Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > S16264 > L679

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POSITION-REF-ALT (hg19) Blocks Names Region McDonald BED combBED STRFTDNA
170191
FGC-BigY
ZR733
YFull-BigY
YF03599
24402932-A-GFGC36620**+
8068096-C-TF110 M11115YY++
23239730-C-TFGC36619Y++
18905662-T-GFGC36618YY*
21428501-C-A**
13140418-C-A**
58988696-G-T**
3389692-C-A**
19201629-C-A**
19201455-C-A**
58993078-G-T**
18953003-AAAAG-A4×AAAG**
18242801-C-A**
18455377-G-GAP6_Dst9×A**
14807370-T-C**
17950825-A-AAT27×AT**
13588614-C-A**
9607152-GC-GIR3_Prx**
7144726-G-A**
21793667-G-T**
7387418-TG-T**
27418151-C-AP1_g3**
16833438-C-A**
28783379-C-A**
10081981-G-C**
10081929-C-A**
10081913-G-C**
27418206-CA-CP1_g3**
25201018-GAAAGAAAGA-Gg1**
13588596-T-C**
21297968-C-A**
15864016-G-T**
24626401-C-AP3_t2**
15912133-C-A**
2790342-C-A**
21104847-C-A**
15985493-A-C**
20872177-G-AP4_Dst**
19461345-C-A**
17491636-C-A**
15725840-C-A**
59001115-G-A**
17233544-C-A**
15700362-C-A**
27151514-GCCTACAA-GP1_g3**
24450436-T-C**
8482128-C-A**
21383579-C-A**
25256413-G-GATP2_r121×AT**
21489147-T-C**
27316356-GT-GP1_g3**
9607099-C-AIR3_Prx**
5635286-C-A**
18439210-T-CP6_Dst**
14292801-G-T**
9994337-C-A**
16516115-C-A**
23145878-C-A**
58978681-G-A**
7255504-C-A**
16284196-C-A**
13857210-C-A**
28731896-T-C**
23412623-C-A**
6992391-C-A**
14187934-C-A**
22358154-G-ADYZ19**
22358134-G-CDYZ19**
27239670-CCT-CP1_g3**
23350475-T-C**
22358088-T-CDYZ19**
6869549-A-G**
28087250-A-CP1_Y2**
27868049-A-GP1_Y2**
13850084-T-A**
23996883-C-A**
13850078-A-G**
13850087-A-T**
8261193-AAT-A**
13850099-A-G**
22125236-C-A**
22170921-C-T**
13850101-T-C**
27151457-G-TP1_g3**
7873040-G-T**
22358092-C-TDYZ19**
22611370-C-A**
7733397-C-A**
14470599-C-A**
27076993-A-GP1_r4***
26986537-T-AP1_r4***
27076983-A-TP1_r4***
27077049-A-TP1_r4***
26991255-T-AP1_r4***
26986536-C-TP1_r4***
27076992-G-AP1_r4***
26991243-T-AP1_r4***
26986547-A-CP1_r4***
27076984-A-TP1_r4***
26986553-C-TP1_r4***
26986542-T-AP1_r4***
26986551-A-TP1_r4***
26986532-A-GP1_r4***
27060071-C-TP1_r4***
27072228-T-AP1_r4***
26991275-T-AP1_r4***
27035452-G-TP1_r4***
27060066-C-TP1_r4***
27060072-A-TP1_r4***
27057001-A-TP1_r4***
27060074-G-TP1_r4***
27056942-A-GP1_r4***
27062013-A-TP1_r4***
27046801-A-GP1_r4***
27062104-C-TP1_r4***
27035456-G-AP1_r4***
27033033-C-AP1_r4***
26991286-G-AP1_r4***
27016031-G-AP1_r4***
27068097-C-TP1_r4***
27072209-A-TP1_r4***
27004356-C-AP1_r4***
27060068-G-TP1_r4***
27001804-A-TP1_r4***
27076288-C-AP1_r4***
26993038-G-TP1_r4***
26991367-G-AP1_r4***
26991289-T-AP1_r4***
26986528-T-AP1_r4***
20084540-T-GP5_Dst***
26986525-G-CP1_r4***
26900292-T-AP1_r3***
26914172-G-CP1_r3***
26914170-T-GP1_r3***
26914167-T-CP1_r3***
26913982-A-TP1_r3***
26913977-G-TP1_r3***
26912666-G-AP1_r3***
26902265-T-GP1_r3***
26900307-T-AP1_r3***
26900304-T-AP1_r3***
26900301-G-AP1_r3***
26900298-C-AP1_r3***
26900297-T-AP1_r3***
26900296-G-AP1_r3***
26900294-C-AP1_r3***
26884409-G-TP1_r3***
26914175-C-TP1_r3***
26874117-A-TP1_r3***
26874109-A-TP1_r3***
26873927-G-TP1_r3***
26810627-G-TP1_g2***
26671190-C-AP1_g2***
26463213-A-GP1_Y1***
26463205-C-GP1_Y1***
26463199-C-TP1_Y1***
26463198-C-AP1_Y1***
26463196-C-TP1_Y1***
26463194-A-TP1_Y1***
26431111-C-AP1_Y1***
26418342-C-AP1_Y1***
26409313-G-TP1_Y1***
26914174-T-CP1_r3***
26914176-A-TP1_r3***
26986522-G-AP1_r4***
26914205-G-AP1_r3***
26986520-A-CP1_r4***
26986512-T-CP1_r4***
26986506-T-CP1_r4***
26986481-C-TP1_r4***
26953277-G-AP1_r3***
26953275-G-AP1_r3***
26946243-C-AP1_r3***
26946233-G-AP1_r3***
26946232-G-AP1_r3***
26921303-C-AP1_r3***
26914215-C-GP1_r3***
26914212-C-TP1_r3***
26914211-C-AP1_r3***
26914208-C-TP1_r3***
26914204-C-GP1_r3***
26914180-C-TP1_r3***
26914202-A-TP1_r3***
26914201-A-CP1_r3***
26914200-C-TP1_r3***
26914199-T-CP1_r3***
26914198-C-TP1_r3***
26914195-A-TP1_r3***
26914193-C-TP1_r3***
26914192-C-TP1_r3***
26914189-C-TP1_r3***
26914188-A-TP1_r3***
26914186-C-TP1_r3***
26914184-C-TP1_r3***
26914183-C-TP1_r3***
26914181-A-TP1_r3***
