Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > S16264 > L679

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
170191
FGC-BigY
ZR733
BigY2
170191
YFull-BigY
YF03599
19669229-C-CA 17557349-C-CA P5_Prx 8×AA*
8068096-C-T 8200055-C-T F110 M11115 YY+++
24402932-A-G 22256785-A-G FGC36620 **++
23239730-C-T 21077844-C-T FGC36619 Y+++
18905662-T-G 16793782-T-G FGC36618 YY***
10987809-C-CGGGTGG **
2895794-C-A 3027753-C-A **
3271440-C-A 3403399-C-A **
3232414-T-G 3364373-T-G **
3164627-T-C 3296586-T-C **
2994612-C-T 3126571-C-T **
2980377-A-G 3112336-A-G **
2930740-C-A 3062699-C-A **
2909195-G-A 3041154-G-A **
2759508-C-A 2891467-C-A **
2806817-C-A 2938776-C-A **
3332484-A-C 3464443-A-C **
17653822-C-A 15541942-C-A **
13937077-C-A 11816371-C-A *****
13940288-C-A 11819582-C-A *****
13978662-T-G 11857956-T-G *****
20757284-C-CTTTT 18595398-C-CTTTT P4_Prx 26×T**
14030774-C-A 11910068-C-A *****
14050767-C-A 11930061-C-A *****
15070434-G-T 12958525-G-T **
14147077-C-A 12026371-C-A *****
14153013-C-A 12032307-C-A *****
3274861-C-A 3406820-C-A **
4069657-C-A 4201616-C-A **
3546518-A-C 3678477-A-C **
4703561-C-A 4835520-C-A **
13838692-G-T 11717986-G-T *****
13850078-A-G 11729372-A-G ****
13850087-A-T 11729381-A-T ****
13850099-A-G 11729393-A-G ****
13850101-T-C 11729395-T-C ****
5240962-C-A 5372921-C-A **
5061146-C-A 5193105-C-A **
4930707-G-T 5062666-G-T **
4925388-T-G 5057347-T-G **
4489238-C-A 4621197-C-A **
3609753-G-T 3741712-G-T **
4467935-A-C 4599894-A-C **
4408788-C-A 4540747-C-A **
4371159-C-A 4503118-C-A **
4352814-G-T 4484773-G-T **
4325621-T-G 4457580-T-G **
4229559-T-G 4361518-T-G **
4213038-C-A 4344997-C-A **
4136964-T-C 4268923-T-C **
13857210-C-A 11736504-C-A ****
14194283-T-C 12073577-T-C *****
14179340-C-A 12058634-C-A *****
8644323-GC-G 8776282-GC-G **
14241359-G-T 12120653-G-T *****
17020611-C-A 14908731-C-A **
3048109-C-A 3180068-C-A **
22603219-C-A 20441333-C-A **
10767417-C-A **
15430643-C-A 13318763-C-A *****
15432928-C-A 13321048-C-A *****
15493238-T-C 13381358-T-C *****
15496988-A-G 13385108-A-G *****
15496990-A-G 13385110-A-G *****
15496991-T-C 13385111-T-C *****
16180207-C-A 14068327-C-A **
15106929-T-A 12995016-T-A *****
15689186-G-T 13577306-G-T *****
15700362-C-A 13588482-C-A ****
15718940-G-T 13607060-G-T *****
15722024-T-G 13610144-T-G *****
15725840-C-A 13613960-C-A ****
15740325-C-A 13628445-C-A *****
15768996-C-A 13657116-C-A *****
15770823-T-G 13658943-T-G *****
13253289-C-A 11097613-C-A **
21012237-G-T 18850351-G-T P4_Dst **
15211246-G-T 13099332-G-T *****
15070422-G-T 12958513-G-T *****
16667008-C-A 14555128-C-A **
14600115-G-T 12488315-G-T *****
5263600-T-G 5395559-T-G **
28612332-G-T 26466185-G-T **
28591070-C-A 26444923-C-A **
14332668-T-G 12211962-T-G *****
14386809-C-A 12266105-C-A *****
14446467-C-A 12325740-C-A *****
14519431-C-A 12407632-C-A *****
14529064-C-T 12417265-C-T *****
14582455-G-T 12470655-G-T *****
14602227-C-A 12490429-C-A *****
15069051-C-A 12957142-C-A *****
14629755-C-A 12517824-C-A *****
14645163-T-G 12533232-T-G *****
14645499-T-A 12533563-T-A *****
14673390-T-G 12561456-T-G *****
14693550-T-A 12581616-T-A *****
14746086-C-A 12634155-C-A *****
10887277-T-C **
18328686-G-T 16216806-G-T P6_Prx **
14424863-C-A 12304138-C-A **
14798735-T-A 12686806-T-A *****
5263580-G-T 5395539-G-T **
27868049-A-G 25721902-A-G P1_Y2 **
5367210-C-A 5499169-C-A **
8274145-A-C 8406104-A-C **
10023027-C-A 10185418-C-A *****
8992960-G-T 9155351-G-T **
8987802-A-G 9150193-A-G **
8706921-A-G 8838880-A-G **
8686310-C-A 8818269-C-A **
8599699-GT-G 8731658-GT-G **
10081913-G-C 10244304-G-C **
10081929-C-A 10244320-C-A **
10081981-G-C 10244372-G-C **
8269653-G-C 8401612-G-C **
10013131-C-A 10175522-C-A *****
13140418-C-A 10629904-C-A **
13194303-T-C 11038627-T-C *****
8159583-G-T 8291542-G-T **
13239362-A-C 11083686-A-C *****
13249148-C-A 11093472-C-A *****
8070120-G-T 8202079-G-T **
8044701-C-G 8176660-C-G **
8027779-C-A 8159738-C-A **
7986518-G-T 8118477-G-T **
9092599-A-C 9254990-A-C **
10004366-A-C 10166757-A-C *****
7926018-G-T 8057977-G-T **
9624612-A-G 9787003-A-G IR3_Prx **
9907615-C-A 10070006-C-A **
9607099-C-A 9769490-C-A IR3_Prx **
9907610-C-A 10070001-C-A **
9848707-C-A 10011098-C-A **
9830998-A-G 9993389-A-G **
9823987-C-A 9986378-C-A **
9771478-C-A 9933869-C-A **
9697799-G-C 9860190-G-C IR3_Prx **
9642490-C-A 9804881-C-A IR3_Prx **
9524076-T-A 9686467-T-A **
9994337-C-A 10156728-C-A ****
9482469-C-G 9644860-C-G **
9482132-A-C 9644523-A-C **
9907509-G-T 10069900-G-T *****
9340190-A-C 9502581-A-C **
9221609-G-T 9384000-G-T **
9940905-G-T 10103296-G-T *****
9113812-G-T 9276203-G-T **
9955472-A-G 10117863-A-G *****
9955525-C-A 10117916-C-A *****
9966136-C-A 10128527-C-A *****
7938855-G-T 8070814-G-T **
7925999-G-T 8057958-G-T **
5549035-G-T 5680994-G-T **
6592513-C-A 6724472-C-A **
7110362-C-A 7242321-C-A **
7103522-A-G 7235481-A-G **
7097232-G-T 7229191-G-T **
7081886-C-A 7213845-C-A **
7040240-C-A 7172199-C-A **
7029861-G-T 7161820-G-T **
7011655-T-G 7143614-T-G **
6910515-C-A 7042474-C-A **
6892545-A-G 7024504-A-G **
6425041-C-A 6557000-C-A **
7152503-C-A 7284462-C-A **
6424952-A-G 6556911-A-G **
6341670-G-T 6473629-G-T **
6202148-C-A 6334107-C-A IR3_Dst **
6130903-C-A 6262862-C-A **
5969652-A-C 6101611-A-C **
5965717-G-T 6097676-G-T **
5762108-C-A 5894067-C-A **
5635181-T-G 5767140-T-G **
5625674-A-G 5757633-A-G **
22993275-T-C 20831389-T-C **
7129803-GC-G 7261762-GC-G **
13652363-G-T 11496687-G-T *****
7871449-A-C 8003408-A-C **
7413471-C-A 7545430-C-A **
7759973-C-A 7891932-C-A **
7759327-G-T 7891286-G-T **
7755279-G-T 7887238-G-T **
7714028-C-A 7845987-C-A **
7706511-A-G 7838470-A-G **
7664177-C-A 7796136-C-A **
13466001-C-G 11310325-C-G *****
7662633-C-A 7794592-C-A **
7633267-G-T 7765226-G-T **
7407418-G-T 7539377-G-T **
13632733-C-A 11477057-C-A *****
7381823-C-G 7513782-C-G **
7353205-T-G 7485164-T-G **
7341627-G-T 7473586-G-T **
7240107-C-A 7372066-C-A **
7196625-G-T 7328584-G-T **
7190622-G-T 7322581-G-T **
7177924-C-A 7309883-C-A **
7172048-G-T 7304007-G-T **
7169765-C-A 7301724-C-A **
7155427-C-A 7287386-C-A **
8736967-C-A 8868926-C-A **
21472384-C-A 19310498-C-A **
20701215-T-TC 18539329-T-TC P4_Prx **
59031853-G-T 56885706-G-T *****
27316356-GT-G 25170209-GT-G P1_g3 **
19359858-A-G 17247978-A-G *****
19403872-C-A 17291992-C-A *****
19467008-C-A 17355128-C-A *****
19543973-C-A 17432093-C-A *****
19553794-C-A 17441914-C-A *****
27151514-GCCTACAA-G 25005367-GCCTACAA-G P1_g3 **
58988696-G-T 56842549-G-T ****
58993078-G-T 56846931-G-T ****
7387418-TG-T 7519377-TG-T **
19303926-G-T 17192046-G-T *****
27239670-CCT-C 25093523-CCT-C P1_g3 **
25201018-GAAAGAAAGA-G 23054871-GAAAGAAAGA-G g1 **
9607152-GC-G 9769543-GC-G IR3_Prx **
20872177-G-A 18710291-G-A P4_Dst **
24626401-C-A 22480254-C-A P3_t2 **
21090845-C-A 18928959-C-A *****
21100405-C-A 18938519-C-A *****
21104847-C-A 18942961-C-A ****
21139563-G-T 18977677-G-T *****
27418206-CA-C 25272059-CA-C P1_g3 **
19201629-C-A 17089749-C-A ****
21201596-C-A 19039710-C-A *****
18652936-G-T 16541056-G-T *****
28587966-A-C 26441819-A-C *****
28608508-C-A 26462361-C-A *****
28609737-G-T 26463590-G-T *****
28622124-T-C 26475977-T-C *****
28742648-C-A 26596501-C-A *****
28757032-G-T 26610885-G-T *****
28773532-C-A 26627385-C-A *****
28783379-C-A 26637232-C-A ****
18652897-G-T 16541017-G-T *****
18687488-C-A 16575608-C-A *****
27756148-ACAC-A 25610001-ACAC-A P1_Y2 *****
18738188-C-A 16626308-C-A *****
18853104-C-A 16741224-C-A *****
18876383-C-A 16764503-C-A *****
18919893-C-A 16808013-C-A *****
18947916-C-A 16836036-C-A *****
19041272-A-C 16929392-A-C *****
19043027-C-A 16931147-C-A *****
19117358-T-C 17005478-T-C *****
19124277-C-A 17012397-C-A *****
19124293-C-T 17012413-C-T *****
21200753-C-A 19038867-C-A *****
21248808-A-G 19086922-A-G *****
18242801-C-A 16130921-C-A ****
23599998-C-T 21438112-C-T *****
18017108-GATATAT-G 15905228-GATATAT-G 22×AT*****
17950825-A-AAT 15838945-A-AAT 27×AT**
22358088-T-C 20196202-T-C DYZ19 **
22358134-G-C 20196248-G-C DYZ19 **
22358154-G-A 20196268-G-A DYZ19 **
13850067-GATTCA-G 11729361-GATTCA-G *****
23996883-C-A 21850736-C-A ****
23807176-T-C 21645290-T-C *****
22611370-C-A 20449484-C-A ****
22793185-C-A 20631299-C-A *****
18953003-AAAAG-A 16841123-AAAAG-A 4×AAAG****
22810272-C-A 20648386-C-A *****
22842923-C-A 20681037-C-A *****
22953182-C-T 20791296-C-T *****
23005345-C-A 20843459-C-A *****
23013835-C-T 20851949-C-T *****
23054445-G-T 20892559-G-T *****
23475543-G-T 21313657-G-T *****
23145878-C-A 20983992-C-A ****
23447037-G-T 21285151-G-T *****
23350475-T-C 21188589-T-C ****
18455377-G-GA 16343497-G-GA P6_Dst 9×A**
22170921-C-T 20009035-C-T ****
21297968-C-A 19136082-C-A ****
24404860-G-T 22258713-G-T *****
24553601-G-C 22407454-G-C P3_t2 *****
21383579-C-A 19221693-C-A ****
21405899-G-T 19244013-G-T *****
21428501-C-A 19266615-C-A ****
21489147-T-C 19327261-T-C ****
24450441-C-A 22304294-C-A *****
24450436-T-C 22304289-T-C ****
24424134-A-C 22277987-A-C *****
24421959-C-A 22275812-C-A *****
21530868-G-T 19368982-G-T *****
22125236-C-A 19963350-C-A ****
21551384-G-T 19389498-G-T *****
21793667-G-T 19631781-G-T ****
21935166-C-A 19773280-C-A *****
21963685-C-A 19801799-C-A *****
21975276-C-T 19813390-C-T *****
22000666-T-C 19838780-T-C *****
22055449-C-T 19893563-C-T *****
22055453-T-C 19893567-T-C *****
22055455-G-A 19893569-G-A *****
22055470-T-C 19893584-T-C *****
18439210-T-C 16327330-T-C P6_Dst **
18133147-A-G 16021267-A-G *****
15864016-G-T 13752136-G-T ****
7020189-C-A 7152148-C-A **
28808583-G-T 26662436-G-T **
13695504-A-G 11539828-A-G **
14580879-C-A 12469079-C-A **
15816245-C-A 13704365-C-A **
5577176-C-A 5709135-C-A **
2766762-C-A 2898721-C-A **
20330550-G-T 18168664-G-T P5_Dst **
10925503-C-A **
28087250-A-C 25941103-A-C P1_Y2 **
15324971-C-A 13213089-C-A **
19189482-C-T 17077602-C-T **
10912520-C-A **
16205753-A-C 14093873-A-C *****
16284196-C-A 14172316-C-A ****
8631425-G-A 8763384-G-A **
56831889-ATTCCATTCCT-A **
8172687-CTTTTTT-C 8304646-CTTTTTT-C 22×T**
16294450-C-A 14182570-C-A *****
10989041-C-A **
28787995-A-G 26641848-A-G **
14549647-C-A 12437848-C-A **
10967404-A-C **
16409146-G-A 14297266-G-A *****
15985493-A-C 13873613-A-C ****
9959720-C-A 10122111-C-A **
3367041-C-A 3499000-C-A **
7305542-C-CT 7437501-C-CT 10×T**
22055474-T-A 19893588-T-A **
15894315-A-T 13782435-A-T *****
15894372-G-T 13782492-G-T *****
14423819-C-A 12303094-C-A **
15912133-C-A 13800253-C-A ****
15917597-C-A 13805717-C-A *****
15992289-G-T 13880409-G-T *****
10070053-C-A 10232444-C-A **
16021032-A-C 13909152-A-C *****
10989019-T-C **
16047050-T-G 13935170-T-G *****
10989012-T-C **
5426662-A-T 5558621-A-T **
2906530-C-A 3038489-C-A **
10673827-C-T **
9669979-G-T 9832370-G-T IR3_Prx **
10070068-A-G 10232459-A-G **
10070057-AG-A 10232448-AG-A **
16359717-G-A 14247837-G-A *****
16424871-C-A 14312991-C-A *****
18093386-G-T 15981506-G-T *****
17770123-C-A 15658243-C-A *****
17406764-C-A 15294884-C-A *****
17491636-C-A 15379756-C-A ****
17498839-A-G 15386959-A-G *****
17517100-C-A 15405220-C-A *****
17588607-T-G 15476727-T-G *****
17606340-C-A 15494460-C-A *****
17701396-C-T 15589516-C-T *****
17763983-T-C 15652103-T-C *****
17764744-T-G 15652864-T-G *****
17832432-C-A 15720552-C-A *****
17289768-C-A 15177888-C-A *****
17854455-C-A 15742575-C-A *****
17871704-C-A 15759824-C-A *****
17889925-C-A 15778045-C-A *****
17907835-C-A 15795955-C-A *****
17916320-G-C 15804440-G-C *****
17922474-G-T 15810594-G-T *****
17956072-C-A 15844192-C-A *****
15038471-G-T 12926561-G-T **
18020006-T-G 15908126-T-G *****
18078582-G-T 15966702-G-T *****
17320573-A-T 15208693-A-T *****
17233544-C-A 15121664-C-A ****
16427695-A-G 14315815-A-G *****
16768350-C-A 14656470-C-A *****
16441132-C-A 14329252-C-A *****
16451781-C-T 14339901-C-T *****
16451785-C-A 14339905-C-A *****
16457314-C-A 14345434-C-A *****
16516115-C-A 14404235-C-A ****
16549620-C-A 14437740-C-A *****
16568263-C-A 14456383-C-A *****
16703863-G-T 14591983-G-T *****
16730242-C-A 14618362-C-A *****
16833438-C-A 14721558-C-A ****
