
13868480-C-G 11747774-C-G ***
13868478-C-A 11747772-C-A ***
13868367-C-A 11747661-C-A ***
13868209-G-T 11747503-G-T ***
13868150-T-G 11747444-T-G ***
13868148-C-A 11747442-C-A ***
13868121-T-G 11747415-T-G 5×AATGG***
13868111-A-G 11747405-A-G ***
13868101-A-G 11747395-A-G ***
13868091-T-G 11747385-T-G ***
13869052-C-A 11748346-C-A ***
13868090-T-G 11747384-T-G ***
13868085-T-G 11747379-T-G ***
13868083-G-A 11747377-G-A ***
13867970-C-G 11747264-C-G ***
13867476-T-G 11746770-T-G ***
13865949-A-G 11745243-A-G ***
13865759-A-G 11745053-A-G ***
13864535-T-G 11743829-T-G ***
13864530-A-G 11743824-A-G ***
13864511-A-G 11743805-A-G S15097 ***
13864510-T-G 11743804-T-G ***
13869049-G-T 11748343-G-T ***
13869054-C-G 11748348-C-G 4×GAATG***
13862760-A-G 11742054-A-G ***
13869345-G-A 11748639-G-A ***
13869436-A-C 11748730-A-C ***
13869433-T-A 11748727-T-A ***
13869426-A-T 11748720-A-T ***
13869425-G-T 11748719-G-T ***
13869424-G-C 11748718-G-C ***
13869419-G-T 11748713-G-T ***
13869388-T-C 11748682-T-C ***
13869383-G-T 11748677-G-T ***
13869374-G-A 11748668-G-A ***
13869368-T-A 11748662-T-A ***
13869365-A-G 11748659-A-G ***
13869332-C-A 11748626-C-A ***
13869065-G-C 11748359-G-C ***
13869330-A-G 11748624-A-G ***
13869323-A-T 11748617-A-T ***
13869317-C-G 11748611-C-G ***
13869313-T-A 11748607-T-A ***
13869304-G-C 11748598-G-C ***
13869291-C-A 11748585-C-A ***
13869236-G-A 11748530-G-A ***
13869224-G-A 11748518-G-A ***
13869222-A-G 11748516-A-G ***
13869079-C-G 11748373-C-G 4×GAATG***
13869067-A-G 11748361-A-G ***
13862774-C-T 11742068-C-T ***
13862753-C-T 11742047-C-T BY1046 ***
13851531-G-C 11730825-G-C ***
13851756-C-A 11731050-C-A ***
13857563-A-C 11736857-A-C ***
13857545-G-A 11736839-G-A ***
13852105-A-T 11731399-A-T ***
13852006-C-G 11731300-C-G ***
13851977-A-G 11731271-A-G 5×AATGG***
13851976-C-G 11731270-C-G ***
13851961-C-G 11731255-C-G ***
13851772-C-A 11731066-C-A ***
13851767-T-G 11731061-T-G ***
13851766-A-G 11731060-A-G ***
13851755-A-T 11731049-A-T ***
13859844-G-C 11739138-G-C ***
13851747-T-G 11731041-T-G ***
13851746-T-G 11731040-T-G ***
13851741-A-T 11731035-A-T ***
13851740-G-C 11731034-G-C ***
13851710-T-A 11731004-T-A ***
13851594-C-A 11730888-C-A ***
13851585-TA-T,TG 11730879-TA-T,TG ***
13851557-G-T 11730851-G-T ***
13851546-G-C 11730840-G-C ***
13851544-A-C 11730838-A-C ***
13851540-A-T 11730834-A-T ***
13858480-A-G 11737774-A-G ***
13859845-G-A 11739139-G-A ***
13862711-T-A 11742005-T-A ***
13862646-T-A 11741940-T-A ***
13862709-G-A 11742003-G-A ***
13862704-A-G 11741998-A-G ***
13862703-A-T 11741997-A-T ***
13862698-C-T 11741992-C-T ***
13862673-T-A 11741967-T-A ***
13862670-G-C 11741964-G-C ***
13862666-AT-A 11741960-AT-A ***
13862660-G-C 11741954-G-C ***
13862654-A-C 11741948-A-C ***
13862652-T-C 11741946-T-C ***
13862651-T-A 11741945-T-A ***
13862640-G-A 11741934-G-A ***
13859873-T-A 11739167-T-A ***
13862638-T-C 11741932-T-C ***
13862180-G-T 11741474-G-T ***
13862068-C-A 11741362-C-A ***
13860164-C-A 11739458-C-A ***
13860012-A-ATGCAG 11739306-A-ATGCAG ***
13859977-G-A 11739271-G-A ***
13859954-C-G 11739248-C-G ***