27077052-C-TP1_r4***
27173542-A-TP1_g3***
27077059-A-TP1_r4***
27791844-T-CP1_Y2***
27819879-T-CP1_Y2***
27819705-A-CP1_Y2***
27810370-A-GP1_Y2***
27810366-A-GP1_Y2***
27810364-G-AP1_Y2***
27810363-A-GP1_Y2***
27810362-A-GP1_Y2***
27810360-G-AP1_Y2***
27810356-G-AP1_Y2***
27809442-T-CP1_Y2***
27793192-C-AP1_Y2***
27792018-A-CP1_Y2***
27792016-A-TP1_Y2***
27786902-G-TP1_Y2***
27821621-G-AP1_Y2***
27785853-C-AP1_Y2***
27785716-C-AP1_Y2***
27711613-G-TP1_Y2***
27686149-C-AP1_Y2***
27644323-A-GP1_Y2***
27644320-C-GP1_Y2***
27637260-G-TP1_Y2***
27585908-A-TP1_Y2***
27585907-C-TP1_Y2***
27585902-C-TP1_Y2***
27585901-G-TP1_Y2***
27585887-A-TP1_Y2***
27582965-C-TP1_Y2***
27582961-C-AP1_Y2***
27821618-G-AP1_Y2***
27821647-C-AP1_Y2***
27582956-A-TP1_Y2***
27960994-G-TP1_Y2***
28117200-C-TP1_b4***
28117196-G-TP1_b4***
28095676-G-TP1_Y2***
28078293-G-TP1_Y2***
28045740-C-AP1_Y2***
28043465-G-TP1_Y2***
28015135-C-AP1_Y2***
27996179-G-TP1_Y2***
27978542-A-TP1_Y2***
27971727-A-CP1_Y2***
27971680-C-AP1_Y2***
27971678-T-AP1_Y2***
27968128-C-AP1_Y2***
27962620-C-AP1_Y2***
27960955-C-AP1_Y2***
27821655-A-TP1_Y2***
27883134-G-TP1_Y2***
27873413-A-TP1_Y2***
27864409-T-GP1_Y2***
27861765-C-AP1_Y2***
27861763-C-AP1_Y2***
27861761-G-TP1_Y2***
27861760-G-AP1_Y2***
27849529-G-TP1_Y2***
27844539-A-TP1_Y227×T***
27829138-T-AP1_Y2***
27829116-T-GP1_Y2***
27821688-T-GP1_Y2***
27821663-T-AP1_Y2***
27821659-G-TP1_Y2***
27582957-T-AP1_Y2***
27582950-A-TP1_Y2***
27077063-C-TP1_r4***
27152351-G-TP1_g3***
27256350-G-TP1_g3***
27253583-G-AP1_g3***
27248618-T-CP1_g3***
27248599-G-TP1_g3***
27235863-A-GP1_g3***
27190371-G-AP1_g3***
27190326-G-TP1_g3***
27186374-T-AP1_g3***
27186372-C-AP1_g3***
27179602-G-AP1_g3***
27161900-T-CP1_g3***
27160574-A-GP1_g3***
27155175-T-CP1_g3***
27153877-C-AP1_g3***
27149804-C-TP1_g3***
27273083-G-TP1_g3***
27112239-A-GP1_r4***
27095967-A-TP1_r4***
27095842-C-AP1_r4***
27077092-A-TP1_r4***
27077090-G-TP1_r4***
27077088-A-TP1_r4***
27077086-G-TP1_r4***
27077083-G-TP1_r4***
27077080-A-TP1_r4***
27077077-C-TP1_r4***
27077074-A-TP1_r4***
27077073-C-TP1_r4***
27077069-C-TP1_r4***
27077067-A-TP1_r4***
27263859-T-AP1_g3***
27277091-G-TP1_g3***
27582948-A-TP1_Y2***
27419620-T-AP1_g3***
27582946-A-TP1_Y2***
27582945-C-TP1_Y2***
27582943-A-TP1_Y2***
27582942-G-TP1_Y2***
27582940-A-TP1_Y2***
27582939-C-TP1_Y2***
27582937-G-TP1_Y2***
27582935-A-TP1_Y2***
27534257-A-CP1_Y2***
27499250-T-AP1_Y2***
27434854-G-AP1_g3***
27427449-A-GP1_g3***
27425654-C-TP1_g3***
27421698-G-AP1_g3***
27415889-A-GP1_g3***
27305957-A-CP1_g3***
27399219-G-AP1_g3***
27397085-C-AP1_g3***
27389623-G-TP1_g3***
27376547-G-AP1_g3***
27375745-G-TP1_g3***
27373452-G-TP1_g3***
27368678-G-TP1_g3***
27357533-G-TP1_g3***
27337438-G-TP1_g3***
27320074-A-TP1_g3***
27318959-A-GP1_g3***
27316296-G-TP1_g3***
27313049-G-TP1_g3***
27306088-T-CP1_g3***
26397738-C-AP1_Y1***
25883669-C-TP1_Y111×T***
26341611-G-TP1_Y1***
24582496-T-AP3_t2***
24662327-A-TP3_b2***
24662316-G-TP3_b2***
24658533-C-AP3_b2***
24654545-T-GP3_b2***
24650358-A-TP3_b2***
24646514-C-GP3_b2***
24646511-C-TP3_b2***
24637332-G-TP3_t2***
24614217-G-AP3_t2***
24614214-G-AP3_t2***
24614213-T-AP3_t2***
24597883-A-GP3_t2***
24582513-T-AP3_t2***
24582507-T-CP3_t2***
24582459-C-AP3_t2***
24671362-T-CP3_b2***
24450441-C-A***
24276005-C-AP3_b1***
24277959-G-TP3_b1***
24304614-C-AP3_t1***
24404860-G-T***
24421959-C-A***
24424134-A-C***
24536673-T-GP3_t2***
24582443-C-TP3_t2***
24544316-G-TP3_t2***
24545418-T-AP3_t2***
24549598-T-CP3_t2***
24553601-G-CP3_t2***
24554491-A-GP3_t2***
24582433-C-TP3_t2***
24671340-T-AP3_b2***
24675559-C-TP3_b2***
24240641-G-TP3_b1***
24789887-G-AP3_b2***
24774813-G-TP3_b2***
24775451-C-AP3_b2***
24783211-C-AP3_b2***
24783919-C-AP3_b2***
24785248-C-TP3_b2***
24789868-G-AP3_b29×A***
24792997-G-AP3_b2***
24768531-A-TP3_b2***
24804031-C-TP3_b2***
24804789-C-AP3_b2***
24804989-G-TP3_b2***
24805089-C-AP3_b2***
24830382-T-AP3_b2***
24841095-T-GP3_b2***
24773074-C-AP3_b2***
24760548-T-CP3_b2***
24676224-T-AP3_b2***