17041897-C-A 14930017-C-A *****
16853777-A-T 14741897-A-T *****
16855352-A-C 14743472-A-C *****
16867594-C-A 14755714-C-A *****
10845800-G-T **
3870584-C-A 4002543-C-A **
22816365-T-C 20654479-T-C **
10971139-C-T **
10971094-C-G **
10971091-A-T **
28618316-C-A 26472169-C-A **
9935392-C-A 10097783-C-A **
3834949-C-A 3966908-C-A **
9964543-T-G 10126934-T-G **
17238154-C-A 15126274-C-A **
17518608-C-A 15406728-C-A **
17511523-A-G 15399643-A-G **
17503653-G-A 15391773-G-A **
17478358-C-A 15366478-C-A **
17375182-T-G 15263302-T-G **
17369280-A-C 15257400-A-C **
17355494-A-C 15243614-A-C **
17307297-G-T 15195417-G-T **
13850084-T-A 11729378-T-A ****
17562086-C-A 15450206-C-A **
23954965-C-A 21808818-C-A **
17052769-A-G 14940889-A-G **
16990014-AC-A 14878134-AC-A **
24331335-T-G 22185188-T-G P3_t1 **
16981543-G-T 14869663-G-T **
16962873-AT-A 14850993-AT-A **
16929473-C-A 14817593-C-A **
24405804-C-A 22259657-C-A **
17544730-A-C 15432850-A-C **
17673611-G-C 15561731-G-C **
16846315-A-G 14734435-A-G **
18093379-GA-G 15981499-GA-G **
18388287-C-A 16276407-C-A P6_Gap **
18297257-C-A 16185377-C-A P6_Prx **
18297239-C-A 16185359-C-A P6_Prx **
18262455-A-T 16150575-A-T **
18258857-T-G 16146977-T-G **
18174459-C-A 16062579-C-A **
18158659-T-C 16046779-T-C **
18138608-G-T 16026728-G-T **
18093373-G-T 15981493-G-T **
17730908-C-A 15619028-C-A **
27418151-C-A 25272004-C-A P1_g3 **
17963464-C-A 15851584-C-A **
23807167-G-T 21645281-G-T **
23819181-C-A 21657295-C-A **
17940160-T-G 15828280-T-G **
17924860-A-T 15812980-A-T **
17862636-A-C 15750756-A-C **
17840409-A-G 15728529-A-G **
17792144-AC-A 15680264-AC-A **
16906801-C-A 14794921-C-A **
16780722-G-C 14668842-G-C **
18558230-A-G 16446350-A-G **
15744753-A-G 13632873-A-G **
16006756-A-C 13894876-A-C **
25533553-C-A 23387406-C-A P1_gr1 **
16006722-C-A 13894842-C-A **
28731896-T-C 26585749-T-C ****
15911439-C-A 13799559-C-A **
15905061-G-T 13793181-G-T **
26044337-T-C 23898190-T-C P1_Y1 **
15789128-T-G 13677248-T-G **
15536539-G-T 13424659-G-T **
16047027-T-A 13935147-T-A **
15496995-A-GG 13385115-A-GG **
15496464-G-T 13384584-G-T **
15396766-A-G 13284886-A-G **
15330791-C-A 13218909-C-A **
15190177-C-A 13078263-C-A **
15163079-G-T 13051165-G-T **
15157250-G-T 13045337-G-T **
15041012-C-A 12929102-C-A **
16034174-A-AC 13922294-A-AC **
2813758-C-A 2945717-C-A *****
24880187-C-A 22734040-C-A g1 **
16279608-C-A 14167728-C-A **
16623595-A-G 14511715-A-G **
16581287-C-A 14469407-C-A **
16464390-G-C 14352510-G-C **
16464372-C-A 14352492-C-A **
16445858-T-C 14333978-T-C **
16297423-C-A 14185543-C-A **
16291962-G-T 14180082-G-T **
16284214-T-G 14172334-T-G **
16245821-T-G 14133941-T-G **
25532962-T-C 23386815-T-C P1_gr1 **
17661357-G-T 15549477-G-T *****
16194690-C-A 14082810-C-A **
16180224-T-C 14068344-T-C **
16180203-C-A 14068323-C-A **
25108838-A-G 22962691-A-G g1 **
16047042-T-G 13935162-T-G **
2752537-C-A 2884496-C-A *****
2753026-C-A 2884985-C-A *****
2790342-C-A 2922301-C-A ****
18462664-T-A 16350784-T-A P6_Dst **
18619082-ATGTATACATATATAACT-A 16507202-ATGTATACATATATAACT-A **
14946249-G-T 12834323-G-T **
21139557-G-T 18977671-G-T **
21294936-G-C 19133050-G-C **
21281817-C-A 19119931-C-A **
21214068-C-A 19052182-C-A **
59001115-G-A 56854968-G-A **
21172065-G-T 19010179-G-T **
21149185-C-A 18987299-C-A **
21148554-A-C 18986668-A-C **
21146305-C-A 18984419-C-A **
21104502-C-G 18942616-C-G **
21306587-AACC-A 19144701-AACC-A **
21103108-C-A 18941222-C-A **
20989175-ATATATATATATATATATT-A 18827289-ATATATATATATATATATT-A P4_Dst **
22771981-C-A 20610095-C-A **
20883103-GA-G 18721217-GA-G P4_Dst **
23010049-T-G 20848163-T-G **
23187731-G-A 21025845-G-A **
22358122-G-T 20196236-G-T DYZ19 **
22358092-C-T 20196206-C-T DYZ19 **
8449460-TTG-T 8581419-TTG-T **
21364557-C-A 19202671-C-A **
20883102-T-G 18721216-T-G P4_Dst **
21951890-C-A 19790004-C-A **
22521105-C-A 20359219-C-A **
22300568-A-G 20138682-A-G DYZ19 **
22199553-G-T 20037667-G-T **
22529489-C-A 20367603-C-A **
22198049-G-T 20036163-G-T **
22171060-C-A 20009174-C-A **
22122070-C-A 19960184-C-A **
21969552-G-T 19807666-G-T **
21923786-A-C 19761900-A-C **
21663229-C-T 19501343-C-T **
8048556-CAGAG-C 8180515-CAGAG-C 13×AG**
21899812-T-G 19737926-T-G **
21899793-T-G 19737907-T-G **
21899782-T-G 19737896-T-G **
21868404-CCAGGG-C 19706518-CCAGGG-C **
21836737-CCT-C 19674851-CCT-C **
21775478-C-A 19613592-C-A **
21775441-C-A 19613555-C-A **
22732697-C-A 20570811-C-A **
23205095-T-G 21043209-T-G **
23373713-G-T 21211827-G-T **
18630017-G-T 16518137-G-T **
19007624-A-AT 16895744-A-AT **
19184034-G-T 17072154-G-T **
19138771-G-T 17026891-G-T **
19123838-T-G 17011958-T-G **
19104608-G-T 16992728-G-T **
19041266-A-C 16929386-A-C **
19040825-C-G 16928945-C-G **
19040819-G-T 16928939-G-T **
19024816-C-A 16912936-C-A **
18961589-T-C 16849709-T-C **
23493512-G-T 21331626-G-T **
18950790-C-A 16838910-C-A **
23560839-G-A 21398953-G-A **
23613584-C-A 21451698-C-A **
18792884-G-T 16681004-G-T **
18792880-G-T 16681000-G-T **
18779498-A-T 16667618-A-T **
18750992-A-G 16639112-A-G **
18737446-G-A 16625566-G-A **
18634859-G-A 16522979-G-A **
19184050-T-G 17072170-T-G **
19294965-A-C 17183085-A-C **
20829697-G-C 18667811-G-C P4_Gap **
19849317-C-A 17737437-C-A P5_Prx **
20701228-G-T 18539342-G-T P4_Prx **
20497390-CT-C 18335504-CT-C P5_Dst **
20497386-CTTT-C 18335500-CTTT-C P5_Dst **
9967971-G-T 10130362-G-T **
20434833-T-C 18272947-T-C P5_Dst **
19899656-G-T 17787776-G-T P5_Prx **
19866293-G-T 17754413-G-T P5_Prx **
19866275-G-T 17754395-G-T P5_Prx **
19834221-G-A 17722341-G-A P5_Prx **
19295503-G-C 17183623-G-C **
19770200-T-C 17658320-T-C P5_Prx **
19770195-C-A 17658315-C-A P5_Prx **
23381023-G-C 21219137-G-C **
23456614-C-A 21294728-C-A **
19520680-T-C 17408800-T-C **
19497281-C-A 17385401-C-A **
19475067-C-A 17363187-C-A **
19359856-A-AGTATTG 17247976-A-AGTATTG **
19303735-T-C 17191855-T-C **
2853557-G-A 2985516-G-A *****
25256413-G-GAT 23110266-G-GAT P2_r1 21×AT**
2873912-C-A 3005871-C-A *****
13236859-G-T 11081183-G-T **
13466029-G-A 11310353-G-A **
28591201-T-C 26445054-T-C **
13459937-C-A 11304261-C-A **
13429330-G-T 11273654-G-T **
13314378-C-A 11158702-C-A **
13310207-C-A 11154531-C-A **
13296482-A-C 11140806-A-C **
13257974-A-G 11102298-A-G **
13233889-C-A 11078213-C-A **
13483404-G-T 11327728-G-T **
13216646-T-G 11060970-T-G **
8216651-C-T 8348610-C-T *****
2877925-C-A 3009884-C-A *****
8293840-G-T 8425799-G-T *****
8482128-C-A 8614087-C-A ****
8486655-G-T 8618614-G-T *****
8514314-C-A 8646273-C-A *****
8652861-A-C 8784820-A-C *****
8698041-C-A 8830000-C-A *****
13480083-A-C 11324407-A-C **
13505566-C-A 11349890-C-A **
8768590-A-T 8900549-A-T *****
8129293-C-A 8261252-C-A *****
7397633-C-A 7529592-C-A *****
7642911-C-A 7774870-C-A *****
7733397-C-A 7865356-C-A ****
7753707-T-G 7885666-T-G *****
7873040-G-T 8004999-G-T ****
7873081-G-T 8005040-G-T *****
7875283-C-A 8007242-C-A *****
8022757-C-G 8154716-C-G *****
8130607-G-T 8262566-G-T *****
13522089-G-T 11366413-G-T **
8159562-T-G 8291521-T-G *****
28483040-C-A 26336893-C-A **
11654111-G-T **
8171740-G-T 8303699-G-T *****
11652680-G-T **
13652297-C-A 11496621-C-A **
14292801-G-T 12172095-G-T ****
13571117-C-A 11415441-C-A **
13522891-G-T 11367215-G-T **
8735700-T-G 8867659-T-G *****
8793053-C-A 8925012-C-A *****
13819457-G-T 11698751-G-T **
8261193-AAT-A 8393152-AAT-A **
28780377-C-A 26634230-C-A **
28795723-A-C 26649576-A-C **
28809322-G-A 26663175-G-A **
10887418-C-A **
10864598-C-A **
10763316-C-CAATGT **
56833225-C-A **
10747071-C-A **
9398133-C-A 9560524-C-A *****
10926858-C-A **
56858108-G-T **
9457172-T-G 9619563-T-G *****
10659724-C-A **
10659719-A-C **
10617660-G-T **
10070172-C-A 10232563-C-A **
10039755-A-T 10202146-A-T **
10019182-A-G 10181573-A-G **
10016780-C-A 10179171-C-A **
10887423-C-A **
28779228-G-T 26633081-G-T **
27151457-G-T 25005310-G-T P1_g3 **
10989025-T-A **
8799254-C-A 8931213-C-A *****
13195363-C-A 11039687-C-A **
9094246-C-A 9256637-C-A *****
28635690-C-A 26489543-C-A **
28659026-T-G 26512879-T-G **
11037927-C-G **
28662965-T-G 26516818-T-G **
11027321-C-T **
11013353-T-G **
10989024-T-C **
10939625-T-G **
10988813-TCCA-T **
28757058-G-T 26610911-G-T **
10987806-CT-C **
10986343-T-A **
10986334-G-C **
10986327-T-C **
10986317-A-C **
10986301-T-C **
10986300-G-A **
7287043-C-A 7419002-C-A *****
8253564-T-C 8385523-T-C *****
14361996-G-T 12241291-G-T **
14693983-A-G 12582049-A-G **
14912798-C-A 12800865-C-A **
14022863-T-C 11902157-T-C **
7144726-G-A 7276685-G-A ****
14488201-C-G 12367470-C-G **
14464458-G-T 12343731-G-T **
14853041-C-A 12741107-C-A **
7099082-C-A 7231041-C-A *****
7056218-T-C 7188177-T-C *****
6992391-C-A 7124350-C-A ****
6944071-G-A 7076030-G-A *****
14447562-T-G 12326835-T-G **
6708999-A-C 6840958-A-C *****
14245092-G-C 12124386-G-C **
14172518-G-T 12051812-G-T **
13921506-C-A 11800800-C-A **
6931350-T-G 7063309-T-G *****
14151580-A-C 12030874-A-C **
14673403-G-T 12561469-G-T **
14266348-T-G 12145642-T-G **
13942454-T-G 11821748-T-G **
6900905-C-T 7032864-C-T *****
6869553-A-G 7001512-A-G *****
6869552-C-A 7001511-C-A *****
6869549-A-G 7001508-A-G ****
14250078-A-C 12129372-A-C **
5635286-C-A 5767245-C-A ****
28307124-C-A 26160977-C-A P1_b4 **
14823613-C-T 12711680-C-T **
14195073-G-A 12074367-G-A **
14600375-C-A 12488575-C-A **
3005690-C-A 3137649-C-A *****
28076427-T-G 25930280-T-G P1_Y2 **
6664065-G-T 6796024-G-T *****
6674653-G-T 6806612-G-T *****
14578104-T-G 12466304-T-G **
3716132-C-A 3848091-C-A *****
14527427-C-A 12415628-C-A **
13853609-A-T 11732903-A-T **
13870884-C-A 11750178-C-A **
14219507-T-C 12098801-T-C **
14521508-C-A 12409709-C-A **
7182924-C-A 7314883-C-A *****
14504712-G-T 12392917-G-T **
13884051-C-A 11763345-C-A **
28307138-A-C 26160991-A-C P1_b4 **
14602677-C-A 12490879-C-A **
14072450-C-A 11951744-C-A **
7255504-C-A 7387463-C-A ****
27477627-AAAT-A 25331480-AAAT-A P1_Y2 **
7253660-C-A 7385619-C-A *****
7246024-G-T 7377983-G-T *****
7190636-C-A 7322595-C-A *****
7186835-G-T 7318794-G-T *****
7186041-C-A 7318000-C-A *****
6734809-C-T 6866768-C-T *****
9751854-CA-C 9914245-CA-C ***
9753975-CTTT-C 9916366-CTTT-C 20×T***
9728574-TTCCCACTGGC-T 9890965-TTCCCACTGGC-T IR3_Prx ***
9671312-CA-C 9833703-CA-C IR3_Prx 9×A***
9634219-C-CT 9796610-C-CT IR3_Prx 9×T***
9629451-C-CA 9791842-C-CA IR3_Prx 12×A***
9923934-AG-TT 10086325-AG-TT ***
10081858-ACTCTATC-GCTATATGA 10244249-ACTCTATC-GCTATATGA ***
9923972-ACAA-GT 10086363-ACAA-GT ***
27186372-C-A 25040225-C-A P1_g3 ***
13141991-AAC-CAT 10631477-AAC-CAT 4×ACTCC***
13140214-CCT-TCC 10629700-CCT-TCC ***
13140125-G-CACTC 10629611-G-CACTC 6×CACTC***
13140096-TCAGA-ACACT 10629582-TCAGA-ACACT ***
13132134-GGGAAC-AGAAAG 10621620-GGGAAC-AGAAAG ***
10081903-GCACAA-TAACAG 10244294-GCACAA-TAACAG ***
13803263-GAAT-AAAC 11682557-GAAT-AAAC ***
13799075-GGACT-CTACA 11678369-GGACT-CTACA ***
9924000-TC-AG 10086391-TC-AG ***
13799151-TAAT-GAAA 11678445-TAAT-GAAA ***
10081889-TATGAAG-GACGTAT 10244280-TATGAAG-GACGTAT ***
10081874-GG-TC 10244265-GG-TC ***
10081845-CAG-AAT 10244236-CAG-AAT ***
10075709-AAAGGTAG-GAATGTAT 10238100-AAAGGTAG-GAATGTAT ***
10070068-ATTCTA-GCACTG 10232459-ATTCTA-GCACTG ***
9974499-TC-CT 10136890-TC-CT ***
9961312-ACT-GG 10123703-ACT-GG ***
9621478-CA-C 9783869-CA-C IR3_Prx ***
6492158-TA-T 6624117-TA-T ***
13803187-CGAATGGAATTTACTCAAATAC-TTAATAGAAATTTTTCGAACAG 11682481-CGAATGGAATTTACTCAAATAC-TTAATAGAAATTTTTCGAACAG ***
27936764-C-CA 25790617-C-CA P1_Y2 15×A***
9557063-TTG-T 9719454-TTG-T IR3_Prx ***
20917254-C-CA 18755368-C-CA P4_Dst 14×A***
27780449-CA-C 25634302-CA-C P1_Y2 18×A***
21002535-TTCTC-T 18840649-TTCTC-T P4_Dst 16×TC***
13860078-TA-AC 11739372-TA-AC ***
28103949-C-CT 25957802-C-CT P1_Y2 22×T***
9551440-G-GT 9713831-G-GT IR3_Prx 11×T***
27337691-G-GA 25191544-G-GA P1_g3 9×A***
58980808-TG-CA 56834661-TG-CA ***
27306088-T-C 25159941-T-C P1_g3 ***
13489012-ATGCCC-GTGACA 11333336-ATGCCC-GTGACA ***
9924014-TGACCCTGTGTGATGAATTTAT-CAACTTCGTGAGATTAATGGAC 10086405-TGACCCTGTGTGATGAATTTAT-CAACTTCGTGAGATTAATGGAC ***
20920178-C-CA 18758292-C-CA P4_Dst 14×A***