13859945-G-A 11739239-G-A ***
13859925-G-A 11739219-G-A ***
13859903-T-A 11739197-T-A ***
13859892-A-G 11739186-A-G ***
13704444-T-G 11548768-T-G ***
13704423-A-T 11548747-A-T ***
13869439-G-C 11748733-G-C ***
13448761-C-T 11293085-C-T ***
13451903-A-C 11296227-A-C ***
13451150-T-C 11295474-T-C ***
13451140-A-C 11295464-A-C ***
13450492-A-T 11294816-A-T ***
13450482-A-T 11294806-A-T ***
13448796-C-T 11293120-C-T ***
13448786-C-T 11293110-C-T ***
13448781-C-T 11293105-C-T ***
13448776-C-T 11293100-C-T ***
13448766-C-T 11293090-C-T ***
13448756-C-T 11293080-C-T ***
13452959-A-C 11297283-A-C ***
13448711-C-T 11293035-C-T ***
13448345-A-C 11292669-A-C ***
13447711-C-T 11292035-C-T ***
13447709-A-C 11292033-A-C ***
13447668-G-GCATTC 11291992-G-GCATTC 4×CATTC***
13447179-C-T 11291503-C-T ***
13447174-C-T 11291498-C-T ***
13446905-G-C 11291229-G-C ***
13446891-T-C 11291215-T-C ***
13446874-A-T 11291198-A-T ***
13446608-C-T 11290932-C-T ***
13451904-C-A 11296228-C-A ***
13452979-T-C 11297303-T-C ***
13320957-CT-C 11165281-CT-C ***
13454194-TGGCAA-T 11298518-TGGCAA-T ***
13455724-C-A 11300048-C-A ***
13455719-T-C 11300043-T-C 10×ATTCC***
13455709-A-C 11300033-A-C ***
13455639-A-C 11299963-A-C ***
13455619-T-C 11299943-T-C ***
13454809-C-T 11299133-C-T 4×TCCAT***
13454807-T-C 11299131-T-C ***
13454792-T-C 11299116-T-C ***
13454302-A-C 11298626-A-C ***
13454289-C-T 11298613-C-T ***
13454179-A-T 11298503-A-T ***
13452994-A-C 11297318-A-C ***
13453779-C-A 11298103-C-A S13811 ***
13453728-A-C 11298052-A-C ***
13453618-A-C 11297942-A-C 12×ATTCC***
13453598-A-C 11297922-A-C ***
13453530-T-A 11297854-T-A ***
13453524-A-C 11297848-A-C ***
13453444-A-C 11297768-A-C ***
13453279-A-C,G 11297603-A-C,G ***
13453276-T-C 11297600-T-C ***
13453196-C-T 11297520-C-T ***
13453013-G-C 11297337-G-C ***
13445757-TAA-T 11290081-TAA-T ***
13143872-C-T 10633358-C-T ***
13455784-A-C 11300108-A-C ***
9985662-G-T 10148053-G-T ***
10020623-T-TCC 10183014-T-TCC ***
10020622-C-CT 10183013-C-CT ***
10020501-G-A 10182892-G-A ***
10020489-G-A 10182880-G-A ***
10020396-G-C 10182787-G-C ***
10019296-AC-A 10181687-AC-A ***
10018589-T-TTTC 10180980-T-TTTC ***
10017702-C-T 10180093-C-T ***
9987980-T-C 10150371-T-C ***
9985752-C-T 10148143-C-T ***
9985631-A-G 10148022-A-G ***
10023268-C-A 10185659-C-A ***
9978388-G-T 10140779-G-T ***
9978354-T-A 10140745-T-A ***
9978346-G-C 10140737-G-C ***
9972748-C-T 10135139-C-T ***
9972726-A-G 10135117-A-G ***
9972722-G-GT 10135113-G-GT ***
9955274-T-C 10117665-T-C ***
9942041-G-A 10104432-G-A ***
9942039-C-A 10104430-C-A ***
9942037-T-A 10104428-T-A ***
9937419-G-T 10099810-G-T ***
10020634-G-C 10183025-G-C ***
10032041-A-G 10194432-A-G ***
13143862-C-T 10633348-C-T ***
13140203-T-C 10629689-T-C ***
13143817-T-C 10633303-T-C ***
13141834-T-C 10631320-T-C ***
13141169-T-A 10630655-T-A ***
13141093-CGTTTT-C,CGT 10630579-CGTTTT-C,CGT ***
13140263-C-T 10629749-C-T ***
13140243-C-T 10629729-C-T ***
13140238-C-T 10629724-C-T ***
13140233-T-C 10629719-T-C ***
13140228-C-T 10629714-C-T ***
13140213-T-C 10629699-T-C ***
13140208-T-C 10629694-T-C ***