24691941-G-TP3_b2***
24677146-C-AP3_b2***
24681586-A-CP3_b2***
24681670-A-CP3_b2***
24681699-A-CP3_b2***
24683148-A-GP3_b2***
24683155-T-CP3_b2***
24714945-G-TP3_b2***
24760535-C-AP3_b2***
24728524-A-GP3_b2***
24728627-A-TP3_b2***
24735589-T-AP3_b2***
24741927-A-GP3_b2***
24742345-C-AP3_b2***
24759977-C-GP3_b2***
24240655-G-TP3_b1***
24240578-T-GP3_b1***
24849275-T-AP3_b2***
23831331-A-G***
23588517-C-A***
23599998-C-T***
23693642-T-C***
23801720-T-A***
23807176-T-C***
23831311-A-T***
23862618-C-A***
23447037-G-T***
23862627-C-A***
23888988-C-A***
24017363-C-A***
24025019-T-G***
24027369-C-A***
24027646-A-G***
23475543-G-T***
23435736-A-G***
24034817-C-A***
23054445-G-T***
22810272-C-A***
22816184-C-A***
22842923-C-A***
22953182-C-T***
23005345-C-A***
23013835-C-T***
23098798-C-A***
23412586-C-A***
23098809-T-A***
23098810-C-T***
23311272-C-T15×T***
23391621-A-C***
23391622-C-T***
23391623-T-G***
24030803-T-A***
24036272-A-G***
24239964-C-AP3_b1***
24235336-G-AP3_b1***
24235303-A-TP3_b1***
24235304-A-TP3_b1***
24235315-C-AP3_b1***
24235322-G-AP3_b1***
24235325-C-AP3_b1***
24235331-G-AP3_b1***
24235338-G-AP3_b1***
24235300-A-CP3_b1***
24235342-G-AP3_b1***
24235348-C-AP3_b1***
24235368-C-AP3_b1***
24235372-G-AP3_b1***
24235493-T-AP3_b1***
24235503-T-AP3_b1***
24235302-A-TP3_b1***
24235299-A-TP3_b1***
24042692-A-T***
24069664-C-AP3_b1***
24042752-C-T***
24043267-T-C***
24043551-A-G***
24043821-G-A***
24045534-G-T***
24069663-T-AP3_b1***
24069668-G-AP3_b1***
24235290-G-TP3_b1***
24104898-G-TP3_b1***
24161555-C-AP3_b1***
24192065-T-AP3_b1***
24192260-G-AP3_b1***
24233717-C-AP3_b1***
24235288-T-GP3_b1***
24847505-G-AP3_b2***
24859158-T-GP3_b2***
26320146-C-AP1_Y1***
25670888-C-AP1_b3***
25657367-C-AP1_b3***
25658041-G-TP1_b3***
25658049-A-TP1_b3***
25658050-C-TP1_b3***
25658052-C-TP1_b3***
25658058-C-TP1_b3***
25709290-C-TP1_b3***
25652525-A-GP1_b3***
25709314-A-TP1_b3***
25709363-G-TP1_b3***
25709374-C-TP1_b3***
25709382-C-TP1_b3***
25717346-T-AP1_b3***
25717349-A-TP1_b3***
25656165-G-TP1_b3***
25652499-T-AP1_b3***
25717503-T-AP1_b3***
25524828-T-CP1_gr1***
25524797-T-CP1_gr1***
25524802-G-AP1_gr1***
25524809-T-CP1_gr1***
25524810-G-CP1_gr1***
25524819-G-TP1_gr1***
25524825-G-CP1_gr1***
25524831-T-AP1_gr1***
25626874-T-AP1_b3***
25524832-G-TP1_gr1***
25524833-A-TP1_gr1***
25524843-A-TP1_gr1***
25524847-C-TP1_gr1***
25555829-C-AP1_gr1***
25575328-C-AP1_gr1***
25717387-G-AP1_b3***
25717533-T-CP1_b3***
25524793-G-CP1_gr1***
26144677-A-GP1_Y1***
25990667-A-GP1_Y1***
26029732-A-TP1_Y1***
26097947-T-AP1_Y1***
26100746-C-GP1_Y1***
26100747-A-GP1_Y1***
26135828-C-AP1_Y1***
26149755-A-GP1_Y1***
25971899-G-AP1_Y1***
26228797-G-TP1_Y1***
26248017-G-AP1_Y1***
26277719-A-TP1_Y1***
26277811-G-AP1_Y1***
26279901-C-AP1_Y1***
26283421-C-AP1_Y1***
25987993-G-AP1_Y1***
25971898-G-AP1_Y1***
25719936-G-AP1_b3***
25804982-C-AP1_b3***
25762973-T-CP1_b3***
25766507-A-GP1_b3***
25766639-A-CP1_b3***
25780960-G-TP1_b3***
25791870-G-TP1_b3***
25804981-A-CP1_b3***
25804986-G-TP1_b3***
25971882-G-AP1_Y1***
25831891-A-TP1_b3***
25831973-G-TP1_b3***
25845005-A-GP1_b3***
25845059-G-AP1_b3***
25883630-C-TP1_Y117×T***
28117217-C-TP1_b4***
25524794-G-CP1_gr1***
25524791-T-CP1_gr1***
24859162-C-AP3_b2***
25232802-G-TP2_r1***
25231936-T-GP2_r1***
25231937-T-GP2_r1***
25232771-C-TP2_r1***
25232783-A-CP2_r1***
25232790-T-CP2_r1***
25232792-T-CP2_r1***
25232809-C-TP2_r1***
25207626-A-CP2_r1***
25246492-A-TP2_r1***
25253452-G-TP2_r1***
25270233-C-AP2_r1***
25327662-T-AP2_r1***
25327934-G-AP2_r1***
25327947-G-AP2_r1***
25225284-T-AP2_r1***
25176967-A-Tg1***
25333944-A-TP2_r1***
24898661-A-Cg1***
24859795-T-AP3_b2***
24864679-G-TP3_b2***
24895738-A-Tg1***
24895744-A-Tg1***
24895745-G-Tg1***
24895774-A-Gg1***
25146697-C-Ag1***
25176962-A-Gg1***
25176894-G-Cg1***
25176902-G-Cg1***
25176913-A-Gg1***
25176925-C-Tg1***
25176933-G-Cg1***
25176952-T-Cg1***
25333856-C-TP2_r132×T***
25364374-T-CP2_r2***
25524785-G-CP1_gr1***
25500157-T-GP2_r2***
25466471-G-CP2_r2***
25466485-T-AP2_r2***