9566983-CTG-C 9729374-CTG-C IR3_Prx ***
18499927-GA-G 16388047-GA-G P6_Dst 13×A***
13801542-CGGAA-TTGAG 11680836-CGGAA-TTGAG ***
13803167-AGACTC-GGACAT 11682461-AGACTC-GGACAT ***
14179193-GA-G 12058487-GA-G 10×A***
10012600-TT-GG 10174991-TT-GG ***
13804186-CAA-AAT 11683480-CAA-AAT ***
27368714-G-GA 25222567-G-GA P1_g3 10×A***
9587293-CA-C 9749684-CA-C IR3_Prx ***
8555559-T-TTTTGTC 8687518-T-TTTTGTC ***
9566727-CA-C 9729118-CA-C IR3_Prx 13×A***
9554422-TGAAGAGTA-T 9716813-TGAAGAGTA-T IR3_Prx ***
9535155-ATT-A 9697546-ATT-A IR3_Prx 17×T***
9503819-C-CTATA 9666210-C-CTATA ***
9342871-GC-G 9505262-GC-G ***
8888375-CTTTTT-C 9020334-CTTTTT-C 25×T***
8768612-TACAC-T 8900571-TACAC-T 17×AC***
13799165-C-GCAATG 11678459-C-GCAATG ***
7532276-GTATATATATA-G 7664235-GTATATATATA-G 28×TA***
13868845-TT-GG 11748139-TT-GG ***
13196092-ACAC-CTGT 11040416-ACAC-CTGT ***
13801160-AATG-CATC 11680454-AATG-CATC ***
6279798-CAA-C 6411757-CAA-C IR3_Dst 13×A***
13803179-GAC-AAT 11682473-GAC-AAT ***
6226086-T-TCTTC 6358045-T-TCTTC IR3_Dst ***
6226074-T-TCTTTCTTC 6358033-T-TCTTTCTTC IR3_Dst ***
6226071-C-CTTTCTTTA 6358030-C-CTTTCTTTA IR3_Dst ***
5785603-GATAC-AAAAA 5917562-GATAC-AAAAA ***
3550471-AACCC-CCGGG 3682430-AACCC-CCGGG ***
13143883-TCCAGTT-ACCATTC 10633369-TCCAGTT-ACCATTC ***
13488837-GCCGGTTG-AACGGGCT 11333161-GCCGGTTG-AACGGGCT ***
13196107-CCTCTCC-GCACTCA 11040431-CCTCTCC-GCACTCA ***
27256350-G-T 25110203-G-T P1_g3 ***
13847496-TTCTAAAG-CTCAAAAT 11726790-TTCTAAAG-CTCAAAAT ***
27253583-G-A 25107436-G-A P1_g3 ***
13690848-CAA-GAT 11535172-CAA-GAT ***
27248599-G-T 25102452-G-T P1_g3 ***
13699729-GGAATT-G 11544053-GGAATT-G ***
13702759-GAAGAGATAAAT-ACGGACTGGAGA 11547083-GAAGAGATAAAT-ACGGACTGGAGA ***
14331156-TG-T 12210450-TG-T ***
13465969-AGTA-GATG 11310293-AGTA-GATG ***
27190326-G-T 25044179-G-T P1_g3 ***
13818030-AG-GT 11697324-AG-GT ***
13850084-TTCA-ATCT 11729378-TTCA-ATCT ***
27263859-T-A 25117712-T-A P1_g3 ***
13850099-ATT-GTC 11729393-ATT-GTC ***
13463893-GGGT-TTGC 11308217-GGGT-TTGC ***
13702782-GAATTC-AAATGG 11547106-GAATTC-AAATGG ***
13704404-TACTCAAATGGATTA-GAATGGAGATTAATG 11548728-TACTCAAATGGATTA-GAATGGAGATTAATG ***
13804231-TA-GC 11683525-TA-GC ***
13839844-CGT-TGG 11719138-CGT-TGG ***
27248618-T-C 25102471-T-C P1_g3 ***
13463860-CACGCGGGATTGG-GACGAGGGGTTGA 11308184-CACGCGGGATTGG-GACGAGGGGTTGA ***
13838730-TCA-CCG 11718024-TCA-CCG ***
13833374-AT-A 11712668-AT-A ***
13818038-CATTG-GAATA 11697332-CATTG-GAATA ***
13488827-GTGACA-ACGACG 11333151-GTGACA-ACGACG ***
13838711-GT-AG 11718005-GT-AG ***
13488808-GAGGACCC-AAGACTG 11333132-GAGGACCC-AAGACTG ***
13487800-GGGGCTGG-CGAGCGGT 11332124-GGGGCTGG-CGAGCGGT ***
13485852-CACCG-TATCA 11330176-CACCG-TATCA ***
13485843-TCAGA-AAATG 11330167-TCAGA-AAATG ***
27190371-G-A 25044224-G-A P1_g3 ***
13485613-AATGC-GATT 11329937-AATGC-GATT ***
13481403-TAGAAAAG-AAGACAAC 11325727-TAGAAAAG-AAGACAAC ***
13474751-CT-C 11319075-CT-C ***
13471972-TG-CT 11316296-TG-CT ***
13466029-GG-AA 11310353-GG-AA ***
13489730-TGGCC-CGGCG 11334054-TGGCC-CGGCG ***
13680939-AGATATCGAATG-TGGAATTGAAAT 11525263-AGATATCGAATG-TGGAATTGAAAT ***
13681022-TCTCCAATGT-AATGGTACCG 11525346-TCTCCAATGT-AATGGTACCG ***
13850261-C-CAAATGGAATG 11729555-C-CAAATGGAATG ***
13855516-CAAACGGATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG-GAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACCCGAGTAAAGTT 11734810-CAAACGGATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG-GAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACCCGAGTAAAGTT ***
13196132-GCATCCCATTAC-CCAATCCACTAT 11040456-GCATCCCATTAC-CCAATCCACTAT ***
13447234-TCCCATC-ATCAATT 11291558-TCCCATC-ATCAATT ***
13447773-GCA-ATC 11292097-GCA-ATC ***
13447764-CACT-TTCA 11292088-CACT-TTCA ***
13489367-TCCC-CCCA 11333691-TCCC-CCCA ***
13447752-TC-CA 11292076-TC-CA ***
13447311-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA 11291635-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA ***
13447264-CTCCACTCCA-TTCTATTCCG 11291588-CTCCACTCCA-TTCTATTCCG ***
13447259-TTT-CTC 11291583-TTT-CTC ***
13447223-GCTA-ACTC 11291547-GCTA-ACTC ***
13803340-CTGTA-ATGTT 11682634-CTGTA-ATGTT ***
13442512-C-AT 11286836-C-AT ***
13803332-TGAC-AGAT 11682626-TGAC-AGAT ***
13385797-GC-AA 11230121-GC-AA ***
13803323-CAAA-TGAT 11682617-CAAA-TGAT ***
13803301-AGG-TGA 11682595-AGG-TGA ***
13803275-CC-AA 11682569-CC-AA ***
13203925-CATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-GTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT 11048249-CATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-GTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT ***
13196148-GGCTCC-CATTCT 11040472-GGCTCC-CATTCT ***
27235863-A-G 25089716-A-G P1_g3 ***
13858759-AC-CG 11738053-AC-CG ***
13461044-TAT-CCC 11305368-TAT-CCC ***
13452806-CACTGCACTACATTCCACTGAATTCCAC-TATTCAACTCCCTTACTCTCCATTACAT 11297130-CACTGCACTACATTCCACTGAATTCCAC-TATTCAACTCCCTTACTCTCCATTACAT ***
13704431-ATGGAACTAAACGTAATGAACTC-GACTAATGGAATAGAATCAAATG 11548755-ATGGAACTAAACGTAATGAACTC-GACTAATGGAATAGAATCAAATG ***
27186374-T-A 25040227-T-A P1_g3 ***
13804159-CGGAA-TGCAG 11683453-CGGAA-TGCAG ***
13456703-CCTTGGGTTG-ATTGCATTCC 11301027-CCTTGGGTTG-ATTGCATTCC ***
13456687-CCGTCCTT-AAGTTGAA 11301011-CCGTCCTT-AAGTTGAA ***
13454342-CA-GG 11298666-CA-GG ***
13858729-CGACTGGAATGGAATGGAATGGAATGG-GGAATCGAAGGAATTGGAACAA 11738023-CGACTGGAATGGAATGGAATGGAATGG-GGAATCGAAGGAATTGGAACAA ***
27273083-G-T 25126936-G-T P1_g3 ***
13804150-AGAA-GGAC 11683444-AGAA-GGAC ***
13451051-CATTCCA-AATTACT 11295375-CATTCCA-AATTACT ***
13804122-GATC-AATA 11683416-GATC-AATA ***
13452796-CATTCC-GGATTG 11297120-CATTCC-GGATTG ***
27277091-G-T 25130944-G-T P1_g3 ***
27305957-A-C 25159810-A-C P1_g3 ***
13452788-ATT-TTA 11297112-ATT-TTA ***
13452758-CTTCTTTCAACTCCACTCATC-TTCCATTCCATTCCGTTCTAT 11297082-CTTCTTTCAACTCCACTCATC-TTCCATTCCATTCCGTTCTAT ***
13452723-CTCCTCTGCAC-TTGCATTCCAT 11297047-CTCCTCTGCAC-TTGCATTCCAT ***
13452715-ACTC-CAAT 11297039-ACTC-CAAT ***
27570867-CGTGT-C 25424720-CGTGT-C P1_Y2 20×GT***
28160701-G-T 26014554-G-T P1_b4 ***
7103038-TACAC-T 7234997-TACAC-T 17×AC***
27582939-C-T 25436792-C-T P1_Y2 ***
27425654-C-T 25279507-C-T P1_g3 ***
28043465-G-T 25897318-G-T P1_Y2 ***
27427449-A-G 25281302-A-G P1_g3 ***
27434854-G-A 25288707-G-A P1_g3 ***
27499250-T-A 25353103-T-A P1_Y2 ***
27534257-A-C 25388110-A-C P1_Y2 ***
27582935-A-T 25436788-A-T P1_Y2 ***
27582937-G-T 25436790-G-T P1_Y2 ***
28015135-C-A 25868988-C-A P1_Y2 ***
27582940-A-T 25436793-A-T P1_Y2 ***
28045740-C-A 25899593-C-A P1_Y2 ***
27582943-A-T 25436796-A-T P1_Y2 ***
27582945-C-T 25436798-C-T P1_Y2 ***
27582946-A-T 25436799-A-T P1_Y2 ***
27996179-G-T 25850032-G-T P1_Y2 ***
27978542-A-T 25832395-A-T P1_Y2 ***
27971727-A-C 25825580-A-C P1_Y2 ***
27582948-A-T 25436801-A-T P1_Y2 ***
27971680-C-A 25825533-C-A P1_Y2 ***
27582950-A-T 25436803-A-T P1_Y2 ***
27582956-A-T 25436809-A-T P1_Y2 ***
27421698-G-A 25275551-G-A P1_g3 ***
28078293-G-T 25932146-G-T P1_Y2 ***
27582961-C-A 25436814-C-A P1_Y2 ***
28120509-C-G 25974362-C-G P1_b4 ***
27357533-G-T 25211386-G-T P1_g3 ***
28146491-G-T 26000344-G-T P1_b4 ***
27368678-G-T 25222531-G-T P1_g3 ***
28143445-C-A 25997298-C-A P1_b4 ***
27373452-G-T 25227305-G-T P1_g3 ***
27375745-G-T 25229598-G-T P1_g3 ***
28133068-A-T 25986921-A-T P1_b4 ***
28132532-T-G 25986385-T-G P1_b4 ***
27376547-G-A 25230400-G-A P1_g3 ***
27389623-G-T 25243476-G-T P1_g3 ***
27397085-C-A 25250938-C-A P1_g3 ***
27419620-T-A 25273473-T-A P1_g3 ***
27399219-G-A 25253072-G-A P1_g3 ***
28120469-G-C 25974322-G-C P1_b4 ***
28120453-A-G 25974306-A-G P1_b4 ***
28117222-C-T 25971075-C-T P1_b4 ***
27415889-A-G 25269742-A-G P1_g3 ***
28117217-C-T 25971070-C-T P1_b4 ***
28117207-A-T 25971060-A-T P1_b4 ***
28117200-C-T 25971053-C-T P1_b4 ***
28117196-G-T 25971049-G-T P1_b4 ***
28095676-G-T 25949529-G-T P1_Y2 ***
27582957-T-A 25436810-T-A P1_Y2 ***
27971678-T-A 25825531-T-A P1_Y2 ***
28160724-G-T 26014577-G-T P1_b4 ***
27821618-G-A 25675471-G-A P1_Y2 ***
27786902-G-T 25640755-G-T P1_Y2 ***
27791844-T-C 25645697-T-C P1_Y2 ***
27829138-T-A 25682991-T-A P1_Y2 ***
27829116-T-G 25682969-T-G P1_Y2 ***
27821688-T-G 25675541-T-G P1_Y2 ***
27821663-T-A 25675516-T-A P1_Y2 ***
27821659-G-T 25675512-G-T P1_Y2 ***
27821655-A-T 25675508-A-T P1_Y2 ***
27821647-C-A 25675500-C-A P1_Y2 ***
27821621-G-A 25675474-G-A P1_Y2 ***
27819879-T-C 25673732-T-C P1_Y2 ***
27849529-G-T 25703382-G-T P1_Y2 ***
27819705-A-C 25673558-A-C P1_Y2 ***
27792018-A-C 25645871-A-C P1_Y2 ***
27810366-A-G 25664219-A-G P1_Y2 ***
27810364-G-A 25664217-G-A P1_Y2 ***
27810363-A-G 25664216-A-G P1_Y2 ***
27810362-A-G 25664215-A-G P1_Y2 ***
27810360-G-A 25664213-G-A P1_Y2 ***
27810356-G-A 25664209-G-A P1_Y2 ***
27793192-C-A 25647045-C-A P1_Y2 ***
27809442-T-C 25663295-T-C P1_Y2 ***
27844539-A-T 25698392-A-T P1_Y2 27×T***
27861760-G-A 25715613-G-A P1_Y2 ***
27582965-C-T 25436818-C-T P1_Y2 ***
27873413-A-T 25727266-A-T P1_Y2 ***
27968128-C-A 25821981-C-A P1_Y2 ***
27585887-A-T 25439740-A-T P1_Y2 ***
27585901-G-T 25439754-G-T P1_Y2 ***
27962620-C-A 25816473-C-A P1_Y2 ***
27960994-G-T 25814847-G-T P1_Y2 ***
27960955-C-A 25814808-C-A P1_Y2 ***
27883134-G-T 25736987-G-T P1_Y2 ***
27585902-C-T 25439755-C-T P1_Y2 ***
27585907-C-T 25439760-C-T P1_Y2 ***
13859884-GGAA-AGAG 11739178-GGAA-AGAG ***
27585908-A-T 25439761-A-T P1_Y2 ***
27861761-G-T 25715614-G-T P1_Y2 ***
27637260-G-T 25491113-G-T P1_Y2 ***
27644320-C-G 25498173-C-G P1_Y2 ***
27644323-A-G 25498176-A-G P1_Y2 ***
27686149-C-A 25540002-C-A P1_Y2 ***
27864409-T-G 25718262-T-G P1_Y2 ***
27861765-C-A 25715618-C-A P1_Y2 ***
27711613-G-T 25565466-G-T P1_Y2 ***
27785716-C-A 25639569-C-A P1_Y2 ***
27785853-C-A 25639706-C-A P1_Y2 ***
27861763-C-A 25715616-C-A P1_Y2 ***
28160697-G-T 26014550-G-T P1_b4 ***
28160725-A-T 26014578-A-T P1_b4 ***
22352949-CCGGTGA-GTGTTGC 20191063-CCGGTGA-GTGTTGC DYZ19 ***
28806582-T-A 26660435-T-A ***
58825008-T-A 56765863-A-T ***
27316296-G-T 25170149-G-T P1_g3 ***
27318959-A-G 25172812-A-G P1_g3 ***
58825007-C-A 56765864-G-T ***
58822432-A-T 56768439-T-A ***
58822425-G-T 56768446-C-A ***
58822217-A-T 56768654-T-A ***
58820203-C-A 56770668-G-T ***
28809305-T-G 26663158-T-G ***
28806583-G-T 26660436-G-T ***
28806580-A-G 26660433-A-G ***
58855362-G-C 56735509-C-G ***
27320074-A-T 25173927-A-T P1_g3 ***
28806578-G-T 26660431-G-T ***
28806577-T-A 26660430-T-A ***
28806575-A-G 26660428-A-G ***
28806573-G-T 26660426-G-T ***
28806572-T-A 26660425-T-A ***
28806571-T-A 26660424-T-A ***
28806570-A-G 26660423-A-G ***
28806568-G-T 26660421-G-T ***
28806566-G-A 26660419-G-A ***
58830518-C-T 56760353-G-A ***
58855367-C-T 56735504-G-A ***
28806564-G-A 26660417-G-A ***
58975940-C-T 56829793-C-T ***
9342865-T-TG 9505256-T-TG ***
27313049-G-T 25166902-G-T P1_g3 ***
59001248-A-C 56855101-A-C ***
58982530-C-A 56836383-C-A ******
58982234-A-T 56836087-A-T ***
58981978-T-C 56835831-T-C ***
58981532-C-A 56835385-C-A ***
58978685-A-T 56832538-A-T ***
58977246-T-C 56831099-T-C ***
58977244-C-A 56831097-C-A ***
58974490-A-C 56828343-A-C ***
58855369-A-G 56735502-T-C ***
58905385-G-A 56685486-C-T ***
58884897-T-C 56705974-A-G ***
58884875-C-A 56705996-G-T ***
58866138-T-C 56724733-A-G ***
58865975-G-C 56724896-C-G ***
58858972-G-A 56731899-C-T ***
58858970-T-A 56731901-A-T ***
58858968-A-T 56731903-T-A ***
58858862-C-G 56732009-G-C ***
58858855-A-T 56732016-T-A ***
28806565-A-G 26660418-A-G ***
28806563-G-T 26660416-G-T ***
28160729-C-T 26014582-C-T P1_b4 ***
28257546-G-T 26111399-G-T P1_b4 ***
28784538-A-T 26638391-A-T ***
28784534-T-C 26638387-T-C ***
28733323-G-T 26587176-G-T ***
28687503-C-A 26541356-C-A ***
28583301-A-G 26437154-A-G ***
28583300-C-G 26437153-C-G ***
28583299-T-G 26437152-T-G ***
28583298-G-T 26437151-G-T ***
28372840-T-C 26226693-T-C P1_gr2 ***
28270445-G-T 26124298-G-T P1_b4 ***
28253542-T-A 26107395-T-A P1_b4 ***
28784544-T-G 26638397-T-G ***
28253470-T-A 26107323-T-A P1_b4 ***
28225814-T-G 26079667-T-G P1_b4 ***
28184557-G-T 26038410-G-T P1_b4 ***
28184467-G-T 26038320-G-T P1_b4 ***
28175320-C-A 26029173-C-A P1_b4 ***