13140198-T-C 10629684-T-C ***
10032050-A-T 10194441-A-T 8×T***
13140178-T-C 10629664-T-C ***
13140153-C-T 10629639-C-T 12×TCCAT***
13140148-C-T 10629634-C-T ***
13140138-C-T 10629624-C-T ***
13140133-C-T 10629619-C-T ***
13140128-C-T 10629614-C-T ***
13139690-G-C 10629176-G-C ***
13138470-T-C 10627956-T-C ***
13137340-TCCACA-T 10626826-TCCACA-T ***
13137308-G-A 10626794-G-A ***
10037247-C-T 10199638-C-T ***
13455771-C-T 11300095-C-T ***
13458406-C-G 11302730-C-G ***
13704418-A-G 11548742-A-G ***
13680834-C-T 11525158-C-T ***
13681005-G-C 11525329-G-C ***
13680993-T-A 11525317-T-A ***
13680978-C-A 11525302-C-A ***
13680965-C-G 11525289-C-G ***
13680918-A-G 11525242-A-G ***
13680905-C-G 11525229-C-G ***
13680869-A-T 11525193-A-T 4×GGAAT***
13680863-G-A 11525187-G-A ***
13680854-A-T 11525178-A-T ***
13680848-C-A 11525172-C-A ***
13680828-G-A 11525152-G-A ***
13681044-C-T 11525368-C-T ***
13680825-T-G 11525149-T-G ***
13677767-A-T 11522091-A-T ***
13677766-C-G 11522090-C-G ***
13677754-C-G 11522078-C-G ***
13677753-G-C 11522077-G-C ***
13676708-C-A 11521032-C-A ***
13676630-C-G 11520954-C-G ***
13664762-A-T 11509086-A-T ***
13664696-A-C 11509020-A-C ***
13658929-T-A 11503253-T-A ***
13658901-T-G 11503225-T-G ***
13681029-T-C 11525353-T-C ***
13681045-G-A 11525369-G-A ***
13658866-C-T 11503190-C-T ***
13702779-A-C 11547103-A-C ***
13704406-C-A 11548730-C-A ***
13704404-T-G 11548728-T-G A1222 ***
13702812-G-A 11547136-G-A ***
13702808-G-A 11547132-G-A ***
13702806-A-G 11547130-A-G ***
13702801-A-G 11547125-A-G ***
13702796-T-C 11547120-T-C ***
13702795-T-A 11547119-T-A ***
13702787-C-G 11547111-C-G ***
13702786-T-G 11547110-T-G ***
13702782-G-A 11547106-G-A ***
13702754-A-T 11547078-A-T ***
13681047-A-T 11525371-A-T ***
13701759-C-G 11546083-C-G ***
13701449-A-C 11545773-A-C ***
13701331-A-T 11545655-A-T ***
13701327-G-C 11545651-G-C ***
13701323-G-T 11545647-G-T ***
13701209-A-G 11545533-A-G A3818 ***
13699247-T-A 11543571-T-A ***
13696044-G-C 11540368-G-C ***
13691614-A-T 11535938-A-T ***
13686910-C-A 11531234-C-A ***
13686900-A-G 11531224-A-G ***
13658884-C-A 11503208-C-A ***
13658736-G-C 11503060-G-C ***
13458410-C-A 11302734-C-A ***
13458718-T-C 11303042-T-C ***
13459080-T-C 11303404-T-C ***
13458822-T-A 11303146-T-A ***
13458805-A-C 11303129-A-C ***
13458783-T-C 11303107-T-C ***
13458773-T-C 11303097-T-C ***
13458768-T-C 11303092-T-C ***
13458753-T-C 11303077-T-C ***
13458748-T-C 11303072-T-C ***
13458743-T-C 11303067-T-C ***
13458738-T-C 11303062-T-C ***
13458713-C-T 11303037-C-T 9×TCCAT***
13459187-G-A 11303511-G-A ***
13458703-C-T 11303027-C-T ***
13458698-C-T 11303022-C-T ***
13458693-C-T 11303017-C-T ***
13458688-C-T 11303012-C-T ***
13458683-C-T 11303007-C-T ***
13458678-T-C 11303002-T-C 5×TCCAC***
13458506-T-C 11302830-T-C ***
13458502-T-A 11302826-T-A ***
13458497-G-A 11302821-G-A ***
13458490-T-C 11302814-T-C ***
13458485-A-C 11302809-A-C ***
13459175-G-C 11303499-G-C ***
13459196-T-C 11303520-T-C ***
13658731-T-G 11503055-T-G ***
13648907-T-A 11493231-T-A ***
13652200-G-A 11496524-G-A ***
13652111-C-T 11496435-C-T ***