25466495-C-AP2_r2***
25466500-T-AP2_r2***
25471048-G-TP2_r2***
25492215-C-AP2_r2***
25502017-C-AP1_gr1***
25461557-T-AP2_r2***
25511923-C-AP1_gr1***
25524747-A-CP1_gr1***
25524772-A-TP1_gr1***
25524777-A-CP1_gr1***
25524780-T-CP1_gr1***
25524782-A-CP1_gr1***
25461588-A-TP2_r2***
25461553-C-AP2_r2***
25366651-T-CP2_r2***
25427009-A-GP2_r2***
25366662-C-AP2_r2***
25370510-G-TP2_r2***
25385232-T-AP2_r2***
25385373-C-TP2_r2***
25388683-T-AP2_r2***
25425520-T-CP2_r2***
25429116-C-AP2_r2***
25454092-A-CP2_r2***
25431645-C-AP2_r2***
25437892-C-AP2_r2***
25446361-G-TP2_r2***
25446440-C-TP2_r221×T***
25453324-C-GP2_r2***
25454057-T-AP2_r2***
28117207-A-TP1_b4***
28253470-T-AP1_b4***
28117222-C-TP1_b4***
21477860-A-AAAGC***
23519572-TA-T***
23435202-C-TTT***
23196627-TAAAA-T17×A***
22481607-TT-CGDYZ19***
22358161-GT-TCDYZ19***
22358088-TTACC-CTACTDYZ19***
22353065-AATAAT-CCGACCDYZ19***
22293412-CCTTA-GCTCDYZ19***
22256886-ATTTACG-TTTGTTCDYZ19***
22244982-GTTATATCCAGAGT-CTGCAGCATCATTCDYZ19***
22236252-GACC-CACADYZ19***
22113187-CAAAAAAA-C23×A***
22023684-GTTTT-G17×T***
21853659-GACGACAGAG-AACAACAAAA***
21477840-A-AAAGT***
24017408-G-GT12×T***
20975335-G-GAP4_Dst***
20868952-TA-TP4_Dst12×A***
20871048-CT-CP4_Dst8×T***
20875153-C-CTP4_Dst10×T***
20888588-TAA-TP4_Dst15×A***
20894542-GA-GP4_Dst***
20966227-GAA-GP4_Dst11×A***
20993598-CAA-CP4_Dst17×A***
21477816-A-AAAGG***
21003227-G-GTTTP4_Dst14×T***
21008974-GTTTTTA-GP4_Dst***
21008982-TAC-TP4_Dst***
21008990-TCA-TP4_Dst***
21251809-T-TA***
21402181-CTTT-C34×T***
24015843-CTCTTCT-C5×TCT***
24027722-TCA-T***
20717038-TC-AAP4_Prx***
24750181-GT-GP3_b2***
24665751-TA-TP3_b2***
24667645-CT-CP3_b2***
24671142-C-CAP3_b214×A***
24685101-GTTTTTTTATATATGTATATATTTGTATA-GP3_b2***
24735797-C-CTP3_b28×T***
24739651-CTT-CP3_b213×T***
24754582-C-AAP3_b2***
24660489-GCCTTACT-GP3_b2***
24759302-AT-AP3_b29×T***
24779006-CGGA-GGGGP3_b2***
24779904-AC-AP3_b2***
24785337-CCT-CP3_b2***
24792898-AGAGTCCTTGCGGG-AP3_b2***
24793957-CTGGGG-CP3_b2***
24662318-CTAA-TTATP3_b2***
24654094-TTG-TP3_b2***
24028762-C-TGAGTTAAT***
24577878-CAA-CP3_t225×A***
24032362-G-GA***
24033727-ATTT-A***
24052805-C-CTP3_b110×T***
24542285-CA-CP3_t28×A***
24545449-T-TCP3_t2***
24552391-C-CTP3_t2***
24587333-A-ATP3_t29×T***
24643210-CTTCTA-TTTTTTP3_t2***
24597813-CT-CP3_t222×T***
24601759-GT-GP3_t211×T***
24607321-CTTTT-CP3_t212×T***
24626441-AT-AP3_t210×T***
24638020-C-CAP3_t210×A***
24641828-A-ATP3_t2***
20850693-G-GTAP4_Dst12×TA***
20602145-CTTTTTATGGC-ACTATAAATTAP5_Dst***
24803075-CTCCA-CP3_b2***
19682387-GAAA-GP5_Prx***
18926872-CAA-C17×A***
19113723-TAAA-T28×A***
19124920-CTTTT-C15×T***
19359822-CACACATACATATATACA-TGTATATATGTATGTGTG***
19359857-TA-GTATTGTG***
19647571-CTTT-CP5_Prx16×T***
19739799-G-GAP5_Prx16×A***
18487171-A-ATP6_Dst***
19745475-CTT-CP5_Prx18×T***
19765959-GCCCACCA-CCCCCCCCP5_Prx***
19925893-T-TAP5_Prx13×A***
19987682-GT-GP5_Prx15×T***
20045224-AAAAAAAAAAAAAAA-GAACAAGACCCTGTCP5_Prx***
20081154-TA-TP5_Dst***
18513323-TA-TP6_Dst8×A***
18453796-TA-TP6_Dst8×A***
20096718-CA-CP5_Dst10×A***
15171226-CTTTTT-C19×T***
13869512-AT-TG***
13869553-TGGTAT-GGAATG***
14026022-G-GAAAT***
14339106-CTTTT-C19×T***
14937835-T-TTTCTTTTCTC***
15157860-CAAAAAAAA-C21×A***
15423440-ACT-CCC***
18439292-TCG-CCCP6_Dst***
16119964-T-TTTCGP8_Prx***
16119970-T-TCTTGP8_Prx***
16148183-C-CTTP8_Dst27×T***
16150948-TAA-TP8_Dst22×A***
16595919-CTTT-C17×T***
17994851-CAAA-CP7_Prx17×A***
20082755-AT-AP5_Dst9×T***
20097620-A-ATP5_Dst9×T***
20602137-TTTTTTT-CTCTATAP5_Dst***
20530282-C-CAAAAAAAAP5_Dst***
20434280-TAA-TP5_Dst18×A***
20442453-GA-GP5_Dst11×A***
20449946-GA-GP5_Dst***
20479152-CTTTTTTAGTTACTTTTGTTATCATT-CP5_Dst***
20479819-A-ATP5_Dst14×T***
20495619-CT-CP5_Dst***
20530293-CA-TGP5_Dst***
20378391-CTT-CP5_Dst***
20567702-AT-AP5_Dst10×T***
20579119-C-CATP5_Dst***
20584677-TAAATACAAGTA-TP5_Dst***
20593055-CA-CP5_Dst22×A***
20602008-AAAAGAGAA-GTAAAAAAGP5_Dst***
20602125-AATG-CAAAP5_Dst***
20387096-GA-GP5_Dst11×A***
20368108-CTTT-CP5_Dst22×T***