28170543-G-A 26024396-G-A P1_b4 ***
28170498-A-C 26024351-A-C P1_b4 ***
28170495-T-A 26024348-T-A P1_b4 ***
28170490-G-A 26024343-G-A P1_b4 ***
28160765-A-G 26014618-A-G P1_b4 ***
28784543-A-T 26638396-A-T ***
28784545-T-A 26638398-T-A ***
28806562-T-A 26660415-T-A ***
28803726-G-C 26657579-G-C ***
28806561-G-A 26660414-G-A ***
28806560-A-G 26660413-A-G ***
28806558-G-T 26660411-G-T ***
28806557-T-A 26660410-T-A ***
28806555-A-G 26660408-A-G ***
28806553-G-T 26660406-G-T ***
28806551-C-A 26660404-C-A ***
28806550-A-G 26660403-A-G ***
28803735-A-G 26657588-A-G ***
28803729-T-C 26657582-T-C ***
28803718-C-A 26657571-C-A ***
28784546-G-A 26638399-G-A ***
28803710-T-G 26657563-T-G ***
28800147-G-T 26654000-G-T ***
28797500-A-C 26651353-A-C ***
28796182-T-C 26650035-T-C ***
28788018-A-C 26641871-A-C ***
28788015-G-C 26641868-G-C ***
28788012-G-T 26641865-G-T ***
28788010-G-A 26641863-G-A ***
27337438-G-T 25191291-G-T P1_g3 ***
28784548-A-T 26638401-A-T ***
13858767-CAC-AGG 11738061-CAC-AGG ***
14937858-C-CTTTTCTTTTA 12825933-C-CTTTTCTTTTA ***
13860018-TAG-ACA 11739312-TAG-ACA ***
58978713-AA-GC 56832566-AA-GC ***
59030568-T-TTTAA 56884421-T-TTTAA ***
59030498-C-CAAAA 56884351-C-CAAAA ***
59004463-A-AAAAGAAAGAAAGAAAG 56858316-A-AAAAGAAAGAAAGAAAG 15×AAAG***
58982249-ACTG-TCTC 56836102-ACTG-TCTC ***
58981831-A-ATTCTT 56835684-A-ATTCTT ******
58981697-GATCC-TATCT 56835550-GATCC-TATCT ***
58981677-ACA-CCT 56835530-ACA-CCT ***
58981662-CC-AA 56835515-CC-AA ***
58981288-TTG-CTT 56835141-TTG-CTT ***
58977556-TGT-CAC 56831409-TGT-CAC ***
14937826-T-TTCTTTTCTTG 12825901-T-TTCTTTTCTTG ***
58977241-TT-CA 56831094-TT-CA ***
58977126-TTCCG-CTCCA 56830979-TTCCG-CTCCA ***
58976964-CTCCAC-A 56830817-CTCCAC-A ***
58976384-ACATTCCATTGCA-CCAAACCACTCCT 56830237-ACATTCCATTGCA-CCAAACCACTCCT ***
58976377-TTA-CTC 56830230-TTA-CTC ***
58975933-TACTTCACCTCA-CATTGCATTCGT 56829786-TACTTCACCTCA-CATTGCATTCGT ***
58975770-CT-TG 56829623-CT-TG ***
58974210-CA-TG 56828063-CA-TG ***
58973093-GC-CG 56826946-GC-CG ***
58972725-GATTCT-CAGTCC 56826578-GATTCT-CAGTCC ***
8555568-T-TGTTTTC 8687527-T-TGTTTTC ***
27173542-A-T 25027395-A-T P1_g3 ***
58858936-GCACTCC-AGGATTG 56731929-GGAGTGC-CAATCCT ***
6786718-C-A 6918677-C-A ***
17031770-C-A 14919890-C-A ***
9092553-G-T 9254944-G-T ***
8533208-C-A 8665167-C-A ***
10825321-A-G ***
22774515-C-A 20612629-C-A ***
28635157-C-A 26489010-C-A ***
13478222-C-A,T 11322546-C-A,T ***
14331155-TTG-G,TTT 12210449-TTG-G,TTT ***
3272840-G-A 3404799-G-A ***
23189452-C-A 21027566-C-A ***
27579076-TC-T 25432929-TC-T P1_Y2 ***
13855528-A-ATGATG 11734822-A-ATGATG ***
13478098-G-T 11322422-G-T ***
23792029-CTTT-C 21630143-CTTT-C 15×T***
10657411-A-G ***
13823196-T-A 11702490-T-A ***
6915833-C-T 7047792-C-T ***
7660016-TAA-T 7791975-TAA-T 14×A***
58972562-T-C 56826415-T-C ***
13865900-A-C,G 11745194-A-C,G ***
14860082-CAA-C 12748148-CAA-C 12×A***
58858951-ACATTCTACTCTA-GACAGGATCTCAC 56731908-TAGAGTAGAATGT-GTGAGATCCTGTC ***
58858832-CAGTCCATTACTATCCA-GGGTTGATTCCATTGCT 56732023-TGGATAGTAATGGACTG-AGCAATGGAATCAACCC ***
9430197-G-T 9592588-G-T ***
27761167-TA-T 25615020-TA-T P1_Y2 ***
27962556-AT-A 25816409-AT-A P1_Y2 8×T***
27942188-CAGAGAGA-C 25796041-CAGAGAGA-C P1_Y2 ***
27937952-TCAGGAAAATCCTTCAAAAATCCATGAATC-T 25791805-TCAGGAAAATCCTTCAAAAATCCATGAATC-T P1_Y2 ***
27916437-CAAACAGAATGAAACAC-AAAAAAAAAAAAAAAAA 25770290-CAAACAGAATGAAACAC-AAAAAAAAAAAAAAAAA P1_Y2 ***
27909316-GA-G 25763169-GA-G P1_Y2 ***
27904476-C-CT 25758329-C-CT P1_Y2 11×T***
27815070-C-CT 25668923-C-CT P1_Y2 10×T***
27809575-TT-AA 25663428-TT-AA P1_Y2 ***
27777099-GT-G 25630952-GT-G P1_Y2 9×T***
27745674-T-TA 25599527-T-TA P1_Y2 12×A***
27978560-ATT-A 25832413-ATT-A P1_Y2 14×T***
27739907-GAA-G 25593760-GAA-G P1_Y2 10×A***
27717288-TA-T 25571141-TA-T P1_Y2 ***
27713162-AT-A 25567015-AT-A P1_Y2 ***
27711690-CTT-C 25565543-CTT-C P1_Y2 17×T***
27711095-G-GT 25564948-G-GT P1_Y2 8×T***
27586578-CATAA-C 25440431-CATAA-C P1_Y2 ***
27583000-C-CT 25436853-C-CT P1_Y2 22×T***
27564840-T-TA 25418693-T-TA P1_Y2 9×A***
27424163-CTT-C 25278016-CTT-C P1_g3 17×T***
27412976-GTT-G 25266829-GTT-G P1_g3 ***
27968354-C-CT 25822207-C-CT P1_Y2 14×T***
27997713-CAGGCAGAG-AAAAAAAAA 25851566-CAGGCAGAG-AAAAAAAAA P1_Y2 ***
58855332-G-GCACACGGGTT 56735536-A-ATGAACCCGTG 4×CATTC***
58819638-C-CT 56771229-G-GA ***
58855325-TTC-ATT 56735544-GAA-AAT ***
58855276-ACCATTCC-TCGAGTCG 56735588-GGAATGGT-CGACTCGA ***
58848072-GA-TC 56742798-TC-GA ***
58834871-TTTCCA-T 56755981-CGAATG-C ***
58826874-CCATTG-C 56763987-GAATGC-G ***
58822358-ATTCCATTCCT-A 56768498-AGGAAAGGAAT-A ***
58822238-AT-A 56768625-GA-G ***
58821640-TCG-AAC 56769229-CGA-GTT ***
58821633-TTTCGT-ATTCTA 56769233-ACGAAA-TAGAAT ***
28803746-GCAG-ACAA 26657599-GCAG-ACAA ***
28007101-GAAAACTTCC-G 25860954-GAAAACTTCC-G P1_Y2 ***
28392034-AT-A 26245887-AT-A P1_gr2 ***
28315828-CTGTG-C 26169681-CTGTG-C P1_b4 21×TG***
28245714-A-ATT 26099567-A-ATT P1_b4 15×T***
28184488-ATAT-A 26038341-ATAT-A P1_b4 14×TAT***
28175354-C-CAA 26029207-C-CAA P1_b4 ***
28146580-AT-A 26000433-AT-A P1_b4 10×T***
28142055-AT-A 25995908-AT-A P1_b4 ***
28142037-A-AT 25995890-A-AT P1_b4 9×T***
28078316-T-TA 25932169-T-TA P1_Y2 10×A***
28015149-CAA-C 25869002-CAA-C P1_Y2 9×A***
23205241-C-A 21043355-C-A ***
13842707-C-T 11722001-C-T ***
27344661-GA-G 25198514-GA-G P1_g3 ***
17193401-A-T 15081521-A-T ***
18814674-C-A 16702794-C-A ***
18247675-C-A 16135795-C-A ***
18242292-C-A 16130412-C-A ***
18145486-C-A 16033606-C-A ***
18053298-C-A 15941418-C-A ***
17959431-C-A 15847551-C-A ***
17583856-C-A 15471976-C-A ***
17436537-G-T 15324657-G-T ***
17193673-A-G 15081793-A-G ***
17142065-C-A 15030185-C-A ***
19124236-C-A 17012356-C-A ***
17126155-C-A 15014275-C-A ***
17119226-C-A 15007346-C-A ***
16984195-C-A 14872315-C-A ***
16777154-C-A 14665274-C-A ***
16729869-C-A 14617989-C-A ***
16556122-C-A 14444242-C-A ***
16386340-C-A 14274460-C-A ***
16176404-G-T 14064524-G-T ***
15993266-C-A 13881386-C-A ***
15684102-T-C 13572222-T-C ***
18855057-A-T 16743177-A-T ***
19217994-C-A 17106114-C-A ***
15391484-C-A 13279604-C-A ***
23555159-C-A 21393273-C-A ***
56827300-T-A ***
28627037-GA-G 26480890-GA-G ***
28591574-C-A 26445427-C-A ***
28536037-C-A 26389890-C-A ***
28485464-C-A 26339317-C-A ***
25201020-AAGAAAGAAAG-A,AAGAAAGAA 23054873-AAGAAAGAAAG-A,AAGAAAGAA g1 ***
23821897-C-A 21660011-C-A ***
23763781-C-A 21601895-C-A ***
23754539-C-A 21592653-C-A ***
23482906-AAAA-AAAG,G 21321020-AAAA-AAAG,G ***
19521198-C-A 17409318-C-A ***
23280328-C-A 21118442-C-A ***
23064906-A-G 20903020-A-G ***
22903092-G-T 20741206-G-T ***
22601548-C-A 20439662-C-A ***
22508578-T-C 20346692-T-C DYZ19 ***
22183287-A-G 20021401-A-G ***
21973972-C-A 19812086-C-A ***
21909757-T-A 19747871-T-A ***
21294091-AGGTGACTGCAGAGTAAAGACATGG-A 19132205-AGGTGACTGCAGAGTAAAGACATGG-A ***
19543570-CCG-C 17431690-CCG-C ***
15609219-C-A 13497339-C-A ***
15346847-C-A 13234966-C-A ***
2717166-C-A 2849125-C-A ***
7332190-G-T 7464149-G-T ***
8481037-T-C 8612996-T-C ***
8449887-C-A 8581846-C-A ***
8440273-G-T 8572232-G-T ***
8434185-C-A 8566144-C-A ***
8414370-C-A 8546329-C-A ***
8395790-A-T 8527749-A-T ***
8385371-C-A 8517330-C-A ***
8024981-C-A 8156940-C-A ***
7958398-AT-A 8090357-AT-A ***
7291593-C-A 7423552-C-A ***
8877327-T-C 9009286-T-C ***
7205668-G-A 7337627-G-A ***
7199310-C-A 7331269-C-A ***
7177913-C-A 7309872-C-A ***
6769710-T-C 6901669-T-C ***
6374011-G-T 6505970-G-T ***
5557735-T-A 5689694-T-A ***
3865917-C-T 3997876-C-T ***
2883512-C-A 3015471-C-A ***
2794723-TATAAACCTTTGACTTTAGTTGCTTGGCACG-T 2926682-TATAAACCTTTGACTTTAGTTGCTTGGCACG-T ***
2738667-T-C 2870626-T-C ***
8637008-C-A 8768967-C-A ***
9140351-T-A 9302742-T-A ***
15129767-G-T 13017854-G-T ***
13818142-G-A 11697436-G-A ***
14714222-C-A 12602289-C-A ***
14638728-C-A 12526797-C-A ***
14317616-C-A 12196910-C-A ***
14241478-C-A 12120772-C-A ***
14228533-C-A 12107827-C-A ***
14225163-C-A 12104457-C-A ***
14187443-C-A 12066737-C-A ***
14076243-C-A 11955537-C-A ***
14000645-C-T 11879939-C-T ***
11656461-C-A ***
9371457-CATATATATATAT-C,CATATATATAT 9533848-CATATATATATAT-C,CATATATATAT 22×AT***
11655960-G-A ***
13644924-C-A 11489248-C-A ***
13464020-C-A 11308344-C-A ***
28132475-C-CT 25986328-C-CT P1_b4 15×T***
10682518-ATTC-A ***
9647475-C-A 9809866-C-A IR3_Prx ***
9520121-G-A 9682512-G-A ***
9467118-CTT-C 9629509-CTT-C 11×T***
9462829-G-T 9625220-G-T ***
9451201-C-A 9613592-C-A ***
27354859-AT-A 25208712-AT-A P1_g3 8×T***
27337461-CAATTCCTTTGACA-C 25191314-CAATTCCTTTGACA-C P1_g3 ***
13860093-AT-TG 11739387-AT-TG ***
20495619-CT-C 18333733-CT-C P5_Dst ***
20602137-TTTTTTT-CTCTATA 18440251-TTTTTTT-CTCTATA P5_Dst ***
20602125-AATG-CAAA 18440239-AATG-CAAA P5_Dst ***
20602008-AAAAGAGAA-GTAAAAAAG 18440122-AAAAGAGAA-GTAAAAAAG P5_Dst ***
20593055-CA-C 18431169-CA-C P5_Dst 22×A***
20584677-TAAATACAAGTA-T 18422791-TAAATACAAGTA-T P5_Dst ***
20579119-C-CAT 18417233-C-CAT P5_Dst ***
20567702-AT-A 18405816-AT-A P5_Dst 10×T***
20530293-CA-TG 18368407-CA-TG P5_Dst ***
20530282-C-CAAAAAAAA 18368396-C-CAAAAAAAA P5_Dst ***
20479819-A-AT 18317933-A-AT P5_Dst 14×T***
20717038-TC-AA 18555152-TC-AA P4_Prx ***
20479152-CTTTTTTAGTTACTTTTGTTATCATT-C 18317266-CTTTTTTAGTTACTTTTGTTATCATT-C P5_Dst ***
20449946-GA-G 18288060-GA-G P5_Dst ***
20442453-GA-G 18280567-GA-G P5_Dst 11×A***
20434280-TAA-T 18272394-TAA-T P5_Dst 18×A***
20387096-GA-G 18225210-GA-G P5_Dst 11×A***
20378391-CTT-C 18216505-CTT-C P5_Dst ***
20368108-CTTT-C 18206222-CTTT-C P5_Dst 22×T***
20362564-C-CTT 18200678-C-CTT P5_Dst 11×T***
20360957-A-ATT 18199071-A-ATT P5_Dst 10×T***
20334605-GA-G 18172719-GA-G P5_Dst ***
20602145-CTTTTTATGGC-ACTATAAATTA 18440259-CTTTTTATGGC-ACTATAAATTA P5_Dst ***
20850693-G-GTA 18688807-G-GTA P4_Dst 12×TA***
20232493-AGAGA-GGAGT 18070607-AGAGA-GGAGT P5_Dst ***
21402181-CTTT-C 19240295-CTTT-C 34×T***
22293412-CCTTA-GCTC 20131526-CCTTA-GCTC DYZ19 ***
22256886-ATTTACG-TTTGTTC 20095000-ATTTACG-TTTGTTC DYZ19 ***
22244982-GTTATATCCAGAGT-CTGCAGCATCATTC 20083096-GTTATATCCAGAGT-CTGCAGCATCATTC DYZ19 ***
22236252-GACC-CACA 20074366-GACC-CACA DYZ19 ***
22113187-CAAAAAAA-C 19951301-CAAAAAAA-C 23×A***
21853659-GACGACAGAG-AACAACAAAA 19691773-GACGACAGAG-AACAACAAAA ***
21477860-A-AAAGC 19315974-A-AAAGC ***
21477840-A-AAAGT 19315954-A-AAAGT ***
21477816-A-AAAGG 19315930-A-AAAGG ***
21251809-T-TA 19089923-T-TA ***
20868952-TA-T 18707066-TA-T P4_Dst 12×A***
21008990-TCA-T 18847104-TCA-T P4_Dst ***
21008982-TAC-T 18847096-TAC-T P4_Dst ***
21008974-GTTTTTA-G 18847088-GTTTTTA-G P4_Dst ***
21003227-G-GTTT 18841341-G-GTTT P4_Dst 14×T***
20993598-CAA-C 18831712-CAA-C P4_Dst 17×A***
20975335-G-GA 18813449-G-GA P4_Dst ***
20966227-GAA-G 18804341-GAA-G P4_Dst 11×A***
20894542-GA-G 18732656-GA-G P4_Dst ***
20875153-C-CT 18713267-C-CT P4_Dst 10×T***
20871048-CT-C 18709162-CT-C P4_Dst 8×T***
20323695-CT-C 18161809-CT-C P5_Dst 9×T***
20232462-CC-TG 18070576-CC-TG P5_Dst ***
22358088-TTACC-CTACT 20196202-TTACC-CTACT DYZ19 ***
14026022-G-GAAAT 11905316-G-GAAAT ***
18439292-TCG-CCC 16327412-TCG-CCC P6_Dst ***
17994851-CAAA-C 15882971-CAAA-C P7_Prx 17×A***
16150948-TAA-T 14039068-TAA-T P8_Dst 22×A***
16148183-C-CTT 14036303-C-CTT P8_Dst 27×T***
16119970-T-TCTTG 14008090-T-TCTTG P8_Prx ***
16119964-T-TTTCG 14008084-T-TTTCG P8_Prx ***
15423440-ACT-CCC 13311560-ACT-CCC ***
15157860-CAAAAAAAA-C 13045947-CAAAAAAA-C 21×A***
14937835-T-TTTCTTTTCTC 12825910-T-TTTCTTTTCTC ***
13869553-TGGTAT-GGAATG 11748847-TGGTAT-GGAATG ***
18487171-A-AT 16375291-A-AT P6_Dst ***
13869512-AT-TG 11748806-AT-TG ***
13869419-GGAATG-TGACTC 11748713-GGAATG-TGACTC ***
13869313-TGGACTCAAAA-AGGAGTCCAAT 11748607-TGGACTCAAAA-AGGAGTCCAAT ***
13869234-AGG-GGA 11748528-AGG-GGA ***
13869213-ATGAA-TCAGT 11748507-ATGAA-TCAGT ***
13866864-GA-AG 11746158-GA-AG ***
13866855-GACTC-CACTT 11746149-GACTC-CACTT ***
13866834-CT-GG 11746128-CT-GG ***
13860367-TTTGGA-AAT 11739661-TTTGGA-AAT ***
13860133-TTCGTTGGAACTT-AGGAATAGAATGG 11739427-TTCGTTGGAACTT-AGGAATAGAATGG ***
18453796-TA-T 16341916-TA-T P6_Dst 8×A***
18513323-TA-T 16401443-TA-T P6_Dst 8×A***
20223521-CA-C 18061635-CA-C P5_Dst ***