13651438-C-G 11495762-C-G ***
13651423-C-T 11495747-C-T ***
13651414-T-G 11495738-T-G ***
13651408-A-G 11495732-A-G ***
13651407-C-T 11495731-C-T ***
13651402-C-T 11495726-C-T ***
13651401-A-G 11495725-A-G ***
13649011-T-A 11493335-T-A ***
13648937-T-A 11493261-T-A ***
13648897-A-T 11493221-A-T ***
13459202-G-A 11303526-G-A ***
13486013-A-C 11330337-A-C ***
13483240-G-C 11327564-G-C ***
13483239-T-C 11327563-T-C ***
13472715-AG-A 11317039-AG-A ***
13472681-C-A 11317005-C-A ***
13470506-C-T 11314830-C-T ***
13463728-G-A 11308052-G-A ***
13459661-G-A 11303985-G-A ***
13459609-G-C 11303933-G-C ***
13459221-A-C 11303545-A-C ***
13459205-G-C 11303529-G-C ***
13869437-A-C 11748731-A-C ***
13869448-T-C 11748742-T-C ***
9994937-A-T 10157328-A-T ***
9994942-T-C 10157333-T-C ***
13454306-A-C 11298630-A-C ***
13453021-C-T 11297345-C-T ***
13453020-C-A 11297344-C-A ***
13451902-C-T 11296226-C-T ***
13451895-T-C 11296219-T-C ***
13448344-A-C 11292668-A-C ***
13140280-T-C 10629766-T-C ***
13140143-C-T 10629629-C-T ***
10026393-A-C 10188784-A-C PF437 ***
10017699-T-C 10180090-T-C ***
9983012-A-T 10145403-A-T ***
13455774-A-C 11300098-A-C ***
9981685-G-A 10144076-G-A ***
9981684-A-C 10144075-A-C ***
6222965-AT-A 6354924-AT-A IR3_Dst 12×T***
6130300-CAA-C 6262259-CAA-C ***
2686603-TA-T 2818562-TA-T 16×A***
58980722-C-T 56834575-C-T ***
58980687-T-C 56834540-T-C ***
58980647-C-T 56834500-C-T ***
58979480-T-C 56833333-T-C ***
58979380-T-C 56833233-T-C ***
58858911-CCATTG-C 56731950-GAATGC-G ***
13454307-A-C 11298631-A-C ***
13455956-C-T 11300280-C-T ***
58819380-A-T 56771491-T-A ***
13700306-C-G 11544630-C-G ***
13846282-C-A 11725576-C-A ***
13842148-C-G 11721442-C-G ***
13839864-C-T 11719158-C-T ***
13839728-G-A 11719022-G-A ***
13833796-C-G 11713090-C-G ***
13833794-C-A 11713088-C-A ***
13821103-T-G 11700397-T-G ***
13745381-A-C 11589705-A-C ***
13735019-A-T 11579343-A-T ***
13722137-TGGAATGAAATGTAATGGAA-T 11566461-TGGAATGAAATGTAATGGAA-T ***
13700305-T-G 11544629-T-G ***
13457399-C-T 11301723-C-T ***
13699246-A-T 11543570-A-T ***
13699244-C-A 11543568-C-A ***
13680886-G-C 11525210-G-C ***
13680875-G-C 11525199-G-C ***
13676646-C-G 11520970-C-G ***
13653011-A-T 11497335-A-T ***
13551088-T-C 11395412-T-C ***
13467326-C-T 11311650-C-T ***
13457855-A-C 11302179-A-C ***
13457408-T-A 11301732-T-A ***
13457402-G-C 11301726-G-C ***
58822808-T-G 56768063-A-C ***
28811155-T-G 26665008-T-G ***
13847255-C-A 11726549-C-A ***
26953134-T-A 24806987-T-A P1_r3 ***
6332659-AAC-A 6464618-AAC-A IR3_Dst 8×AC***
2700292-CT-C 2832251-CT-C 11×T***
58983168-A-C 56837021-A-C ***
58975705-A-T 56829558-A-T ***
58844647-ATTCCT-A,ATTCCA 56746216-CAAAGG-C,CAATGG ***
28795413-A-G 26649266-A-G ***
28795412-C-G 26649265-C-G ***
28795410-G-A 26649263-G-A ***
28787373-C-G 26641226-C-G ***
28785704-G-A 26639557-G-A ***
25758270-C-A 23612123-C-A P1_b3 15×A***
10020474-G-A 10182865-G-A ***
22505621-T-C 20343735-T-C DYZ19 ***
22473978-A-T 20312092-A-T BY186 SUR34 DYZ19 ***
22360426-A-T 20198540-A-T DYZ19 ***
20741857-CT-C 18579971-CT-C P4_Prx 14×T***
20729664-AT-A 18567778-AT-A P4_Prx 12×T***