20097820-TTTC-TP5_Dst5×TTC***
20213957-TA-TP5_Dst***
20112192-TCTTGTCCATCAGCCTGGAACCTGGACCTCAGGCTGTAA-TP5_Dst***
20142089-CAAGA-AAAACP5_Dst***
20195543-G-GAP5_Dst10×A***
20205142-CT-CP5_Dst***
20207102-C-CAP5_Dst10×A***
20212297-C-CAP5_Dst16×A***
20217548-C-CTP5_Dst***
20362564-C-CTTP5_Dst11×T***
20223521-CA-CP5_Dst***
20232462-CC-TGP5_Dst***
20232493-AGAGA-GGAGTP5_Dst***
20323695-CT-CP5_Dst9×T***
20334605-GA-GP5_Dst***
20360957-A-ATTP5_Dst10×T***
24796652-G-GTP3_b28×T***
24860879-TTAATAACAATGATACAATAAACA-TP3_b2***
13869313-TGGACTCAAAA-AGGAGTCCAAT***
28142037-A-ATP1_b49×T***
58822358-ATTCCATTCCT-A***
58822238-AT-A***
58821640-TCG-AAC***
58821633-TTTCGT-ATTCTA***
58819638-C-CT***
28803746-GCAG-ACAA***
28392034-AT-AP1_gr2***
28315828-CTGTG-CP1_b421×TG***
28245714-A-ATTP1_b415×T***
28229322-TA-TP1_b417×A***
28184488-ATAT-AP1_b414×TAT***
28175354-C-CAAP1_b4***
28146580-AT-AP1_b410×T***
28142055-AT-AP1_b4***
28078316-T-TAP1_Y210×A***
58834871-TTTCCA-T***
27916437-CAAACAGAATGAAACAC-AAAAAAAAAAAAAAAAAP1_Y2***
27761167-TA-TP1_Y2***
27777099-GT-GP1_Y29×T***
27809575-TT-AAP1_Y2***
27815070-C-CTP1_Y210×T***
27904476-C-CTP1_Y211×T***
27909316-GA-GP1_Y2***
27937952-TCAGGAAAATCCTTCAAAAATCCATGAATC-TP1_Y2***
28015149-CAA-CP1_Y29×A***
27942188-CAGAGAGA-CP1_Y2***
27962556-AT-AP1_Y28×T***
27968354-C-CTP1_Y214×T***
27978560-ATT-AP1_Y214×T***
27997713-CAGGCAGAG-AAAAAAAAAP1_Y2***
28007101-GAAAACTTCC-GP1_Y2***
58826874-CCATTG-C***
58848072-GA-TC***
27745674-T-TAP1_Y212×A***
58982249-ACTG-TCTC***
58981288-TTG-CTT***
58981662-CC-AA***
58981677-ACA-CCT***
58981697-GATCC-TATCT***
58981831-A-ATTCTT***
58982078-CTCAAT-C***
59004463-A-AAAAGAAAGAAAGAAAG15×AAAG***
58978672-T-TCCACC***
59030498-C-CAAAA***
59030568-T-TTTAA***
8555568-T-TGTTTTC***
14937826-T-TTCTTTTCTTG***
14937858-C-CTTTTCTTTTA***
27579076-TC-TP1_Y2***
58978713-AA-GC***
58977556-TGT-CAC***
58855276-ACCATTCC-TCGAGTCG***
58973093-GC-CG***
58855325-TTC-ATT***
58855332-G-GCACACGGGTT4×CATTC***
58858832-CAGTCCATTACTATCCA-GGGTTGATTCCATTGCT***
58858936-GCACTCC-AGGATTG***
58858951-ACATTCTACTCTA-GACAGGATCTCAC***
58972725-GATTCT-CAGTCC***
58974210-CA-TG***
58977241-TT-CA***
58975770-CT-TG***
58975933-TACTTCACCTCA-CATTGCATTCGT***
58976377-TTA-CTC***
58976384-ACATTCCATTGCA-CCAAACCACTCCT***
58976964-CTCCAC-A***
58977126-TTCCG-CTCCA***
27756148-ACAC-AP1_Y2***
27739907-GAA-GP1_Y210×A***
25250612-GGTGTGTGT-GP2_r121×GT***
25670996-GGGTCT-GP1_b3***
25473356-TTTATTAATCAAGCTTCATTA-TP2_r2***
25490732-CA-CP2_r2***
25524836-AGC-TGTP1_gr1***
25658036-G-TTTP1_b3***
25662111-TAA-TP1_b314×A***
25668660-C-CTP1_b39×T***
25689959-TA-TP1_b313×A***
25460675-TATA-TP2_r213×ATA***
25698641-ATG-AP1_b38×TG***
25763125-TA-TP1_b39×A***
25766674-CA-CP1_b3***
25964715-GTTTCA-TTTTTTP1_Y1***
26228685-CTTTC-TTTTTP1_Y1***
26395278-G-GTP1_Y111×T***
25470597-TCCTC-TP2_r24×CCTC***
25445580-GTA-GP2_r210×TA***
26834599-CAAAGAAAGAAAG-CP1_g216×AAAG***
25366915-GA-GP2_r2***
25283792-TA-TP2_r113×A***
25287876-TTACCGAAGAATGAAGTAGGCAGACACATAAGGAG-AGTGTAAGCAGGATCAGAGAAATTAGATGCAAGAP2_r1***
25287915-GCTTTCATTC-CACGGGATTTP2_r1***
25287926-CT-TAP2_r1***
25365149-TATCTCTTGAAAG-TP2_r2***
25366671-AT-AP2_r2***
25382069-GTA-GP2_r2***
25442253-AT-AP2_r2***
25385362-TC-TP2_r2***
25388722-G-GTP2_r28×T***
25393996-ACGT-AP2_r2***
25425541-G-GAP2_r2***
25427715-GGATTT-GP2_r2***
25430759-CT-CP2_r28×T***
26400765-A-ATP1_Y111×T***
26884348-GGTGTGTGT-GP1_r322×GT***
27717288-TA-TP1_Y2***
27412976-GTT-GP1_g3***
27315379-TA-TP1_g3***
27316208-TG-TP1_g3***
27316407-G-GTTP1_g39×T***
27337461-CAATTCCTTTGACA-CP1_g3***
27344661-GA-GP1_g3***
27354859-AT-AP1_g38×T***
27424163-CTT-CP1_g317×T***
27253568-G-GAP1_g39×A***
27564840-T-TAP1_Y29×A***
27583000-C-CTP1_Y222×T***
27586578-CATAA-CP1_Y2***
27711095-G-GTP1_Y28×T***
27711690-CTT-CP1_Y217×T***
27713162-AT-AP1_Y2***
27256040-C-CAP1_g39×A***
27248568-G-GTP1_g318×T***
26893687-GA-GP1_r38×A***
27070993-TA-TP1_r4***
26942287-AT-AP1_r3***
26943646-CA-CP1_r3***
26953773-G-GAP1_r3***
26990528-TG-TP1_r4***
27001771-CTT-CP1_r424×T***