20097620-A-AT 17985740-A-AT P5_Dst 9×T***
20217548-C-CT 18055662-C-CT P5_Dst ***
20213957-TA-T 18052071-TA-T P5_Dst ***
20212297-C-CA 18050411-C-CA P5_Dst 16×A***
20207102-C-CA 18045216-C-CA P5_Dst 10×A***
20205142-CT-C 18043256-CT-C P5_Dst ***
20195543-G-GA 18033657-G-GA P5_Dst 10×A***
20142089-CAAGA-AAAAC 18030209-CAAGA-AAAAC P5_Dst ***
20112192-TCTTGTCCATCAGCCTGGAACCTGGACCTCAGGCTGTAA-T 18000312-TCTTGTCCATCAGCCTGGAACCTGGACCTCAGGCTGTAA-T P5_Dst ***
20097820-TTTC-T 17985940-TTTC-T P5_Dst 5×TTC***
20096718-CA-C 17984838-CA-C P5_Dst 10×A***
19124920-CTTTT-C 17013040-CTTTT-C 15×T******
20082755-AT-A 17970875-AT-A P5_Dst 9×T***
20081154-TA-T 17969274-TA-T P5_Dst ***
20045224-AAAAAAAAAAAAAAA-GAACAAGACCCTGTC 17933344-AAAAAAAAAAAAAAA-GAACAAGACCCTGTC P5_Prx ***
19987682-GT-G 17875802-GT-G P5_Prx 15×T***
19765959-GCCCACCA-CCCCCCCC 17654079-GCCCACCA-CCCCCCCC P5_Prx ***
19745475-CTT-C 17633595-CTT-C P5_Prx 18×T***
19682387-GAAA-G 17570507-GAAA-G P5_Prx ***
19647571-CTTT-C 17535691-CTTT-C P5_Prx 16×T***
19359857-TA-GTATTGTG 17247977-TA-GTATTGTG ***
19359822-CACACATACATATATACA-TGTATATATGTATGTGTG 17247942-CACACATACATATATACA-TGTATATATGTATGTGTG ***
22353065-AATAAT-CCGACC 20191179-AATAAT-CCGACC DYZ19 ***
22358161-GT-TC 20196275-GT-TC DYZ19 ***
27316407-G-GTT 25170260-G-GTT P1_g3 9×T***
25524836-AGC-TGT 23378689-AGC-TGT P1_gr1 ***
25964715-GTTTCA-TTTTTT 23818568-GTTTCA-TTTTTT P1_Y1 ***
25766674-CA-C 23620527-CA-C P1_b3 ***
25763125-TA-T 23616978-TA-T P1_b3 9×A***
25698641-ATG-A 23552494-ATG-A P1_b3 8×TG***
25689959-TA-T 23543812-TA-T P1_b3 13×A***
25670996-GGGTCT-G 23524849-GGGTCT-G P1_b3 ***
25668660-C-CT 23522513-C-CT P1_b3 9×T***
25662111-TAA-T 23515964-TAA-T P1_b3 14×A***
25658036-G-TTT 23511889-G-TTT P1_b3 ***
25490732-CA-C 23344585-CA-C P2_r2 ***
26395278-G-GT 24249131-G-GT P1_Y1 11×T***
25473356-TTTATTAATCAAGCTTCATTA-T 23327209-TTTATTAATCAAGCTTCATTA-T P2_r2 ***
25470597-TCCTC-T 23324450-TCCTC-T P2_r2 4×CCTC***
25460675-TATA-T 23314528-TATA-T P2_r2 13×ATA***
25445580-GTA-G 23299433-GTA-G P2_r2 10×TA***
25442253-AT-A 23296106-AT-A P2_r2 ***
25430759-CT-C 23284612-CT-C P2_r2 8×T***
25427715-GGATTT-G 23281568-GGATTT-G P2_r2 ***
25425541-G-GA 23279394-G-GA P2_r2 ***
25393996-ACGT-A 23247849-ACGT-A P2_r2 ***
25388722-G-GT 23242575-G-GT P2_r2 8×T***
26228685-CTTTC-TTTTT 24082538-CTTTC-TTTTT P1_Y1 ***
26834599-CAAAGAAAGAAAG-C 24688452-CAAAGAAAGAAAG-C P1_g2 16×AAAG***
25382069-GTA-G 23235922-GTA-G P2_r2 ***
27162085-GAC-AAA 25015938-GAC-AAA P1_g3 ***
27316208-TG-T 25170061-TG-T P1_g3 ***
27315379-TA-T 25169232-TA-T P1_g3 ***
27256040-C-CA 25109893-C-CA P1_g3 9×A***
27253568-G-GA 25107421-G-GA P1_g3 9×A***
27248568-G-GT 25102421-G-GT P1_g3 18×T***
27248303-GA-G 25102156-GA-G P1_g3 ***
27228156-GA-G 25082009-GA-G P1_g3 ***
27199330-GTC-G 25053183-GTC-G P1_g3 ***
27178881-G-GA 25032734-G-GA P1_g3 ***
27124134-AAAGT-A 24977987-AAAGT-A P1_g3 6×AAGT***
26884348-GGTGTGTGT-G 24738201-GGTGTGTGT-G P1_r3 22×GT***
27122869-T-TA 24976722-T-TA P1_g3 8×A***
27076355-TATAATA-T 24930208-TATAATA-T P1_r4 9×ATA***
27070993-TA-T 24924846-TA-T P1_r4 ***
27042638-A-AT 24896491-A-AT P1_r4 10×T***
27001771-CTT-C 24855624-CTT-C P1_r4 24×T***
26990528-TG-T 24844381-TG-T P1_r4 ***
26953773-G-GA 24807626-G-GA P1_r3 ***
26943646-CA-C 24797499-CA-C P1_r3 ***
26942287-AT-A 24796140-AT-A P1_r3 ***
26893687-GA-G 24747540-GA-G P1_r3 8×A***
25385362-TC-T 23239215-TC-T P2_r2 ***
25366915-GA-G 23220768-GA-G P2_r2 ***
22481607-TT-CG 20319721-TT-CG DYZ19 ***
24552391-C-CT 22406244-C-CT P3_t2 ***
24643210-CTTCTA-TTTTTT 22497063-CTTCTA-TTTTTT P3_t2 ***
24641828-A-AT 22495681-A-AT P3_t2 ***
24638020-C-CA 22491873-C-CA P3_t2 10×A***
24626441-AT-A 22480294-AT-A P3_t2 10×T***
24607321-CTTTT-C 22461174-CTTTT-C P3_t2 12×T***
24601759-GT-G 22455612-GT-G P3_t2 11×T***
24597813-CT-C 22451666-CT-C P3_t2 22×T***
24587333-A-AT 22441186-A-AT P3_t2 9×T***
24577878-CAA-C 22431731-CAA-C P3_t2 25×A***
24545449-T-TC 22399302-T-TC P3_t2 ***
24660489-GCCTTACT-G 22514342-GCCTTACT-G P3_b2 ***
24542285-CA-C 22396138-CA-C P3_t2 8×A***
24052805-C-CT 21906658-C-CT P3_b1 10×T***
24033727-ATTT-A 21887580-ATTT-A ***
24032362-G-GA 21886215-G-GA ***
24028762-C-TGAGTTAAT 21882615-C-TGAGTTAAT ***
24027722-TCA-T 21881575-TCA-T ***
24017408-G-GT 21871261-G-GT 12×T***
24015843-CTCTTCT-C 21869696-CTCTTCT-C 5×TCT***
23519572-TA-T 21357686-TA-T ***
23435202-C-TTT 21273316-C-TTT ***
24654094-TTG-T 22507947-TTG-T P3_b2 ***
24662318-CTAA-TTAT 22516171-CTAA-TTAT P3_b2 ***
25366671-AT-A 23220524-AT-A P2_r2 ***
24793957-CTGGGG-C 22647810-CTGGGG-C P3_b2 ***
25365149-TATCTCTTGAAAG-T 23219002-TATCTCTTGAAAG-T P2_r2 ***
25287926-CT-TA 23141779-CT-TA P2_r1 ***
25287915-GCTTTCATTC-CACGGGATTT 23141768-GCTTTCATTC-CACGGGATTT P2_r1 ***
25287876-TTACCGAAGAATGAAGTAGGCAGACACATAAGGAG-AGTGTAAGCAGGATCAGAGAAATTAGATGCAAGA 23141729-TTACCGAAGAATGAAGTAGGCAGACACATAAGGAG-AGTGTAAGCAGGATCAGAGAAATTAGATGCAAGA P2_r1 ***
25283792-TA-T 23137645-TA-T P2_r1 13×A***
25250612-GGTGTGTGT-G 23104465-GGTGTGTGT-G P2_r1 21×GT***
24860879-TTAATAACAATGATACAATAAACA-T 22714732-TTAATAACAATGATACAATAAACA-T P3_b2 ***
24803075-CTCCA-C 22656928-CTCCA-C P3_b2 ***
24796652-G-GT 22650505-G-GT P3_b2 8×T***
24792898-AGAGTCCTTGCGGG-A 22646751-AGAGTCCTTGCGGG-A P3_b2 ***
24665751-TA-T 22519604-TA-T P3_b2 ***
24785337-CCT-C 22639190-CCT-C P3_b2 ***
24779904-AC-A 22633757-AC-A P3_b2 ***
24779006-CGGA-GGGG 22632859-CGGA-GGGG P3_b2 ***
24759302-AT-A 22613155-AT-A P3_b2 9×T***
24754582-C-AA 22608435-C-AA P3_b2 ***
24750181-GT-G 22604034-GT-G P3_b2 ***
24739651-CTT-C 22593504-CTT-C P3_b2 13×T***
24735797-C-CT 22589650-C-CT P3_b2 8×T***
24685101-GTTTTTTTATATATGTATATATTTGTATA-G 22538954-GTTTTTTTATATATGTATATATTTGTATA-G P3_b2 ***
24667645-CT-C 22521498-CT-C P3_b2 ***
27179602-G-A 25033455-G-A P1_g3 ***
26149755-A-G 24003608-A-G P1_Y1 ***
27161900-T-C 25015753-T-C P1_g3 ***
13720132-A-G 11564456-A-G ***
13704055-A-G 11548379-A-G ***
13704057-A-C 11548381-A-C ***
13704058-A-T 11548382-A-T ***
13704059-C-G 11548383-C-G ***
13720127-A-T 11564451-A-T ***
13720131-C-T 11564455-C-T ***
13720136-T-A 11564460-T-A ***
13489466-T-G 11333790-T-G ***
13720137-C-G 11564461-C-G ***
13720141-T-C 11564465-T-C ***
13720142-T-G 11564466-T-G ***
13720147-G-A 11564471-G-A ***
13720148-G-T 11564472-G-T ***
13720152-G-A 11564476-G-A ***
13720163-G-T 11564487-G-T ***
13704050-C-A 11548374-C-A ***
13489000-C-A 11333324-C-A ***
13722229-A-G 11566553-A-G ***
13469348-G-C 11313672-G-C ***
13467225-T-C 11311549-T-C ***
13467226-G-A 11311550-G-A ***
13467235-G-T 11311559-G-T ***
13467240-G-C 11311564-G-C ***
13468319-A-G 11312643-A-G ***
13469346-G-T 11313670-G-T ***
13471991-T-A 11316315-T-A ***
13488793-C-T 11333117-C-T ***
13480141-G-A 11324465-G-A ***
13480591-T-C 11324915-T-C ***
13480653-G-A 11324977-G-A ***
13480682-T-G 11325006-T-G ***
13480703-C-A 11325027-C-A ***
13482062-G-C 11326386-G-C ***
13482112-G-A 11326436-G-A ***
13722228-T-C 11566552-T-C ***
13722233-A-G 11566557-A-G ***
13465929-T-A 11310253-T-A ***
13869503-C-G 11748797-C-G ***
13850132-G-A 11729426-G-A ***
13850139-G-A 11729433-G-A ***
13850141-G-C 11729435-G-C ***
13850146-G-T 11729440-G-T ***
13858799-T-G 11738093-T-G ***
13869489-A-G 11748783-A-G ***
13869508-T-G 11748802-T-G ***
13850129-G-A 11729423-G-A ***
13869510-G-A 11748804-G-A ***
13869515-G-A 11748809-G-A ***
13869518-T-C 11748812-T-C ***
13869520-G-A 11748814-G-A ***
13869522-G-T 11748816-G-T ***
13869523-T-G 11748817-T-G ***
13869525-G-A 11748819-G-A ***
13850131-G-A 11729425-G-A ***
13850126-A-G 11729420-A-G ***
13722234-T-G 11566558-T-G ***
13803225-A-G 11682519-A-G ***
13728638-G-A 11572962-G-A ***
13735155-G-T 11579479-G-T ***
13740868-C-A 11585192-C-A ***
13801114-G-T 11680408-G-T ***
13801123-G-T 11680417-G-T ***
13801495-A-G 11680789-A-G ***
13818045-A-T 11697339-A-T ***
13850125-T-G 11729419-T-G ***
13828546-G-T 11707840-G-T ***
13850111-T-G 11729405-T-G ***
13850115-T-A 11729409-T-A ***
13850116-T-G 11729410-T-G ***
13850117-G-A 11729411-G-A ***
13850120-A-T 11729414-A-T ***
13850122-A-G 11729416-A-G ***
13467219-A-T 11311543-A-T ***
13464369-C-A 11308693-C-A ***
13869530-G-A 11748824-G-A ***
9700910-T-G 9863301-T-G IR3_Prx ***
9601655-T-C 9764046-T-C IR3_Prx ***
9602643-T-A 9765034-T-A IR3_Prx ***
9629420-G-T 9791811-G-T IR3_Prx ***
9634161-A-T 9796552-A-T IR3_Prx ***
9700702-C-G 9863093-C-G IR3_Prx ***
9700889-G-A 9863280-G-A IR3_Prx ***
9700911-G-A 9863302-G-A IR3_Prx ***
9596527-A-G 9758918-A-G IR3_Prx ***
9700913-T-G 9863304-T-G IR3_Prx ***
9700917-A-C 9863308-A-C IR3_Prx ***
9745940-A-C 9908331-A-C ***
9745941-A-C 9908332-A-C ***
9746018-C-T 9908409-C-T ***
9749917-A-G 9912308-A-G ***
9750015-G-T 9912406-G-T ***
9601573-T-C 9763964-T-C IR3_Prx ***
9574486-T-G 9736877-T-G IR3_Prx ***
9923899-T-C 10086290-T-C ***
9340653-G-T 9503044-G-T ***
9191780-G-T 9354171-G-T ***
9191782-A-T 9354173-A-T ***
9191786-A-T 9354177-A-T ***
9229655-T-A 9392046-T-A ***
9306180-C-A 9468571-C-A ***
9320591-T-C 9482982-T-C ***
9342980-C-G 9505371-C-G ***
9572360-G-C 9734751-G-C IR3_Prx ***
9345476-A-G 9507867-A-G ***
9478111-A-C 9640502-A-C ***
9528801-A-T 9691192-A-T ***
9539327-C-T 9701718-C-T IR3_Prx ***
9551427-A-G 9713818-A-G IR3_Prx ***
9564391-T-G 9726782-T-G IR3_Prx ***
9564408-G-T 9726799-G-T IR3_Prx ***
9784666-G-T 9947057-G-T ***
9923961-T-C 10086352-T-C ***
13457646-G-C 11301970-G-C ***
13405112-A-T 11249436-A-T ***
13140095-A-C 10629581-A-C ***
13196119-A-C 11040443-A-C ***
13253352-A-T 11097676-A-T ***
13255996-G-T 11100320-G-T ***
13325975-A-G 11170299-A-G ***
13325977-T-G 11170301-T-G ***
13410664-T-A 11254988-T-A ***
13140093-A-T 10629579-A-T ***
13448858-C-A 11293182-C-A ***
13448859-C-A 11293183-C-A ***
13454350-T-C 11298674-T-C ***
13454352-C-T 11298676-C-T ***
13456716-A-C 11301040-A-C ***
13457642-G-A 11301966-G-A ***
13457643-G-T 11301967-G-T ***
13140094-A-C 10629580-A-C ***
13140091-T-A 10629577-T-A ***
9923981-G-T 10086372-G-T ***
10070058-G-A 10232449-G-A ***
9924053-C-A 10086444-C-A ***
9934935-A-T 10097326-A-T ***
9935926-C-T 10098317-C-T ***
9941285-C-T 10103676-C-T ***
10019109-T-G 10181500-T-G ***
10025267-C-A 10187658-C-A ***
10033408-C-A 10195799-C-A ***
10075704-T-C 10238095-T-C ***
13132226-G-C 10621712-G-C ***
10075730-A-T 10238121-A-T ***
10075763-G-C 10238154-G-C ***
10075782-C-T 10238173-C-T ***
10081845-C-A 10244236-C-A ***
10081847-G-T 10244238-G-T ***
10081908-A-G 10244299-A-G ***
13126058-A-T 10615544-A-T ***
13869528-T-G 11748822-T-G ***
13869536-A-G 11748830-A-G ***
9191776-A-T 9354167-A-T ***
18369713-G-A 16257833-G-A P6_Prx ***
18195228-C-A 16083348-C-A ***
18195310-C-A 16083430-C-A ***
18297872-C-A 16185992-C-A P6_Prx ***
18311685-C-A 16199805-C-A P6_Prx ***
18369619-C-A 16257739-C-A P6_Prx ***
18369627-C-A 16257747-C-A P6_Prx ***
18369716-T-G 16257836-T-G P6_Prx ***
18195202-G-T 16083322-G-T ***
18369717-G-A 16257837-G-A P6_Prx ***
18369721-T-G 16257841-T-G P6_Prx ***
18369737-A-G 16257857-A-G P6_Prx ***
18439296-T-C 16327416-T-C P6_Dst ***
18439302-G-C 16327422-G-C P6_Dst ***
18439306-A-C 16327426-A-C P6_Dst ***
18439313-A-T 16327433-A-T P6_Dst ***
18195203-T-C 16083323-T-C ***
18008715-T-C 15896835-T-C P7_Dst ***
18439315-T-C 16327435-T-C P6_Dst ***
16990029-A-C 14878149-A-C ***
16305878-T-C 14193998-T-C ***
16648161-C-T 14536281-C-T ***
16860748-G-T 14748868-G-T ***
16990024-A-G 14878144-A-G ***
16990025-A-T 14878145-A-T ***
16990027-A-G 14878147-A-G ***
16990030-A-G 14878150-A-G ***
18008714-G-T 15896834-G-T P7_Dst ***
16990031-T-G 14878151-T-G ***
16990032-A-G 14878152-A-G ***
17056887-T-C 14945007-T-C ******
17707374-C-G 15595494-C-G ***
17802164-A-T 15690284-A-T ***
18008710-C-A 15896830-C-A P7_Dst ***
18008711-G-T 15896831-G-T P7_Dst ***
18439314-G-T 16327434-G-T P6_Dst ***
18439325-G-C 16327445-G-C P6_Dst ***
16292643-C-T 14180763-C-T ***
19007643-C-T 16895763-C-T ***
18959168-T-C 16847288-T-C ***
18959177-T-C 16847297-T-C ***
18959182-T-C 16847302-T-C ***
18959185-A-C 16847305-A-C ***
18982530-G-A 16870650-G-A ***
18982545-C-G 16870665-C-G ***
19007644-A-G 16895764-A-G ***