20707114-CA-C 18545228-CA-C P4_Prx 14×A***
19988605-GA-G 17876725-GA-G P5_Prx 12×A***
14887094-CT-C 12775160-CT-C 11×T***
13869422-A-C 11748716-A-C ***
13868404-C-T 11747698-C-T ***
13868070-A-G 11747364-A-G ***
9942045-T-A 10104436-T-A ***
10020479-G-A 10182870-G-A ***
28785660-A-T 26639513-A-T ***
13867483-C-A 11746777-C-A ***
28785656-A-G 26639509-A-G ***
25985430-AT-A 23839283-AT-A P1_Y1 12×T***
25220651-TA-T 23074504-TA-T P2_r1 11×A***
22441642-T-G 20279756-T-G DYZ19 ***
22343977-TG-T 20182091-TG-T DYZ19 ***
21142834-CA-C 18980948-CA-C 16×A***
20634947-AAT-A 18473061-AAT-A P4_Prx 9×AT***
19964140-TA-T 17852260-TA-T P5_Prx 11×A***
19716310-G-GAATA 17604430-G-GAATA P5_Prx 9×AATA***
13869214-T-C,G 11748508-T-C,G ***
13868287-C-A 11747581-C-A ***
13866453-C-T 11745747-C-T ***
10020484-G-A 10182875-G-A ***
13860218-A-T 11739512-A-T ***
13818707-C-A 11698001-C-A ***
13815538-CAATGA-C 11694832-CAATGA-C ***
13688674-C-T 11532998-C-T ***
13664768-T-A,G 11509092-T-A,G ***
13651327-T-A 11495651-T-A ***
13649008-T-G 11493332-T-G ***
13458795-G-C 11303119-G-C ***
13448751-C-T 11293075-C-T ***
13447097-T-C 11291421-T-C ***
13141313-A-C 10630799-A-C ***
13846314-A-G 11725608-A-G ***
13849152-C-G 11728446-C-G ***
13860120-A-G 11739414-A-G ***
13852124-C-A 11731418-C-A ***
25461433-C-CTT 23315286-C-CTT P2_r2 26×T***
25447269-GGTA-G 23301122-GGTA-G P2_r2 9×GTA***
22344013-G-T 20182127-G-T DYZ19 ***
18454857-TC-T 16342977-TC-T P6_Dst ***
13868362-T-A 11747656-T-A ***
13868103-T-A 11747397-T-A ***
13868088-A-G 11747382-A-G ***
13865834-A-G 11745128-A-G ***
13865824-G-A 11745118-G-A ***
13862768-C-T 11742062-C-T ***
13852117-T-G 11731411-T-G ***
28785669-G-A 26639522-G-A ***
13851713-A-AT,T 11731007-A-AT,T ***
13851712-G-A 11731006-G-A ***
13851711-T-A,G 11731005-T-A,G ***
13851558-A-G 11730852-A-G ***
13850360-C-T 11729654-C-T ***
13839653-C-A 11718947-C-A ***
13838263-C-A 11717557-C-A ***
13833440-T-C,G 11712734-T-C,G ***
13832506-A-AGGAAT,T 11711800-A-AGGAAT,T 12×GGAAT***
13822130-T-A 11701424-T-A ***
13822129-T-A 11701423-T-A ***
25971895-T-C 23825748-T-C P1_Y1 ***
28811158-T-A 26665011-T-A ***
13805364-C-A 11684658-C-A ***
3279668-T-C 3411627-T-C ***
9987817-A-G 10150208-A-G ***
9510732-CCT-C 9673123-CCT-C 14×CT***
9221660-CATATATATAT-C 9384051-CATATATATAT-C 27×AT***
22361051-T-A 20199165-T-A DYZ19 ***
13722179-G-A 11566503-G-A ***
13663194-A-C 11507518-A-C ***
13451392-T-C 11295716-T-C ***
13137786-G-C 10627272-G-C ***
13137783-C-A 10627269-C-A ***
10020829-C-A 10183220-C-A ***
9952399-G-A 10114790-G-A ***
19692989-CT-C 17581109-CT-C P5_Prx 11×T***
58974063-A-T 56827916-A-T ***
14753933-CA-C 12642002-CA-C 12×A***
13701318-C-G 11545642-C-G ***
13664774-T-G 11509098-T-G ***
13485915-G-C 11330239-G-C ***
13143705-C-T 10633191-C-T ***
13138440-C-T 10627926-C-T ***
10032046-T-A 10194437-T-A ***
9307398-TTGTG-T,TTGAG 9469789-TTGTG-T,TTGAG 15×TG***
58980697-T-C 56834550-T-C ***
58975587-A-C 56829440-A-C ***
58975578-G-A 56829431-G-A ***
13818810-C-A 11698104-C-A ***
13748477-AGAATG-A 11592801-AGAATG-A 6×GAATG***
13849155-A-T 11728449-A-T ***