27042638-A-ATP1_r410×T***
27076355-TATAATA-TP1_r49×ATA***
27248303-GA-GP1_g3***
27122869-T-TAP1_g38×A***
27124134-AAAGT-AP1_g36×AAGT***
27162085-GAC-AAAP1_g3***
27178881-G-GAP1_g3***
27199330-GTC-GP1_g3***
27228156-GA-GP1_g3***
13869419-GGAATG-TGACTC***
13869234-AGG-GGA***
28120453-A-GP1_b4***
58825007-C-A***
58905385-G-A***
58884897-T-C***
58884875-C-A***
58865975-G-C***
58858972-G-A***
58858970-T-A***
58858968-A-T***
58858862-C-G***
58858855-A-T***
58855369-A-G***
58855367-C-T***
58855362-G-C***
58830518-C-T***
58825008-T-A***
58822432-A-T***
58974490-A-C***
28806578-G-T***
28806570-A-G***
28806571-T-A***
28806572-T-A***
28806573-G-T***
28806575-A-G***
28806577-T-A***
28806580-A-G***
58822425-G-T***
28806582-T-A***
28806583-G-T***
28809305-T-G***
58819772-G-C***
58820203-C-A***
58822217-A-T***
58973368-G-A***
58975940-C-T***
28806566-G-A***
16478198-GA-G16×A***
14179193-GA-G10×A***
18499927-GA-GP6_Dst13×A***
9566983-CTG-CIR3_Prx***
20920178-C-CAP4_Dst14×A***
9924014-TGACCCTGTGTGATGAATTTAT-CAACTTCGTGAGATTAATGGAC***
13489012-ATGCCC-GTGACA***
58980808-TG-CA***
19449428-GA-G23×A***
27936764-C-CAP1_Y215×A***
27337691-G-GAP1_g39×A***
9551440-G-GTIR3_Prx11×T***
28103949-C-CTP1_Y222×T***
13860078-TA-AC***
21002535-TTCTC-TP4_Dst16×TC***
26544618-GAT-GP1_g214×AT***
10012600-TT-GG***
58977244-C-A***
58983637-C-A***
58977246-T-C***
58978685-A-T***
58981532-C-A***
58981978-T-C***
58982234-A-T***
58982530-C-A***
59001248-A-C***
27570867-CGTGT-CP1_Y220×GT***
59031853-G-T***
9342865-T-TG***
22352949-CCGGTGA-GTGTTGCDYZ19***
7103038-TACAC-T17×AC***
21562049-T-TCA18×CA***
14331156-TG-T***
28806568-G-T***
28806565-A-G***
20917254-C-CAP4_Dst14×A***
28372840-T-CP1_gr2***
28184557-G-TP1_b4***
28225814-T-GP1_b4***
22739657-C-A***
28253542-T-AP1_b4***
28257546-G-TP1_b4***
28270445-G-TP1_b4***
28583298-G-T***
28175320-C-AP1_b4***
28583299-T-G***
28583300-C-G***
28583301-A-G***
28587966-A-C***
28608508-C-A***
28609737-G-T***
28184467-G-TP1_b4***
28170543-G-AP1_b4***
28687503-C-A***
28160697-G-TP1_b4***
28120469-G-CP1_b4***
28120509-C-GP1_b4***
28132532-T-GP1_b4***
28133068-A-TP1_b4***
28143445-C-AP1_b4***
28146491-G-TP1_b4***
28160701-G-TP1_b4***
28170498-A-CP1_b4***
28160724-G-TP1_b4***
28160725-A-TP1_b4***
28160729-C-TP1_b4***
28160765-A-GP1_b4***
28170490-G-AP1_b4***
28170495-T-AP1_b4***
28622124-T-C***
28733323-G-T***
28806564-G-A***
28806553-G-T***
28803718-C-A***
28803726-G-C***
28803729-T-C***
28803735-A-G***
28806550-A-G***
28806551-C-A***
28806555-A-G***
28800147-G-T***
28806557-T-A***
28806558-G-T***
28806560-A-G***
28806561-G-A***
28806562-T-A***
28806563-G-T***
28803710-T-G***
28797500-A-C***
28742648-C-A***
28784545-T-A***
28757032-G-T***
28773532-C-A***
28784534-T-C***
28784538-A-T***
28784543-A-T***
28784544-T-G***
28784546-G-A***
28796182-T-C***
28784548-A-T***
28787997-A-G4×GAGTG***
28788010-G-A***
28788012-G-T***
28788015-G-C***
28788018-A-C***
27780449-CA-CP1_Y218×A***
9557063-TTG-TIR3_Prx***
13869213-ATGAA-TCAGT***
13702782-GAATTC-AAATGG***
13489730-TGGCC-CGGCG***
13680939-AGATATCGAATG-TGGAATTGAAAT***
13681022-TCTCCAATGT-AATGGTACCG***
13690848-CAA-GAT***
13699729-GGAATT-G***
13702759-GAAGAGATAAAT-ACGGACTGGAGA***
13704404-TACTCAAATGGATTA-GAATGGAGATTAATG***
13488837-GCCGGTTG-AACGGGCT***
13704431-ATGGAACTAAACGTAATGAACTC-GACTAATGGAATAGAATCAAATG***
13799075-GGACT-CTACA***
13799151-TAAT-GAAA***
13799165-C-GCAATG***
13801160-AATG-CATC***
13801542-CGGAA-TTGAG***
13489367-TCCC-CCCA***
13488827-GTGACA-ACGACG***
13803179-GAC-AAT***
13466029-GG-AA***
13456687-CCGTCCTT-AAGTTGAA***
13456703-CCTTGGGTTG-ATTGCATTCC***
13461044-TAT-CCC***
13463860-CACGCGGGATTGG-GACGAGGGGTTGA***
13463893-GGGT-TTGC***
13465969-AGTA-GATG***
13471972-TG-CT***
13488808-GAGGACCC-AAGACTG***
13474751-CT-C***
13481403-TAGAAAAG-AAGACAAC***
13485613-AATGC-GATT***
13485843-TCAGA-AAATG***
13485852-CACCG-TATCA***
13487800-GGGGCTGG-CGAGCGGT***
13803167-AGACTC-GGACAT***
13803187-CGAATGGAATTTACTCAAATAC-TTAATAGAAATTTTTCGAACAG***
13452806-CACTGCACTACATTCCACTGAATTCCAC-TATTCAACTCCCTTACTCTCCATTACAT***