18959158-T-G 16847278-T-G ***
19007647-C-T 16895767-C-T ***
19036750-A-T 16924870-A-T ***
19187485-C-G 17075605-C-G ***
19187488-A-G 17075608-A-G ***
19187491-C-T 17075611-C-T ***
19187493-C-T 17075613-C-T ***
19187494-G-C 17075614-G-C ***
18959160-A-G 16847280-A-G ***
18959146-C-G 16847266-C-G ***
18439334-C-G 16327454-C-G P6_Dst ***
18480129-T-A 16368249-T-A P6_Dst ***
18439342-A-G 16327462-A-G P6_Dst ***
18439345-C-G 16327465-C-G P6_Dst ***
18439350-C-G 16327470-C-G P6_Dst ***
18460848-G-T 16348968-G-T P6_Dst ***
18467297-C-T 16355417-C-T P6_Dst ***
18480063-T-A 16368183-T-A P6_Dst ***
18480130-C-G 16368250-C-G P6_Dst ***
18615981-A-T 16504101-A-T ***
18480132-C-A 16368252-C-A P6_Dst ***
18480137-C-A 16368257-C-A P6_Dst ***
18512448-G-T 16400568-G-T P6_Dst ***
18513257-C-A 16401377-C-A P6_Dst ***
18534163-C-T 16422283-C-T P6_Dst ***
18565060-T-A 16453180-T-A ***
18615962-G-T 16504082-G-T ***
16305877-A-C 14193997-A-C ***
16292641-A-T 14180761-A-T ***
13869538-T-G 11748832-T-G ***
15496995-A-G 13385115-A-G ***
14986602-C-A 12874670-C-A ***
15260711-A-T 13148795-A-T ***
15363995-G-A 13252115-G-A ***
15364001-A-G 13252121-A-G ***
15364005-A-G 13252125-A-G ***
15410622-A-G 13298742-A-G ***
15622673-G-A 13510793-G-A ***
14765725-G-C 12653794-G-C ***
15815263-G-A 13703383-G-A ***
15815266-G-A 13703386-G-A ***
15815267-G-A 13703387-G-A ***
15815269-G-A 13703389-G-A ***
15815283-G-A 13703403-G-A ***
15882009-A-G 13770129-A-G ***
15882013-A-G 13770133-A-G ***
14765726-C-T 12653795-C-T ***
14765724-G-T 12653793-G-T ***
15882020-A-G 13770140-A-G ***
13929472-A-C 11808766-A-C ***
13869540-G-A 11748834-G-A ***
13869542-A-T 11748836-A-T ***
13869545-G-A 11748839-G-A ***
13869547-C-T 11748841-C-T ***
13869548-T-G 11748842-T-G ***
13869550-G-A 11748844-G-A ***
13982640-C-A 11861934-C-A ***
14754114-A-T 12642183-A-T ***
14073028-G-T 11952322-G-T ***
14077821-A-C 11957115-A-C ***
14324959-A-G 12204253-A-G ***
14324960-G-C 12204254-G-C ***
14324961-T-G 12204255-T-G ***
14324972-C-G 12204266-C-G ***
14324992-T-C 12204286-T-C ***
15882018-A-G 13770138-A-G ***
15882042-T-G 13770162-T-G ***
16292620-A-T 14180740-A-T ***
16148256-G-C 14036376-G-C P8_Dst ***
16148240-T-G 14036360-T-G P8_Dst ***
16148249-G-A 14036369-G-A P8_Dst ***
16148251-G-T 14036371-G-T P8_Dst ***
16148252-G-T 14036372-G-T P8_Dst ***
16148254-G-T 14036374-G-T P8_Dst ***
16148255-C-T 14036375-C-T P8_Dst ***
16148257-A-G 14036377-A-G P8_Dst ***
16148237-G-C 14036357-G-C P8_Dst ***
16148259-C-T 14036379-C-T P8_Dst ***
16148260-T-A 14036380-T-A P8_Dst ***
16148269-T-C 14036389-T-C P8_Dst ***
16164357-T-G 14052477-T-G P8_Dst ***
16292613-G-T 14180733-G-T ***
16292617-C-T 14180737-C-T ***
16292619-C-T 14180739-C-T ***
16148238-G-C 14036358-G-C P8_Dst ***
16148231-C-T 14036351-C-T P8_Dst ***
15904036-G-A 13792156-G-A ***
16148213-G-A 14036333-G-A P8_Dst ***
16034209-C-A 13922329-C-A ***
16118198-T-A 14006318-T-A P8_Prx ***
16118209-G-A 14006329-G-A P8_Prx ***
16118225-A-G 14006345-A-G P8_Prx ***
16146447-T-C 14034567-T-C P8_Dst ***
16147827-T-A 14035947-T-A P8_Dst ***
16148212-A-G 14036332-A-G P8_Dst ***
16148214-A-C 14036334-A-C P8_Dst ***
16148230-T-C 14036350-T-C P8_Dst ***
16148215-C-G 14036335-C-G P8_Dst ***
16148218-A-G 14036338-A-G P8_Dst ***
16148219-G-T 14036339-G-T P8_Dst ***
16148222-T-C 14036342-T-C P8_Dst ***
16148223-C-T 14036343-C-T P8_Dst ***
16148226-T-C 14036346-T-C P8_Dst ***
16148227-C-T 14036347-C-T P8_Dst ***
9191778-C-T 9354169-C-T ***
9191775-C-G 9354166-C-G ***
19187497-C-T 17075617-C-T ***
13203946-G-T 11048270-G-T ***
13203938-A-G 11048262-A-G ***
13203939-T-A 11048263-T-A ***
13203940-G-T 11048264-G-T ***
13203941-A-G 11048265-A-G ***
13203942-T-A 11048266-T-A ***
13203945-A-G 11048269-A-G ***
13203948-T-G 11048272-T-G ***
13203936-A-G 11048260-A-G ***
13203949-G-T 11048273-G-T ***
13203950-A-G 11048274-A-G ***
13203951-T-A 11048275-T-A ***
13203952-G-T 11048276-G-T ***
13203954-T-G 11048278-T-G ***
13203955-C-T 11048279-C-T ***
13203956-A-G 11048280-A-G ***
13203937-G-T 11048261-G-T ***
13203935-G-A 11048259-G-A ***
13833408-A-T 11712702-A-T ***
13203923-G-T 11048247-G-T ***
13256126-G-GT 11100450-G-GT ***
18468583-TTG-T 16356703-TTG-T P6_Dst 11×TG***
18804472-GAA-G 16692592-GAA-G ***
9745937-G-C 9908328-G-C ***
9745939-G-C 9908330-G-C ***
9745942-G-C 9908333-G-C ***
13203925-C-G 11048249-C-G ***
13203934-A-T 11048258-A-T ***
13203926-A-T 11048250-A-T ***
13203927-T-A 11048251-T-A ***
13203929-G-T 11048253-G-T ***
13203930-T-A 11048254-T-A ***
13203931-G-T 11048255-G-T ***
13203932-A-G 11048256-A-G ***
13203933-T-A 11048257-T-A ***
13203957-T-A 11048281-T-A ***
20942974-T-A 18781088-T-A P4_Dst ***
13437695-G-T 11282019-G-T ***
13855157-AA-TT 11734451-AA-TT ***
27760220-G-GT 25614073-G-GT P1_Y2 14×T***
24618868-C-CT 22472721-C-CT P3_t2 12×T***
9591034-GA-G 9753425-GA-G IR3_Prx 12×A***
13681005-GA-CG 11525329-GA-CG ***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13801234-AAG-GAA 11680528-AAG-GAA ***
16150095-CTT-C 14038215-CTT-C P8_Dst 22×T***
9540246-CT-C 9702637-CT-C IR3_Prx 18×T***
16162095-CA-C 14050215-CA-C P8_Dst 19×A***
18490252-C-CT 16378372-C-CT P6_Dst 11×T***
20848244-A-AT 18686358-A-AT P4_Dst 19×T***
20949887-AAGC-CAGT 18788001-AAGC-CAGT P4_Dst ***
20949903-TCC-CCT 18788017-TCC-CCT P4_Dst ***
21030546-T-TA 18868660-T-TA P4_Dst 13×A***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
24754928-TA-T 22608781-TA-T P3_b2 15×A***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
23693640-A-C 21531754-A-C ***
25845058-T-A 23698911-T-A P1_b3 ***
24084237-A-C 21938090-A-C P3_b1 ***
24192261-T-A 22046114-T-A P3_b1 ***
24662330-A-T 22516183-A-T P3_b2 ***
25524846-A-T 23378699-A-T P1_gr1 ***
25626845-G-A 23480698-G-A P1_b3 ***
25845055-C-A 23698908-C-A P1_b3 ***
25845062-T-A 23698915-T-A P1_b3 ***
20428495-AT-A 18266609-AT-A P5_Dst 15×T***
27062118-C-T 24915971-C-T P1_r4 22×T***
27585905-A-T 25439758-A-T P1_Y2 ***
27844528-G-T 25698381-G-T P1_Y2 ***
27873407-A-T 25727260-A-T P1_Y2 ***
28253528-T-A 26107381-T-A P1_b4 ***
28253532-G-A 26107385-G-A P1_b4 ***
28802562-T-A 26656415-T-A ***
10023585-T-G 10185976-T-G ***
24673369-T-TA 22527222-T-TA P3_b2 10×A***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
13818015-A-C 11697309-A-C ***
27810190-A-G 25664043-A-G P1_Y2 ***
27810198-A-G 25664051-A-G P1_Y2 ***
27810206-A-G 25664059-A-G P1_Y2 ***
16157706-GAAAGA-G 14045826-GAAAGA-G P8_Dst 6×AAAGA***
22489986-C-T 20328100-C-T DYZ19 ***
26282942-T-C 24136795-T-C P1_Y1 ***
20534081-TA-T 18372195-TA-T P5_Dst 14×A***
26563173-TAC-T 24417026-TAC-T P1_g2 ***
20884101-G-GA 18722215-G-GA P4_Dst 10×A***
58866148-G-C 56724723-C-G ***
20914498-C-CA 18752612-C-CA P4_Dst 12×A***
26953179-G-A 24807032-G-A P1_r3 ***
18369802-CA-C 16257922-CA-C P6_Prx 25×A***
22485755-C-A 20323869-C-A FGC12295BY4098 YFC075191 DYZ19 ***
20108239-AAT-A 17996359-AAT-A P5_Dst 15×AT***
27791968-T-TCTG 25645821-T-TCTG P1_Y2 ***
25064178-T-G 22918031-T-G g1 ******
13452743-C-T 11297067-C-T ***
13452332-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G 11296656-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G 12×ATTCC***
20084551-T-C 17972671-T-C P5_Dst ***
10026415-C-T 10188806-C-T ***
10031490-G-A 10193881-G-A ***
13449301-C-A 11293625-C-A ***
13449311-A-C 11293635-A-C ***
13449362-T-TTCCACTCCACTCCAC 11293686-T-TTCCACTCCACTCCAC ***
13454005-C-G 11298329-C-G ***
22505037-G-T 20343151-G-T DYZ19 ***
13489058-C-T 11333382-C-T ***
13494326-G-A 11338650-G-A ***
13811024-G-C 11690318-G-C ***
13811032-T-A 11690326-T-A ***
13811049-G-C 11690343-G-C ***
13815487-C-T 11694781-C-T ***
22504991-T-A 20343105-T-A DYZ19 ***
25709383-A-T 23563236-A-T P1_b3 ***
20232470-T-A 18070584-T-A P5_Dst ***
7464063-G-A 7596022-G-A IR1_L ***
20881862-CA-C 18719976-CA-C P4_Dst 16×A***
25466467-T-A 23320320-T-A P2_r2 ***
25504098-T-C 23357951-T-C P1_gr1 ***
25524814-C-T 23378667-C-T P1_gr1 ***
25658043-A-G 23511896-A-G P1_b3 ***
26310873-A-C 24164726-A-C P1_Y1 ***
27895974-A-C 25749827-A-C P1_Y2 ***
10016081-AA-TC 10178472-AA-TC ***
19189498-A-T 17077618-A-T ***
13463768-GCCCG-TCCCC 11308092-GCCCG-TCCCC ***
13803371-AGGAG-TGGAA 11682665-AGGAG-TGGAA ***
13803396-TG-CA 11682690-TG-CA ***
20253869-G-GT 18091983-G-GT P5_Dst 13×T***
20893454-CA-C 18731568-CA-C P4_Dst 10×A***
58975760-TTCCG-CTCCA 56829613-TTCCG-CTCCA ***
7464057-G-A 7596016-G-A IR1_L ***
25280450-T-C 23134303-T-C P2_r1 ***
18008713-A-T 15896833-A-T P7_Dst ***
22229609-T-C 20067723-T-C DYZ19 ***
13801242-T-G 11680536-T-G ***
13203970-C-T 11048294-C-T ***
10025263-G-A 10187654-G-A ***
58819959-A-C 56770912-T-G ***
8599943-G-GT 8731902-G-GT 9×T***
8363664-C-CT 8495623-C-CT 11×T***
27585917-C-T 25439770-C-T P1_Y2 19×T***
22358055-C-G 20196169-C-G DYZ19 ***
24177697-TTGTG-T 22031550-TTGTG-T P3_b1 17×TG***
16691391-C-A 14579511-C-A ***
13704467-A-T 11548791-A-T ***
28142885-AT-A 25996738-AT-A P1_b4 11×T***
27368948-G-GA 25222801-G-GA P1_g3 11×A***
27794410-AT-A 25648263-AT-A P1_Y2 ***
9923914-A-G 10086305-A-G ***
22481595-A-T 20319709-A-T DYZ19 ***
9311496-G-C 9473887-G-C ***
22341511-TTTCG-GTTCT 20179625-TTTCG-GTTCT DYZ19 ***
27046828-CT-C 24900681-CT-C P1_r4 10×T***
9191774-G-T 9354165-G-T ***
6140957-C-A 6272916-C-A IR3_Dst ***
5317367-G-A 5449326-G-A ***
5755691-A-G 5887650-A-G ***
5874059-C-A 6006018-C-A ***
6090422-T-G 6222381-T-G ***
6104709-G-A 6236668-G-A ***
6137892-T-G 6269851-T-G IR3_Dst ***
6158846-G-T 6290805-G-T IR3_Dst ***
4561563-C-A 4693522-C-A ***
6174500-T-G 6306459-T-G IR3_Dst ***
6246812-A-T 6378771-A-T IR3_Dst ***
6298678-T-A 6430637-T-A IR3_Dst ***
6389589-G-T 6521548-G-T ***
6400089-G-T 6532048-G-T ***
6757115-C-A 6889074-C-A ***
6901143-G-T 7033102-G-T ***
4926002-T-C 5057961-T-C ***
4557458-C-A 4689417-C-A ***
7270339-G-T 7402298-G-T ***
3990603-C-G 4122562-C-G ***
3550465-C-G 3682424-C-G ***
3550468-T-A 3682427-T-A ***
3550494-T-A 3682453-T-A ***
3951284-C-A 4083243-C-A ***
3990585-G-T 4122544-G-T ***
3990588-C-A 4122547-C-A ***
3990606-C-G 4122565-C-G ***
4509590-C-A 4641549-C-A ***
3990609-T-A 4122568-T-A ***
4243329-G-T 4375288-G-T ***
4243330-A-G 4375289-A-G ***
4243331-A-G 4375290-A-G ***
4243332-C-A 4375291-C-A ***
4243333-A-T 4375292-A-T ***
4425853-C-A 4557812-C-A ***
6939998-G-A 7071957-G-A ***
7270340-G-C 7402299-G-C ***
2814853-A-C 2946812-A-C ***
9175451-A-C 9337842-A-C ***
8181256-C-G 8313215-C-G ***
8181264-C-G 8313223-C-G ***
8181267-C-T 8313226-C-T ***
8207952-G-T 8339911-G-T ***
8216467-C-G 8348426-C-G ***
9001128-G-T 9163519-G-T ***
9175452-G-C 9337843-G-C ***
8181253-T-G 8313212-T-G ***
9175455-T-G 9337846-T-G ***
9175465-A-G 9337856-A-G ***
9175471-T-G 9337862-T-G ***
9175473-C-G 9337864-C-G ***
9175486-T-G 9337877-T-G ***
9175489-A-G 9337880-A-G ***
9175495-A-G 9337886-A-G ***
8181255-G-C 8313214-G-C ***
8181252-G-T 8313211-G-T ***
7270341-A-T 7402300-A-T ***
8181239-A-T 8313198-A-T ***
7270344-G-T 7402303-G-T ***
7387421-G-T 7519380-G-T ***
7487948-C-A 7619907-C-A IR1_L ***
7497619-C-A 7629578-C-A IR1_L ***
8163748-C-A 8295707-C-A ***
8181232-G-C 8313191-G-C ***
8181235-G-C 8313194-G-C ***
8181240-G-C 8313199-G-C ***
8181251-A-T 8313210-A-T ***
8181242-C-G 8313201-C-G ***
8181243-T-C 8313202-T-C ***
8181244-G-T 8313203-G-T ***
8181246-A-T 8313205-A-T ***
8181247-G-T 8313206-G-T ***
8181248-T-G 8313207-T-G ***
8181250-C-T 8313209-C-T ***
2860531-C-A 2992490-C-A ***
2814852-A-G 2946811-A-G ***
27166686-G-GA 25020539-G-GA P1_g3 11×A***
28796363-GTAATGCAATGGAATT-G 26650216-GTAATGCAATGGAATT-G ***
14604587-CTTC-TTTT 12492789-CTTC-TTTT ***
13704046-C-A 11548370-C-A ***
10039846-G-C 10202237-G-C ***
10075752-G-A 10238143-G-A ***
10075778-G-GTT 10238169-G-GTT ***
22358065-T-A 20196179-T-A DYZ19 ***
16104472-A-T 13992592-A-T P8_Prx ***
28814964-G-T 26668817-G-T ***
17584196-T-G 15472316-T-G ***
25427340-A-C 23281193-A-C P2_r2 ***
18913092-ATT-A 16801212-ATT-A 14×T***
27313118-A-AT 25166971-A-AT P1_g3 9×T***
13859602-A-T 11738896-A-T ***
13132116-C-T 10621602-C-T ***
13467229-A-G 11311553-A-G ***
28814967-T-A 26668820-T-A ***
20872237-AT-A 18710351-AT-A P4_Dst 11×T***