14379561-T-TGATA 12258857-T-TGATA 10×GATA***
28784443-G-A 26638296-G-A ***
25501261-CT-C 23355114-CT-C P2_r2 12×T***
23194817-CT-C 21032931-CT-C 24×T***
8702810-GT-G 8834769-GT-G 21×T***
22361038-T-C 20199152-T-C DYZ19 ***
22256886-A-T 20095000-A-T DYZ19 ***
21292579-TA-T 19130693-TA-T 15×A***
20958967-CT-C 18797081-CT-C P4_Dst 13×T***
20692965-CA-C 18531079-CA-C P4_Prx 19×A***
18109358-TA-T 15997478-TA-T 23×A***
13936205-G-GAAGAAAGA 11815499-G-GAAGAAAGA 14×AAGA***
28813933-G-A 26667786-G-A ***
13869328-T-G 11748622-T-G ***
13869294-T-C,G 11748588-T-C,G ***
13869234-A-C,G 11748528-A-C,G ***
13868511-G-A 11747805-G-A ***
13866719-G-A 11746013-G-A ***
13863613-A-G 11742907-A-G ***
13863612-C-T 11742906-C-T ***
13859843-A-T 11739137-A-T 5×GGAAT***
13851946-C-G 11731240-C-G ***
13849176-A-G 11728470-A-G ***
13849175-C-T 11728469-C-T ***
28785714-A-G 26639567-A-G ***
58844574-C-T 56746297-G-A 11×CCATT***
13696023-T-C 11540347-T-C ***
10020370-G-A 10182761-G-A A4859 ***
13696013-T-C 11540337-T-C ***
13664614-A-G 11508938-A-G ***
13664335-T-A 11508659-T-A FGC33026 ***
13454177-A-C 11298501-A-C ***
13449951-C-A 11294275-C-A ***
13140168-T-C 10629654-T-C ***
10020453-A-G 10182844-A-G ***
10020448-A-G 10182839-A-G ***
10020442-G-A 10182833-G-A ***
10020435-A-T 10182826-A-T ***
10020376-G-T 10182767-G-T ***
10017721-C-T 10180112-C-T ***
58844630-G-C 56746241-C-G 4×CATTC***
10017711-C-T 10180102-C-T ***
10017707-C-T 10180098-C-T ***
10017704-T-C 10180095-T-C ***
9961021-C-A 10123412-C-A ***
9942047-T-A 10104438-T-A ***
9937423-G-T 10099814-G-T ***
58980801-T-A 56834654-T-A ***
58980542-C-T 56834395-C-T ***
58980505-T-C 56834358-T-C ***
58974918-G-T 56828771-G-T ***
58972979-G-C 56826832-G-C ***
13861198-C-T 11740492-C-T ***
13859839-C-G 11739133-C-G ***
13869452-A-C 11748746-A-C ***
23897301-T-A 21735415-T-A ***
25971852-C-A 23825705-C-A P1_Y1 ***
25307730-TA-T 23161583-TA-T P2_r1 12×A***
25302951-TA-T 23156804-TA-T P2_r1 12×A***
25298204-TA-T 23152057-TA-T P2_r1 18×A***
25265708-AACT-A 23119561-AACT-A P2_r1 9×ACT***
25221549-CT-C 23075402-CT-C P2_r1 19×T***
25181200-TA-T 23035053-TA-T g1 12×A***
25073370-CT-C 22927223-CT-C g1 13×T***
25007696-TA-T 22861549-TA-T g1 11×A***
24566404-A-AT 22420257-A-AT P3_t2 14×T***
23897295-A-G 21735409-A-G ***
25971863-G-T 23825716-G-T P1_Y1 ***
23897294-T-C 21735408-T-C ***
22804535-CA-C 20642649-CA-C 12×A***
22512437-T-C 20350551-T-C DYZ19 ***
22511962-C-A 20350076-C-A DYZ19 ***
22507179-C-G 20345293-C-G DYZ19 ***
22507176-A-G 20345290-A-G DYZ19 ***
22503139-C-G 20341253-C-G DYZ19 ***
22502705-G-C 20340819-G-C DYZ19 ***
22502698-G-C 20340812-G-C DYZ19 ***
22502655-A-T 20340769-A-T DYZ19 ***
22502642-C-T 20340756-C-T DYZ19 ***
25971857-T-G 23825710-T-G P1_Y1 ***
25971866-G-T 23825719-G-T P1_Y1 ***
22491197-T-A 20329311-T-A DYZ19 ***
28785626-C-G 26639479-C-G ***
28786602-A-T 26640455-A-T ***
28786600-G-A 26640453-G-A ***
28786018-T-A 26639871-T-A A10495 ***
28785697-A-G 26639550-A-G ***
28785696-A-G 26639549-A-G ***
28785689-T-A 26639542-T-A ***
28785687-T-G 26639540-T-G ***
28785674-A-G 26639527-A-G ***
28785672-T-G 26639525-T-G ***