13859884-GGAA-AGAG***
13850099-ATT-GTC***
13850261-C-CAAATGGAATG***
13855516-CAAACGGATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG-GAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACCCGAGTAAAGTT***
13858729-CGACTGGAATGGAATGGAATGGAATGG-GGAATCGAAGGAATTGGAACAA***
13858759-AC-CG***
13858767-CAC-AGG***
13860018-TAG-ACA***
13850067-GATTCA-G***
13860093-AT-TG***
13860133-TTCGTTGGAACTT-AGGAATAGAATGG***
13860367-TTTGGA-AAT***
13866834-CT-GG***
13866855-GACTC-CACTT***
13866864-GA-AG***
13850084-TTCA-ATCT***
13847496-TTCTAAAG-CTCAAAAT***
13803263-GAAT-AAAC***
13804150-AGAA-GGAC***
13803275-CC-AA***
13803301-AGG-TGA***
13803323-CAAA-TGAT***
13803332-TGAC-AGAT***
13803340-CTGTA-ATGTT***
13804122-GATC-AATA***
13804159-CGGAA-TGCAG***
13839844-CGT-TGG***
13804231-TA-GC***
13818030-AG-GT***
13818038-CATTG-GAATA***
13833374-AT-A***
13838711-GT-AG***
13838730-TCA-CCG***
13454342-CA-GG***
13452796-CATTCC-GGATTG***
13804186-CAA-AAT***
9621478-CA-CIR3_Prx***
9503819-C-CTATA***
9535155-ATT-AIR3_Prx17×T***
9554422-TGAAGAGTA-TIR3_Prx***
9566727-CA-CIR3_Prx13×A***
9587293-CA-CIR3_Prx***
9589945-CT-CIR3_Prx10×T***
9629451-C-CAIR3_Prx12×A***
9073219-CTTTT-C15×T***
9634219-C-CTIR3_Prx9×T***
9671312-CA-CIR3_Prx9×A***
9728574-TTCCCACTGGC-TIR3_Prx***
9751854-CA-C***
9753975-CTTT-C20×T***
9923934-AG-TT***
9342871-GC-G***
8888375-CTTTTT-C25×T***
9924000-TC-AG***
6226074-T-TCTTTCTTCIR3_Dst***
27368714-G-GAP1_g310×A***
13868845-TT-GG***
3550471-AACCC-CCGGG***
4113116-TAA-T16×A***
5785603-GATAC-AAAAA***
6226071-C-CTTTCTTTAIR3_Dst***
6226086-T-TCTTCIR3_Dst***
8842203-T-TAA12×A***
6279798-CAA-CIR3_Dst13×A***
6492158-TA-T***
7532276-GTATATATATA-G28×TA***
8555559-T-TTTTGTC***
8628154-CTTT-C16×T***
8768612-TACAC-T17×AC***
9923972-ACAA-GT***
9961312-ACT-GG***
13452788-ATT-TTA***
13447311-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA***
13385797-GC-AA***
13442512-C-AT***
13447223-GCTA-ACTC***
13447234-TCCCATC-ATCAATT***
13447259-TTT-CTC***
13447264-CTCCACTCCA-TTCTATTCCG***
13447752-TC-CA***
13196148-GGCTCC-CATTCT***
13447764-CACT-TTCA***
13447773-GCA-ATC***
13451051-CATTCCA-AATTACT***
13452715-ACTC-CAAT***
13452723-CTCCTCTGCAC-TTGCATTCCAT***
13452758-CTTCTTTCAACTCCACTCATC-TTCCATTCCATTCCGTTCTAT***
13203925-CATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-GTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT***
13196132-GCATCCCATTAC-CCAATCCACTAT***
9974499-TC-CT***
10081903-GCACAA-TAACAG***
10070068-ATTCTA-GCACTG***
10075709-AAAGGTAG-GAATGTAT***
10081845-CAG-AAT***
10081858-ACTCTATC-GCTATATGA***
10081874-GG-TC***
10081889-TATGAAG-GACGTAT***
13132134-GGGAAC-AGAAAG***
13196107-CCTCTCC-GCACTCA***
13140096-TCAGA-ACACT***
13140125-G-CACTC6×CACTC***
13140214-CCT-TCC***
13141991-AAC-CAT4×ACTCC***
13143883-TCCAGTT-ACCATTC***
13196092-ACAC-CTGT***
22793185-C-A***
22319045-T-CDYZ19***
22703595-C-A30×A***
8652861-A-C***
9175486-T-G***
9175473-C-G***
9175471-T-G***
9175465-A-G***
9175455-T-G***
9175452-G-C***
9175451-A-C***
9094246-C-A***
9001128-G-T***
8799254-C-A***
8793053-C-A***
8768590-A-T***
8735700-T-G***
8698041-C-A***
8514314-C-A***
9175495-A-G***
8181256-C-G***
8181248-T-G***
8181250-C-T***
8181251-A-T***
8181252-G-T***
8181253-T-G***
8181255-G-C***
8181264-C-G***
8486655-G-T***
8181267-C-T***
8207952-G-T***
8216467-C-G***
8216651-C-T***
8253564-T-C***
8293840-G-T***
9175489-A-G***
9191774-G-T***
8181246-A-T***
9551427-A-GIR3_Prx***
9700911-G-AIR3_Prx***
9700910-T-GIR3_Prx***
9700889-G-AIR3_Prx***
9700702-C-GIR3_Prx***
9634161-A-TIR3_Prx***
9629420-G-TIR3_Prx***
9602643-T-AIR3_Prx***
9601655-T-CIR3_Prx***
9601573-T-CIR3_Prx***
9596527-A-GIR3_Prx***
9574486-T-GIR3_Prx***
9572360-G-CIR3_Prx***
9564408-G-TIR3_Prx***
9564391-T-GIR3_Prx***
9539327-C-TIR3_Prx***
9191775-C-G***
9306180-C-A***
9191776-A-T***
9191778-C-T***
9191780-G-T***
9191782-A-T***
9191786-A-T***
9229655-T-A***
9320591-T-C***
9528801-A-T***
9340653-G-T***
9342980-C-G***
9345476-A-G***
9398133-C-A***
9457172-T-G***
9478111-A-C***
8181247-G-T***
8181244-G-T***