58977126-T-C 56830979-T-C ***
58985437-TCTGC-CCTGT 56839290-TCTGC-CCTGT ***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
27736672-G-GA 25590525-G-GA P1_Y2 10×A***
27868124-CA-C 25721977-CA-C P1_Y2 13×A***
27991626-GGA-G 25845479-GGA-G P1_Y2 13×GA***
28260208-CT-C 26114061-CT-C P1_b4 13×T***
58823679-TCCATTTGATGCCATC-T 56767172-CATGGGATGGCATCAA-C ***
58975737-CCAT-ACAC 56829590-CCAT-ACAC ***
9731612-GTTTG-TTTTT 9894003-GTTTG-TTTTT IR3_Prx ***
27585914-A-T 25439767-A-T P1_Y2 ***
27585915-G-T 25439768-G-T P1_Y2 ***
18369724-A-C 16257844-A-C P6_Prx ***
18369731-A-G 16257851-A-G P6_Prx ***
25466540-G-A 23320393-G-A P2_r2 ***
26463200-A-T 24317053-A-T P1_Y1 ***
27082215-G-A 24936068-G-A P1_r4 ***
6133763-C-G 6265722-C-G ***
58977125-A-G 56830978-A-G ***
2814851-C-G 2946810-C-G ***
2814838-A-T 2946797-A-T ***
2814829-A-C 2946788-A-C ***
2814830-G-T 2946789-G-T ***
2814831-G-C 2946790-G-C ***
2814832-A-C 2946791-A-C ***
2814833-G-C 2946792-G-C ***
2814835-T-A 2946794-T-A ***
2814840-A-C 2946799-A-C ***
2814826-G-A 2946785-G-A ***
2814841-C-T 2946800-C-T ***
2814842-C-G 2946801-C-G ***
2814843-A-G 2946802-A-G ***
2814845-C-A 2946804-C-A ***
2814846-C-T 2946805-C-T ***
2814848-G-A 2946807-G-A ***
2814849-G-C 2946808-G-C ***
2814827-T-G 2946786-T-G ***
2814825-G-C 2946784-G-C ***
26900291-G-A 24754144-G-A P1_r3 ***
13461699-C-A 11306023-C-A ***
9923988-A-C 10086379-A-C ***
13801131-A-G 11680425-A-G ***
21853674-T-A 19691788-T-A ***
13467218-T-A 11311542-T-A ***
13483448-T-G 11327772-T-G ***
13801536-A-G 11680830-A-G ***
23816742-G-T 21654856-G-T ***
21714723-T-G 19552837-T-G ***
2814824-A-T 2946783-A-T ***
13480600-A-T 11324924-A-T ***
9924043-C-A 10086434-C-A ***
13869490-T-A 11748784-T-A ***
28784531-G-A 26638384-G-A ***
13850142-G-T 11729436-G-T ***
2744676-A-G 2876635-A-G ***
2814823-G-T 2946782-G-T ***
19187495-C-T 17075615-C-T ***
19187499-G-T 17075619-G-T ***
27160574-A-G 25014427-A-G P1_g3 ***
25524785-G-C 23378638-G-C P1_gr1 ***
25502017-C-A 23355870-C-A P1_gr1 ***
25511923-C-A 23365776-C-A P1_gr1 ***
25524772-A-T 23378625-A-T P1_gr1 ***
25524777-A-C 23378630-A-C P1_gr1 ***
25524780-T-C 23378633-T-C P1_gr1 ***
25524782-A-C 23378635-A-C P1_gr1 ***
25524791-T-C 23378644-T-C P1_gr1 ***
25492215-C-A 23346068-C-A P2_r2 ***
25524793-G-C 23378646-G-C P1_gr1 ***
25524794-G-C 23378647-G-C P1_gr1 ***
25524797-T-C 23378650-T-C P1_gr1 ***
25524802-G-A 23378655-G-A P1_gr1 ***
25524809-T-C 23378662-T-C P1_gr1 ***
25524810-G-C 23378663-G-C P1_gr1 ***
25524819-G-T 23378672-G-T P1_gr1 ***
25500157-T-G 23354010-T-G P2_r2 ***
25471048-G-T 23324901-G-T P2_r2 ***
25524828-T-C 23378681-T-C P1_gr1 ***
25453324-C-G 23307177-C-G P2_r2 ***
25427009-A-G 23280862-A-G P2_r2 ***
25429116-C-A 23282969-C-A P2_r2 ***
25431645-C-A 23285498-C-A P2_r2 ***
25437892-C-A 23291745-C-A P2_r2 ***
25446361-G-T 23300214-G-T P2_r2 ***
25446440-C-T 23300293-C-T P2_r2 21×T***
25454057-T-A 23307910-T-A P2_r2 ***
25466500-T-A 23320353-T-A P2_r2 ***
25454092-A-C 23307945-A-C P2_r2 ***
25461553-C-A 23315406-C-A P2_r2 ***
25461557-T-A 23315410-T-A P2_r2 ***
25461588-A-T 23315441-A-T P2_r2 ***
25466471-G-C 23320324-G-C P2_r2 ***
25466485-T-A 23320338-T-A P2_r2 ***
25466495-C-A 23320348-C-A P2_r2 ***
25524825-G-C 23378678-G-C P1_gr1 ***
25524831-T-A 23378684-T-A P1_gr1 ***
25388683-T-A 23242536-T-A P2_r2 ***
25717533-T-C 23571386-T-C P1_b3 ***
25709374-C-T 23563227-C-T P1_b3 ***
25709382-C-T 23563235-C-T P1_b3 ***
25717346-T-A 23571199-T-A P1_b3 ***
25717349-A-T 23571202-A-T P1_b3 ***
25717387-G-A 23571240-G-A P1_b3 ***
25717503-T-A 23571356-T-A P1_b3 ***
25719936-G-A 23573789-G-A P1_b3 ***
25709314-A-T 23563167-A-T P1_b3 ***
25762973-T-C 23616826-T-C P1_b3 ***
25766507-A-G 23620360-A-G P1_b3 ***
25766639-A-C 23620492-A-C P1_b3 ***
25780960-G-T 23634813-G-T P1_b3 ***
25791870-G-T 23645723-G-T P1_b3 ***
25804981-A-C 23658834-A-C P1_b3 ***
25804982-C-A 23658835-C-A P1_b3 ***
25709363-G-T 23563216-G-T P1_b3 ***
25709290-C-T 23563143-C-T P1_b3 ***
25524832-G-T 23378685-G-T P1_gr1 ***
25652499-T-A 23506352-T-A P1_b3 ***
25524833-A-T 23378686-A-T P1_gr1 ***
25524843-A-T 23378696-A-T P1_gr1 ***
25524847-C-T 23378700-C-T P1_gr1 ***
25555829-C-A 23409682-C-A P1_gr1 ***
25575328-C-A 23429181-C-A P1_gr1 ***
25626874-T-A 23480727-T-A P1_b3 ***
25652525-A-G 23506378-A-G P1_b3 ***
25670888-C-A 23524741-C-A P1_b3 ***
25656165-G-T 23510018-G-T P1_b3 ***
25657367-C-A 23511220-C-A P1_b3 ***
25658041-G-T 23511894-G-T P1_b3 ***
25658049-A-T 23511902-A-T P1_b3 ***
25658050-C-T 23511903-C-T P1_b3 ***
25658052-C-T 23511905-C-T P1_b3 ***
25658058-C-T 23511911-C-T P1_b3 ***
25425520-T-C 23279373-T-C P2_r2 ***
25385373-C-T 23239226-C-T P2_r2 ***
25831891-A-T 23685744-A-T P1_b3 ***
24804031-C-T 22657884-C-T P3_b2 ***
24783211-C-A 22637064-C-A P3_b2 ***
24783919-C-A 22637772-C-A P3_b2 ***
24785248-C-T 22639101-C-T P3_b2 ***
24789868-G-A 22643721-G-A P3_b2 9×A***
24789887-G-A 22643740-G-A P3_b2 ***
24792997-G-A 22646850-G-A P3_b2 ***
24804789-C-A 22658642-C-A P3_b2 ***
24774813-G-T 22628666-G-T P3_b2 ***
24804989-G-T 22658842-G-T P3_b2 ***
24805089-C-A 22658942-C-A P3_b2 ***
24830382-T-A 22684235-T-A P3_b2 ***
24841095-T-G 22694948-T-G P3_b2 ***
24847505-G-A 22701358-G-A P3_b2 ***
24849275-T-A 22703128-T-A P3_b2 ***
24859158-T-G 22713011-T-G P3_b2 ***
24775451-C-A 22629304-C-A P3_b2 ***
24773074-C-A 22626927-C-A P3_b2 ***
24859795-T-A 22713648-T-A P3_b2 ***
24714945-G-T 22568798-G-T P3_b2 ***
24681586-A-C 22535439-A-C P3_b2 ***
24681670-A-C 22535523-A-C P3_b2 ***
24681699-A-C 22535552-A-C P3_b2 ***
24683148-A-G 22537001-A-G P3_b2 ***
24683155-T-C 22537008-T-C P3_b2 ***
24691941-G-T 22545794-G-T P3_b2 ***
24728524-A-G 22582377-A-G P3_b2 ***
24768531-A-T 22622384-A-T P3_b2 ***
24728627-A-T 22582480-A-T P3_b2 ***
24735589-T-A 22589442-T-A P3_b2 ***
24741927-A-G 22595780-A-G P3_b2 ***
24742345-C-A 22596198-C-A P3_b2 ***
24759977-C-G 22613830-C-G P3_b2 ***
24760535-C-A 22614388-C-A P3_b2 ***
24760548-T-C 22614401-T-C P3_b2 ***
24859162-C-A 22713015-C-A P3_b2 ***
24864679-G-T 22718532-G-T P3_b2 ***
25385232-T-A 23239085-T-A P2_r2 ***
25327662-T-A 23181515-T-A P2_r1 ***
25232792-T-C 23086645-T-C P2_r1 ***
25232802-G-T 23086655-G-T P2_r1 ***
25232809-C-T 23086662-C-T P2_r1 ***
25246492-A-T 23100345-A-T P2_r1 ***
25253452-G-T 23107305-G-T P2_r1 ***
25270233-C-A 23124086-C-A P2_r1 ***
25327934-G-A 23181787-G-A P2_r1 ***
25232783-A-C 23086636-A-C P2_r1 ***
25327947-G-A 23181800-G-A P2_r1 ***
25333856-C-T 23187709-C-T P2_r1 32×T***
25333944-A-T 23187797-A-T P2_r1 ***
25364374-T-C 23218227-T-C P2_r2 ***
25366651-T-C 23220504-T-C P2_r2 ***
25366662-C-A 23220515-C-A P2_r2 ***
25370510-G-T 23224363-G-T P2_r2 ***
25232790-T-C 23086643-T-C P2_r1 ***
25232771-C-T 23086624-C-T P2_r1 ***
24895738-A-T 22749591-A-T g1 ***
25176913-A-G 23030766-A-G g1 ***
24895744-A-T 22749597-A-T g1 ***
24895745-G-T 22749598-G-T g1 ***
24895774-A-G 22749627-A-G g1 ***
24898661-A-C 22752514-A-C g1 ***
25146697-C-A 23000550-C-A g1 ***
25176894-G-C 23030747-G-C g1 ***
25176902-G-C 23030755-G-C g1 ***
25176925-C-T 23030778-C-T g1 ***
25231937-T-G 23085790-T-G P2_r1 ***
25176933-G-C 23030786-G-C g1 ***
25176952-T-C 23030805-T-C g1 ***
25176962-A-G 23030815-A-G g1 ***
25176967-A-T 23030820-A-T g1 ***
25207626-A-C 23061479-A-C P2_r1 ***
25225284-T-A 23079137-T-A P2_r1 ***
25231936-T-G 23085789-T-G P2_r1 ***
25804986-G-T 23658839-G-T P1_b3 ***
25831973-G-T 23685826-G-T P1_b3 ***
24676224-T-A 22530077-T-A P3_b2 ***
26993038-G-T 24846891-G-T P1_r4 ***
26986551-A-T 24840404-A-T P1_r4 ***
26986553-C-T 24840406-C-T P1_r4 ***
26991243-T-A 24845096-T-A P1_r4 ***
26991275-T-A 24845128-T-A P1_r4 ***
26991286-G-A 24845139-G-A P1_r4 ***
26991289-T-A 24845142-T-A P1_r4 ***
27001804-A-T 24855657-A-T P1_r4 ***
26986542-T-A 24840395-T-A P1_r4 ***
27004356-C-A 24858209-C-A P1_r4 ***
27016031-G-A 24869884-G-A P1_r4 ***
27033033-C-A 24886886-C-A P1_r4 ***
27035452-G-T 24889305-G-T P1_r4 ***
27035456-G-A 24889309-G-A P1_r4 ***
27046801-A-G 24900654-A-G P1_r4 ***
27056942-A-G 24910795-A-G P1_r4 ***
26986547-A-C 24840400-A-C P1_r4 ***
26986537-T-A 24840390-T-A P1_r4 ***
27060066-C-T 24913919-C-T P1_r4 ***
26953277-G-A 24807130-G-A P1_r3 ***
26914215-C-G 24768068-C-G P1_r3 ***
26921303-C-A 24775156-C-A P1_r3 ***
26946232-G-A 24800085-G-A P1_r3 ***
26946233-G-A 24800086-G-A P1_r3 ***
26946243-C-A 24800096-C-A P1_r3 ***
26953275-G-A 24807128-G-A P1_r3 ***
26986481-C-T 24840334-C-T P1_r4 ***
26986536-C-T 24840389-C-T P1_r4 ***
26986506-T-C 24840359-T-C P1_r4 ***
26986512-T-C 24840365-T-C P1_r4 ***
26986520-A-C 24840373-A-C P1_r4 ***
26986522-G-A 24840375-G-A P1_r4 ***
26986525-G-C 24840378-G-C P1_r4 ***
26986528-T-A 24840381-T-A P1_r4 ***
26986532-A-G 24840385-A-G P1_r4 ***
27057001-A-T 24910854-A-T P1_r4 ***
27060068-G-T 24913921-G-T P1_r4 ***
26914211-C-A 24768064-C-A P1_r3 ***
27077090-G-T 24930943-G-T P1_r4 ***
27077074-A-T 24930927-A-T P1_r4 ***
27077077-C-T 24930930-C-T P1_r4 ***
27077080-A-T 24930933-A-T P1_r4 ***
27077083-G-T 24930936-G-T P1_r4 ***
27077086-G-T 24930939-G-T P1_r4 ***
27077088-A-T 24930941-A-T P1_r4 ***
27077092-A-T 24930945-A-T P1_r4 ***
27077069-C-T 24930922-C-T P1_r4 ***
27095842-C-A 24949695-C-A P1_r4 ***
27095967-A-T 24949820-A-T P1_r4 ***
27112239-A-G 24966092-A-G P1_r4 ***
27149804-C-T 25003657-C-T P1_g3 ***
27152351-G-T 25006204-G-T P1_g3 ***
27153877-C-A 25007730-C-A P1_g3 ***
27155175-T-C 25009028-T-C P1_g3 ***
27077073-C-T 24930926-C-T P1_r4 ***
27077067-A-T 24930920-A-T P1_r4 ***
27060071-C-T 24913924-C-T P1_r4 ***
27072228-T-A 24926081-T-A P1_r4 ***
27060072-A-T 24913925-A-T P1_r4 ***
27060074-G-T 24913927-G-T P1_r4 ***
27062013-A-T 24915866-A-T P1_r4 ***
27062104-C-T 24915957-C-T P1_r4 ***
27068097-C-T 24921950-C-T P1_r4 ***
27072209-A-T 24926062-A-T P1_r4 ***
27076288-C-A 24930141-C-A P1_r4 ***
27077063-C-T 24930916-C-T P1_r4 ***
27076983-A-T 24930836-A-T P1_r4 ***
27076984-A-T 24930837-A-T P1_r4 ***
27076992-G-A 24930845-G-A P1_r4 ***
27076993-A-G 24930846-A-G P1_r4 ***
27077049-A-T 24930902-A-T P1_r4 ***
27077052-C-T 24930905-C-T P1_r4 ***
27077059-A-T 24930912-A-T P1_r4 ***
26914212-C-T 24768065-C-T P1_r3 ***
26914208-C-T 24768061-C-T P1_r3 ***
25845005-A-G 23698858-A-G P1_b3 ***
26418342-C-A 24272195-C-A P1_Y1 ***
26279901-C-A 24133754-C-A P1_Y1 ***
26283421-C-A 24137274-C-A P1_Y1 ***
26320146-C-A 24173999-C-A P1_Y1 ***
26341611-G-T 24195464-G-T P1_Y1 ***
26397738-C-A 24251591-C-A P1_Y1 ***
26409313-G-T 24263166-G-T P1_Y1 ***
26431111-C-A 24284964-C-A P1_Y1 ***
26277719-A-T 24131572-A-T P1_Y1 ***
26463194-A-T 24317047-A-T P1_Y1 ***
26463196-C-T 24317049-C-T P1_Y1 ***
26463198-C-A 24317051-C-A P1_Y1 ***
26463199-C-T 24317052-C-T P1_Y1 ***
26463205-C-G 24317058-C-G P1_Y1 ***
26463213-A-G 24317066-A-G P1_Y1 ***
26671190-C-A 24525043-C-A P1_g2 ***
26277811-G-A 24131664-G-A P1_Y1 ***
26248017-G-A 24101870-G-A P1_Y1 ***
26873927-G-T 24727780-G-T P1_r3 ***
25987993-G-A 23841846-G-A P1_Y1 ***
25845059-G-A 23698912-G-A P1_b3 ***
25883630-C-T 23737483-C-T P1_Y1 17×T***
25883669-C-T 23737522-C-T P1_Y1 11×T***
25971882-G-A 23825735-G-A P1_Y1 ***
25971898-G-A 23825751-G-A P1_Y1 ***
25971899-G-A 23825752-G-A P1_Y1 ***
25990667-A-G 23844520-A-G P1_Y1 ***
26228797-G-T 24082650-G-T P1_Y1 ***
26029732-A-T 23883585-A-T P1_Y1 ***
26097947-T-A 23951800-T-A P1_Y1 ***
26100746-C-G 23954599-C-G P1_Y1 ***
26100747-A-G 23954600-A-G P1_Y1 ***
26135828-C-A 23989681-C-A P1_Y1 ***
26144677-A-G 23998530-A-G P1_Y1 ***
20084540-T-G 17972660-T-G P5_Dst ***
26810627-G-T 24664480-G-T P1_g2 ***
26874109-A-T 24727962-A-T P1_r3 ***
26914205-G-A 24768058-G-A P1_r3 ***
26914192-C-T 24768045-C-T P1_r3 ***
26914181-A-T 24768034-A-T P1_r3 ***
26914183-C-T 24768036-C-T P1_r3 ***
26914184-C-T 24768037-C-T P1_r3 ***
26914186-C-T 24768039-C-T P1_r3 ***
26914188-A-T 24768041-A-T P1_r3 ***
26914189-C-T 24768042-C-T P1_r3 ***
26914193-C-T 24768046-C-T P1_r3 ***
26914176-A-T 24768029-A-T P1_r3 ***
26914195-A-T 24768048-A-T P1_r3 ***
26914198-C-T 24768051-C-T P1_r3 ***
26914199-T-C 24768052-T-C P1_r3 ***
26914200-C-T 24768053-C-T P1_r3 ***