28785670-A-T 26639523-A-T ***
28785627-A-G 26639480-A-G ***
28784448-G-A 26638301-G-A ***
25971869-G-A 23825722-G-A P1_Y1 ***
28784413-A-G 26638266-A-G ***
28784393-G-A 26638246-G-A ***
28784378-G-A 26638231-G-A ***
28784358-G-A 26638211-G-A ***
28784348-G-A 26638201-G-A ***
28784346-C-G 26638199-C-G S26519 ***
28587730-TAA-T 26441583-TAA-T ***
27990599-C-G 25844452-C-G P1_Y2 ***
26262185-CT-C 24116038-CT-C P1_Y1 21×T***
25971879-A-G 23825732-A-G P1_Y1 ***
25971873-G-A 23825726-G-A P1_Y1 ***
22491219-C-T 20329333-C-T DYZ19 ***
22490746-G-T 20328860-G-T DYZ19 ***
28786612-C-T 26640465-C-T ***
18318839-GA-G 16206959-GA-G P6_Prx 11×A***
8409442-CA-C 8541401-CA-C 11×A***
20690178-CT-C 18528292-CT-C P4_Prx 12×T***
19930059-AT-A 17818179-AT-A P5_Prx 13×T***
19895331-AT-A 17783451-AT-A P5_Prx 13×T***
19839042-G-GT 17727162-G-GT P5_Prx 15×T***
19831751-GA-G 17719871-GA-G P5_Prx 11×A***
19792996-G-GT 17681116-G-GT P5_Prx 15×T***
19746883-TTG-T 17635003-TTG-T P5_Prx 13×TG***
19645682-CT-C 17533802-CT-C P5_Prx 14×T***
19003405-AT-A 16891525-AT-A 14×T***
17755384-T-TA 15643504-T-TA 17×A***
21365422-CA-C 19203536-CA-C 17×A***
17711769-CT-C 15599889-CT-C 11×T***
16108786-A-C 13996906-A-C P8_Prx ***
14480737-G-A 12360006-G-A ***
14480736-T-C 12360005-T-C ***
14480730-G-A 12359999-G-A ***
14480729-T-C 12359998-T-C ***
14480725-A-G 12359994-A-G ***
14480724-C-T 12359993-C-T ***
14480679-T-C 12359948-T-C ***
13869904-T-G 11749198-T-G ***
13869457-C-A 11748751-C-A ***
20798749-GA-G 18636863-GA-G P4_Prx 13×A***
21916133-CT-C 19754247-CT-C 14×T***
22490719-G-T 20328833-G-T DYZ19 ***
22259344-T-G 20097458-T-G DYZ19 ***
22476295-T-C 20314409-T-C DYZ19 ***
22476294-A-C 20314408-A-C DYZ19 ***
22364349-T-G 20202463-T-G DYZ19 ***
22358196-G-C 20196310-G-C DYZ19 ***
22289510-C-T 20127624-C-T DYZ19 ***
22289509-T-G 20127623-T-G DYZ19 ***
22271936-C-T 20110050-C-T DYZ19 ***
22271921-C-G 20110035-C-G DYZ19 ***
22271914-C-T 20110028-C-T DYZ19 ***
22271888-C-T 20110002-C-T DYZ19 ***
22270568-T-G 20108682-T-G DYZ19 ***
22259341-C-T 20097455-C-T A3985 DYZ19 ***
22231759-AATGT-A 20069873-AATGT-A DYZ19 ***
22259340-C-T 20097454-C-T A3984 DYZ19 ***
22259332-G-A 20097446-G-A DYZ19 ***
22259328-T-C 20097442-T-C DYZ19 ***
22259324-C-T 20097438-C-T DYZ19 ***
22259323-A-G 20097437-A-G DYZ19 ***
22255471-G-C 20093585-G-C DYZ19 ***
22238400-GA-G 20076514-GA-G DYZ19 ***
22238369-G-C 20076483-G-C DYZ19 ***
22238340-G-T 20076454-G-T DYZ19 ***
22238332-C-A 20076446-C-A DYZ19 ***
22231783-A-G 20069897-A-G DYZ19 ***
28786607-A-T 26640460-A-T ***
28786613-T-G 26640466-T-G ***
13853082-C-G 11732376-C-G ***
13301285-A-G 11145609-A-G ***
13455979-T-C 11300303-T-C ***
13455380-G-A 11299704-G-A ***
13454288-G-A 11298612-G-A ***
13452973-G-C 11297297-G-C ***
13448771-T-C 11293095-T-C ***
13448716-C-T 11293040-C-T ***
13447169-C-T 11291493-C-T ***
13320387-T-A 11164711-T-A ***
13320385-C-G 11164709-C-G ***
13301292-T-TG 11145616-T-TG ***
13301284-C-T 11145608-C-T ***
13459586-ATTGCG-A 11303910-ATTGCG-A ***
13142456-A-T 10631942-A-T ***
13142452-A-C 10631938-A-C ***
13142229-ATACTT-A 10631715-ATACTT-A ***
10023253-G-T 10185644-G-T ***
10023252-T-C 10185643-T-C ***
10023236-G-GTGGTT 10185627-G-GTGGTT ***
10019575-CTTTT-C 10181966-CTTTT-C 10×T***
10018694-G-C 10181085-G-C ***
9992570-C-T 10154961-C-T ***
9192345-G-T 9354736-G-T ***
58980737-T-C 56834590-T-C ***
13459511-G-A 11303835-G-A ***
13459599-T-C 11303923-T-C ***
58980652-C-T 56834505-C-T ***
13801043-G-A 11680337-G-A ***
13849174-G-A 11728468-G-A ***
13842222-A-G 11721516-A-G ***
13838555-C-T 11717849-C-T ***
13838411-T-G 11717705-T-G ***
13838155-A-T 11717449-A-T ***
13838139-C-A 11717433-C-A ***
13833370-A-G,T 11712664-A-G,T ***
13821258-A-G 11700552-A-G ***
13821148-C-G 11700442-C-G ***
13821131-G-A 11700425-G-A ***
13817981-T-A 11697275-T-A ***
13801041-A-G 11680335-A-G ***
13459601-T-A 11303925-T-A ***
13717372-C-A 11561696-C-A ***
13714172-C-T 11558496-C-T FGC26126 ***
13714165-A-T 11558489-A-T ***
13714029-A-T 11558353-A-T ***
13701341-C-A,G 11545665-C-A,G ***
13701328-G-A 11545652-G-A ***
13680925-A-G 11525249-A-G ***
13652115-A-G 11496439-A-G ***
13652087-T-G 11496411-T-G ***
13486019-A-G,T 11330343-A-G,T ***
13463727-C-T 11308051-C-T ***
58980727-C-T 56834580-C-T ***
58980592-T-C 56834445-T-C ***
28786619-C-G 26640472-C-G 4×AGTGG***
28803881-A-G 26657734-A-G ***
58866021-C-T 56724850-G-A 12×CCATT***
58858965-C-T 56731906-G-A ***
58844689-C-T 56746182-G-A ***
28818720-A-G 26672573-A-G ***
28813304-A-T 26667157-A-T A4542 ***
28805484-A-C 26659337-A-C ***
28803921-A-G 26657774-A-G ***
28803897-T-A 26657750-T-A BY2545 ***
28803893-G-C 26657746-G-C ***
28803883-C-A 26657736-C-A ***
28803858-T-G 26657711-T-G ***
58973009-A-C,G 56826862-A-C,G ***
28803846-G-A 26657699-G-A ***
28803845-A-T 26657698-A-T ***
28803818-T-A 26657671-T-A BY2541 ***
28803782-AT-A 26657635-AT-A ***
28800181-T-G 26654034-T-G ***
28800168-G-A 26654021-G-A ***
28800149-G-A 26654002-G-A ***
28786773-T-G 26640626-T-G ***
28786758-C-G 26640611-C-G ***
28786652-T-A 26640505-T-A ***
28786631-G-A 26640484-G-A ***
58972876-G-T 56826729-G-T 4×TCCAT***
58973038-A-C 56826891-A-C ***
58980587-T-C 56834440-T-C ***
58979360-C-T 56833213-C-T ***
58980567-T-C 56834420-T-C ***
58980399-C-T 56834252-C-T ***
58980089-C-T 56833942-C-T ***
58980084-T-C 56833937-T-C ***
58979470-C-T 56833323-C-T ***
58979460-T-C 56833313-T-C ***
58979395-T-C 56833248-T-C ***
58979390-C-T 56833243-C-T ***
58979385-C-T 56833238-C-T ***
58979375-T-C 56833228-T-C ***
58979365-T-C 56833218-T-C ***
58975362-T-A 56829215-T-A ***
58973041-C-T 56826894-C-T ***
58975300-T-C 56829153-T-C ***
58974051-A-C 56827904-A-C ***
58974037-A-T 56827890-A-T ***
58974022-A-C 56827875-A-C ***
58974016-C-G 56827869-C-G ***
58974005-C-T 56827858-C-T ***
58973993-C-T 56827846-C-T ***
58973986-C-G 56827839-C-G ***
58973975-G-C 56827828-G-C ***
58973973-G-T 56827826-G-T ***
58973965-A-C 56827818-A-C ***
17794252-CG-C,CT 15682372-CG-C,CT ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1746071044945175666147636925
Used in age calculations1044945175666147636925
Counts of SNPs1415
Variant counts last updated 2017-10-28 19:11:09.



Big Tree Main Page