26914201-A-C 24768054-A-C P1_r3 ***
26914202-A-T 24768055-A-T P1_r3 ***
26914204-C-G 24768057-C-G P1_r3 ***
26914180-C-T 24768033-C-T P1_r3 ***
26914175-C-T 24768028-C-T P1_r3 ***
26874117-A-T 24727970-A-T P1_r3 ***
26900304-T-A 24754157-T-A P1_r3 ***
26884409-G-T 24738262-G-T P1_r3 ***
26900292-T-A 24754145-T-A P1_r3 ***
26900294-C-A 24754147-C-A P1_r3 ***
26900296-G-A 24754149-G-A P1_r3 ***
26900297-T-A 24754150-T-A P1_r3 ***
26900298-C-A 24754151-C-A P1_r3 ***
26900301-G-A 24754154-G-A P1_r3 ***
26900307-T-A 24754160-T-A P1_r3 ***
26914174-T-C 24768027-T-C P1_r3 ***
26902265-T-G 24756118-T-G P1_r3 ***
26912666-G-A 24766519-G-A P1_r3 ***
26913977-G-T 24767830-G-T P1_r3 ***
26913982-A-T 24767835-A-T P1_r3 ***
26914167-T-C 24768020-T-C P1_r3 ***
26914170-T-G 24768023-T-G P1_r3 ***
26914172-G-C 24768025-G-C P1_r3 ***
24677146-C-A 22530999-C-A P3_b2 ***
24675559-C-T 22529412-C-T P3_b2 ***
19187501-C-T 17075621-C-T ***
20500970-T-C 18339084-T-C P5_Dst ***
20442391-G-A 18280505-G-A P5_Dst ***
20479194-T-A 18317308-T-A P5_Dst ***
20479850-T-G 18317964-T-G P5_Dst ***
20497231-A-C 18335345-A-C P5_Dst ***
20497238-T-C 18335352-T-C P5_Dst ***
20497609-G-T 18335723-G-T P5_Dst ***
20507919-G-T 18346033-G-T P5_Dst ***
20428131-G-T 18266245-G-T P5_Dst ***
20530271-T-A 18368385-T-A P5_Dst ***
20530307-T-G 18368421-T-G P5_Dst ***
20530331-C-A 18368445-C-A P5_Dst ***
20534054-C-A 18372168-C-A P5_Dst ***
20593080-G-A 18431194-G-A P5_Dst ***
20602137-T-C 18440251-T-C P5_Dst ***
20602139-T-C 18440253-T-C P5_Dst ***
20428379-A-C 18266493-A-C P5_Dst ***
20427754-G-T 18265868-G-T P5_Dst ***
20602143-T-A 18440257-T-A P5_Dst ***
20252687-C-A 18090801-C-A P5_Dst ***
20200950-C-T 18039064-C-T P5_Dst ***
20230236-G-A 18068350-G-A P5_Dst ***
20243019-G-T 18081133-G-T P5_Dst ***
20243030-G-A 18081144-G-A P5_Dst ***
20243042-T-A 18081156-T-A P5_Dst ***
20247630-A-G 18085744-A-G P5_Dst ***
20256282-T-G 18094396-T-G P5_Dst ***
20420560-C-A 18258674-C-A P5_Dst ***
20284423-C-T 18122537-C-T P5_Dst ***
20312756-G-A 18150870-G-A P5_Dst ***
20318815-A-T 18156929-A-T P5_Dst ***
20325439-C-G 18163553-C-G P5_Dst ***
20362527-T-C 18200641-T-C P5_Dst ***
20379085-G-T 18217199-G-T P5_Dst ***
20394513-G-A 18232627-G-A P5_Dst ***
20602141-T-A 18440255-T-A P5_Dst ***
20645955-A-T 18484069-A-T P4_Prx ***
20200065-A-T 18038179-A-T P5_Dst ***
20993541-G-T 18831655-G-T P4_Dst ***
20932788-A-G 18770902-A-G P4_Dst ***
20937148-G-A 18775262-G-A P4_Dst ***
20951260-C-A 18789374-C-A P4_Dst ***
20959417-G-T 18797531-G-T P4_Dst ***
20982314-A-T 18820428-A-T P4_Dst ***
20990517-G-T 18828631-G-T P4_Dst ***
21014287-G-T 18852401-G-T P4_Dst ***
20915768-C-T 18753882-C-T P4_Dst ***
21030501-G-A 18868615-G-A P4_Dst ***
21084343-A-G 18922457-A-G ***
21148588-T-A 18986702-T-A ***
21261823-C-T 19099937-C-T ***
21306547-T-A 19144661-T-A ***
21306553-G-A 19144667-G-A ***
21306559-G-A 19144673-G-A ***
20920234-C-A 18758348-C-A P4_Dst ***
20915296-T-C 18753410-T-C P4_Dst ***
20716960-G-A 18555074-G-A P4_Prx ***
20756508-C-T 18594622-C-T P4_Prx ***
20716969-G-A 18555083-G-A P4_Prx ***
20716972-G-A 18555086-G-A P4_Prx ***
20717032-T-A 18555146-T-A P4_Prx ***
20717036-T-A 18555150-T-A P4_Prx ***
20722328-G-T 18560442-G-T P4_Prx ***
20751238-G-T 18589352-G-T P4_Prx ***
20849687-G-T 18687801-G-T P4_Dst ***
20894476-A-G 18732590-A-G P4_Dst ***
20853417-G-T 18691531-G-T P4_Dst ***
20867232-T-A 18705346-T-A P4_Dst ***
20870790-T-G 18708904-T-G P4_Dst ***
20870919-T-G 18709033-T-G P4_Dst ***
20872395-C-T 18710509-C-T P4_Dst ***
20886851-C-G 18724965-C-G P4_Dst ***
20886864-A-T 18724978-A-T P4_Dst ***
20200111-T-C 18038225-T-C P5_Dst ***
20199868-T-A 18037982-T-A P5_Dst ***
21306569-C-A 19144683-C-A ***
19668716-T-A 17556836-T-A P5_Prx ***
19359835-A-G 17247955-A-G ***
19359837-A-G 17247957-A-G ***
19359838-C-T 17247958-C-T ***
19359839-A-G 17247959-A-G ***
19668709-C-A 17556829-C-A P5_Prx ***
19668712-G-A 17556832-G-A P5_Prx ***
19668751-C-A 17556871-C-A P5_Prx ***
19359830-C-T 17247950-C-T ***
19668761-C-A 17556881-C-A P5_Prx ***
19678542-G-T 17566662-G-T P5_Prx ***
19681958-T-G 17570078-T-G P5_Prx ***
19682119-T-A 17570239-T-A P5_Prx ***
19700766-A-G 17588886-A-G P5_Prx ***
19711943-A-G 17600063-A-G P5_Prx ***
19727366-T-C 17615486-T-C P5_Prx ***
19359831-A-G 17247951-A-G ***
19359826-C-T 17247946-C-T ***
19754426-T-C 17642546-T-C P5_Prx ***
19189474-G-C 17077594-G-C ***
19187502-G-T 17075622-G-T ***
19187506-A-C 17075626-A-C ***
19187507-G-C 17075627-G-C ***
19187508-G-C 17075628-G-C ***
19189467-A-G 17077587-A-G ***
19189473-A-C 17077593-A-C ***
19189475-T-C 17077595-T-C ***
19359824-C-T 17247944-C-T ***
19189553-T-A 17077673-T-A ***
19189555-C-T 17077675-C-T ***
19206713-T-G 17094833-T-G ***
19231377-A-G 17119497-A-G ***
19333357-C-A 17221477-C-A ***
19359822-C-T 17247942-C-T ***
19359823-A-G 17247943-A-G ***
19743705-T-A 17631825-T-A P5_Prx ***
19765957-A-T 17654077-A-T P5_Prx ***
20197415-A-G 18035529-A-G P5_Dst ***
20130747-T-A 18018867-T-A P5_Dst ***
20089232-C-T 17977352-C-T P5_Dst ***
20089241-G-T 17977361-G-T P5_Dst ***
20089283-G-A 17977403-G-A P5_Dst ***
20097549-T-A 17985669-T-A P5_Dst ***
20105783-T-A 17993903-T-A P5_Dst ***
20112840-G-T 18000960-G-T P5_Dst ***
20137961-G-A 18026081-G-A P5_Dst ***
20084550-T-C 17972670-T-C P5_Dst ***
20142085-C-A 18030205-C-A P5_Dst ***
20142098-G-C 18030218-G-C P5_Dst ***
20194525-G-T 18032639-G-T P5_Dst ***
20194872-A-G 18032986-A-G P5_Dst ***
20196237-A-G 18034351-A-G P5_Dst ***
20197311-G-T 18035425-G-T P5_Dst ***
20197355-A-G 18035469-A-G P5_Dst ***
20087732-T-A 17975852-T-A P5_Dst ***
20084547-C-T 17972667-C-T P5_Dst ***
19817452-G-T 17705572-G-T P5_Prx ***
19977128-C-A 17865248-C-A P5_Prx ***
19817453-G-T 17705573-G-T P5_Prx ***
19829283-A-T 17717403-A-T P5_Prx ***
19867373-C-A 17755493-C-A P5_Prx ***
19892926-G-C 17781046-G-C P5_Prx ***
19910367-C-A 17798487-C-A P5_Prx ***
19926017-G-A 17814137-G-A P5_Prx ***
19926077-G-T 17814197-G-T P5_Prx ***
19998816-T-C 17886936-T-C P5_Prx ***
20084541-C-T 17972661-C-T P5_Dst ***
20019177-G-T 17907297-G-T P5_Prx ***
20036241-T-G 17924361-T-G P5_Prx ***
20039526-C-A 17927646-C-A P5_Prx ***
20078779-T-G 17966899-T-G P5_Dst ***
20082705-T-C 17970825-T-C P5_Dst ***
20084533-G-T 17972653-G-T P5_Dst ***
20084534-G-T 17972654-G-T P5_Dst ***
21306562-T-A 19144676-T-A ***
21306571-G-A 19144685-G-A ***
24671362-T-C 22525215-T-C P3_b2 ***
24235299-A-T 22089152-A-T P3_b1 ***
24161555-C-A 22015408-C-A P3_b1 ***
24192065-T-A 22045918-T-A P3_b1 ***
24192260-G-A 22046113-G-A P3_b1 ***
24233717-C-A 22087570-C-A P3_b1 ***
24235288-T-G 22089141-T-G P3_b1 ***
24235290-G-T 22089143-G-T P3_b1 ***
24235300-A-C 22089153-A-C P3_b1 ***
24069668-G-A 21923521-G-A P3_b1 ***
24235302-A-T 22089155-A-T P3_b1 ***
24235303-A-T 22089156-A-T P3_b1 ***
24235304-A-T 22089157-A-T P3_b1 ***
24235315-C-A 22089168-C-A P3_b1 ***
24235322-G-A 22089175-G-A P3_b1 ***
24235325-C-A 22089178-C-A P3_b1 ***
24235331-G-A 22089184-G-A P3_b1 ***
24104898-G-T 21958751-G-T P3_b1 ***
24069664-C-A 21923517-C-A P3_b1 ***
24235338-G-A 22089191-G-A P3_b1 ***
24030803-T-A 21884656-T-A ***
23862627-C-A 21700741-C-A ***
23888988-C-A 21727102-C-A ***
24017363-C-A 21871216-C-A ***
24025019-T-G 21878872-T-G ***
24027369-C-A 21881222-C-A ***
24027646-A-G 21881499-A-G ***
24034817-C-A 21888670-C-A ***
24069663-T-A 21923516-T-A P3_b1 ***
24036272-A-G 21890125-A-G ***
24042692-A-T 21896545-A-T ***
24042752-C-T 21896605-C-T ***
24043267-T-C 21897120-T-C ***
24043551-A-G 21897404-A-G ***
24043821-G-A 21897674-G-A ***
24045534-G-T 21899387-G-T ***
24235336-G-A 22089189-G-A P3_b1 ***
24235342-G-A 22089195-G-A P3_b1 ***
23831311-A-T 21669425-A-T ***
24643206-A-T 22497059-A-T P3_t2 ***
24582507-T-C 22436360-T-C P3_t2 ***
24582513-T-A 22436366-T-A P3_t2 ***
24597883-A-G 22451736-A-G P3_t2 ***
24614213-T-A 22468066-T-A P3_t2 ***
24614214-G-A 22468067-G-A P3_t2 ***
24637332-G-T 22491185-G-T P3_t2 ***
24646511-C-T 22500364-C-T P3_b2 ***
24582459-C-A 22436312-C-A P3_t2 ***
24646514-C-G 22500367-C-G P3_b2 ***
24650358-A-T 22504211-A-T P3_b2 ***
24654545-T-G 22508398-T-G P3_b2 ***
24658533-C-A 22512386-C-A P3_b2 ***
24662316-G-T 22516169-G-T P3_b2 ***
24662327-A-T 22516180-A-T P3_b2 ***
24671340-T-A 22525193-T-A P3_b2 ***
24582496-T-A 22436349-T-A P3_t2 ***
24582443-C-T 22436296-C-T P3_t2 ***
24235348-C-A 22089201-C-A P3_b1 ***
24240655-G-T 22094508-G-T P3_b1 ***
24235368-C-A 22089221-C-A P3_b1 ***
24235372-G-A 22089225-G-A P3_b1 ***
24235493-T-A 22089346-T-A P3_b1 ***
24235503-T-A 22089356-T-A P3_b1 ***
24239964-C-A 22093817-C-A P3_b1 ***
24240578-T-G 22094431-T-G P3_b1 ***
24240641-G-T 22094494-G-T P3_b1 ***
24276005-C-A 22129858-C-A P3_b1 ***
24582433-C-T 22436286-C-T P3_t2 ***
24277959-G-T 22131812-G-T P3_b1 ***
24304614-C-A 22158467-C-A P3_t1 ***
24536673-T-G 22390526-T-G P3_t2 ***
24544316-G-T 22398169-G-T P3_t2 ***
24545418-T-A 22399271-T-A P3_t2 ***
24549598-T-C 22403451-T-C P3_t2 ***
24554491-A-G 22408344-A-G P3_t2 ***
23862618-C-A 21700732-C-A ***
23693642-T-C 21531756-T-C ***
21402218-T-A 19240332-T-A ***
22023276-T-C 19861390-T-C ***
21714738-G-A 19552852-G-A ***
21714740-C-A 19552854-C-A ***
21714746-C-A 19552860-C-A ***
21853654-G-A 19691768-G-A ***
21853676-T-A 19691790-T-A ***
22023265-G-C 19861379-G-C ***
22023278-A-T 19861392-A-T ***
21714722-C-A 19552836-C-A ***
22223285-C-T 20061399-C-T DYZ19 ***
22247187-T-C 20085301-T-C DYZ19 ***
22261635-G-A 20099749-G-A DYZ19 ***
22262326-G-T 20100440-G-T DYZ19 ***
22290881-T-C 20128995-T-C DYZ19 ***
22290889-G-C 20129003-G-C DYZ19 ***
22290894-A-T 20129008-A-T DYZ19 ***
21714728-G-A 19552842-G-A ***
21714721-C-G 19552835-C-G ***
22319044-T-A 20157158-T-A DYZ19 ***
21515810-C-T 19353924-C-T ***
21515798-G-A 19353912-G-A ***
21515800-T-G 19353914-T-G ***
21515804-A-T 19353918-A-T ***
21515805-G-A 19353919-G-A ***
21515806-T-G 19353920-T-G ***
21515809-G-C 19353923-G-C ***
21515813-A-G 19353927-A-G ***
21515825-T-G 19353939-T-G ***
21515814-G-T 19353928-G-T ***
21515815-A-C 19353929-A-C ***
21515816-T-A 19353930-T-A ***
21515817-C-A 19353931-C-A ***
21515819-C-G 19353933-C-G ***
21515822-C-A 19353936-C-A ***
21515824-C-G 19353938-C-G ***
22307303-T-G 20145417-T-G DYZ19 ***
22319045-T-C 20157159-T-C DYZ19 ***
23588517-C-A 21426631-C-A ***
22739657-C-A 20577771-C-A ***
22431187-A-T 20269301-A-T DYZ19 ***
22447615-G-T 20285729-G-T DYZ19 ***
22481392-C-G 20319506-C-G DYZ19 ***
22485097-C-T 20323211-C-T DYZ19 ***
22485115-G-A 20323229-G-A DYZ19 ***
22703568-C-T 20541682-C-T ***
22816184-C-A 20654298-C-A ***
22358177-G-C 20196291-G-C DYZ19 ***
23098809-T-A 20936923-T-A ***
23311272-C-T 21149386-C-T 15×T***
23391621-A-C 21229735-A-C ***
23391622-C-T 21229736-C-T ***
23391623-T-G 21229737-T-G ***
23412586-C-A 21250700-C-A ***
23435736-A-G 21273850-A-G ***
22367824-G-T 20205938-G-T DYZ19 ***
22358162-T-C 20196276-T-C DYZ19 ***
22319046-A-C 20157160-A-C DYZ19 ***
22319060-C-A 20157174-C-A DYZ19 ***
22319049-G-T 20157163-G-T DYZ19 ***
22319050-G-A 20157164-G-A DYZ19 ***
22319051-T-A 20157165-T-A DYZ19 ***
22319053-A-T 20157167-A-T DYZ19 ***
22319055-T-C 20157169-T-C DYZ19 ***
22319056-G-T 20157170-G-T DYZ19 ***
22319057-T-G 20157171-T-G DYZ19 ***
22319061-A-C 20157175-A-C DYZ19 ***
22358161-G-T 20196275-G-T DYZ19 ***
22319062-G-A 20157176-G-A DYZ19 ***
22319064-A-T 20157178-A-T DYZ19 ***
22334796-G-T 20172910-G-T DYZ19 ***
22336980-C-A 20175094-C-A DYZ19 ***
22344911-A-G 20183025-A-G DYZ19 ***
22358056-T-G 20196170-T-G DYZ19 ***
22358057-T-A 20196171-T-A DYZ19 ***
13027-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Bond1224151011-14121213131329169-1010112515192914-15-15-15111119-231615181636-36121211915-1681010810101223-231610121215814222114121113111112123415916132526191311131211912121011113012122113101020152013241812162412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1701911008801872079357257607
Kit: 170191892477772959777238844
Used in age calculations1008801872959777257607
Counts of SNPs32
Variant counts last updated 2018-01-24 23:36:09.



Big Tree Main Page