9700917-A-CIR3_Prx***
6400089-G-T***
7056218-T-C***
6944071-G-A***
6939998-G-A***
6931350-T-G***
6901143-G-T***
6900905-C-T***
6869553-A-G***
6869552-C-A***
6757115-C-A***
6734809-C-T***
6708999-A-C***
6674653-G-T***
6664065-G-T***
6509869-C-A***
6389589-G-T***
7182924-C-A***
5874059-C-A***
4557458-C-A***
4561563-C-A***
4926002-T-C***
5317367-G-A***
5755691-A-G***
5785598-C-A***
6090422-T-G***
6298678-T-AIR3_Dst***
6104709-G-A***
6137892-T-GIR3_Dst***
6140957-C-AIR3_Dst***
6158846-G-TIR3_Dst***
6174500-T-GIR3_Dst***
6246812-A-TIR3_Dst***
7099082-C-A***
7186041-C-A***
8181243-T-C***
8163748-C-A***
7873081-G-T***
7875283-C-A***
8022757-C-G***
8129293-C-A***
8130607-G-T***
8159562-T-G***
8171740-G-T***
7642911-C-A***
8181214-G-T***
8181232-G-C***
8181235-G-C***
8181239-A-T***
8181240-G-C***
8181242-C-G***
7753707-T-G***
7497619-C-AIR1_L***
7186835-G-T***
7270341-A-T***
7190636-C-A***
7246024-G-T***
7253660-C-A***
7270318-C-T***
7270339-G-T***
7270340-G-C***
7270344-G-T***
7487948-C-AIR1_L***
7287043-C-A***
7387420-A-T***
7387421-G-T***
7397633-C-A***
7401961-C-A***
7414265-G-A***
9700913-T-GIR3_Prx***
9745940-A-C***
4509590-C-A***
13489041-G-A***
13704058-A-T***
13704057-A-C***
13704055-A-G***
13704050-C-A***
13652363-G-T***
13632733-C-A***
13489508-G-A***
13489500-A-C***
13489495-C-A***
13489466-T-G***
13489089-G-A***
13489077-T-G***
13489046-T-G***
13489042-C-T***
13489000-C-A***
13718506-G-C***
13482062-G-C***
13480141-G-A***
13480461-A-G***
13480591-T-C***
13480653-G-A***
13480682-T-G***
13480703-C-A***
13482081-A-T***
13488918-C-A***
13482112-G-A***
13487790-C-A***
13488793-C-T***
13488810-G-A***
13488837-G-A***
13488844-G-T***
13704059-C-G***
13720127-A-T***
13478251-G-T***
13801114-G-T***
13850126-A-G***
13850125-T-G***
13850122-A-G***
13850120-A-T***
13850117-G-A***
13850116-T-G***
13850115-T-A***
13850111-T-G***
13838692-G-T***
13828546-G-T***
13818045-A-T***
13803225-A-G***
13801495-A-G***
13801123-G-T***
13740868-C-A***
13720131-C-T***
13720148-G-T***
13720132-A-G***
13720136-T-A***
13720137-C-G***
13720141-T-C***
13720142-T-G***
13720147-G-A***
13720152-G-A***
13735155-G-T***
13720163-G-T***
13722228-T-C***
13722229-A-G***
13722233-A-G***
13722234-T-G***
13728638-G-A***
13478258-A-G***
13478250-G-T***
9745941-A-C***
9966136-C-A***
10081908-A-G***
10081847-G-T***
10081845-C-A***
10075782-C-T***
10075763-G-C***
10075730-A-T***
10075704-T-C***
10070058-G-A***
10033408-C-A***
10025267-C-A***
10023027-C-A***
10019109-T-G***
10013131-C-A***
10004366-A-C***
9955525-C-A***
13132226-G-C***
9923899-T-C***
9746018-C-T***
9749917-A-G***
9750015-G-T***
9772116-C-A***
9784666-G-T***
9907509-G-T***
9923961-T-C***
9955472-A-G***
9923981-G-T***
9924053-C-A***
9934935-A-T***
9935926-C-T***
9940905-G-T***
9941285-C-T***
13126058-A-T***
13140091-T-A***
13471991-T-A***
13467219-A-T***
13457643-G-T***
13457646-G-C***
13464369-C-A***
13465929-T-A***
13466001-C-G***
13467155-C-A***
13467225-T-C***
13456716-A-C***
13467226-G-A***
13467235-G-T***
13467240-G-C***
13468319-A-G***
13469346-G-T***
13469348-G-C***
13457642-G-A***
13454352-C-T***
13140093-A-T***
13253352-A-T***
13140094-A-C***
13140095-A-C***
13194303-T-C***
13196119-A-C***
13239362-A-C***
13249148-C-A***
13255996-G-T***
13454350-T-C***
13325975-A-G***
13325977-T-G***
13405112-A-T***
13410664-T-A***
13448858-C-A***
13448859-C-A***
4537932-C-A***
4460679-C-A***
13850131-G-A***
13203925-C-G***
13203940-G-T***
13203939-T-A***
13203938-A-G***
13203937-G-T***
13203936-A-G***
13203935-G-A***
13203934-A-T***
13203933-T-A***
13203932-A-G***
13203931-G-T***
13203930-T-A***
13203929-G-T***
13203927-T-A***
13203926-A-T***
13203923-G-T***
13203942-T-A***
15928397-TG-T***
7464063-G-AIR1_L***
24673369-T-TAP3_b210×A***
19604809-CA-CP5_Prx19×A***
13437695-G-T***
10023585-T-G***
13256126-G-GT***
18468583-TTG-TP6_Dst11×TG***
9745942-G-C***
18804472-GAA-G***
18908110-GTA-G***
19407606-CT-C17×T***
8439220-G-GTTT14×T***
9745937-G-C***
9745939-G-C***
13203941-A-G***
13203945-A-G***
58975760-TTCCG-CTCCA***
25626845-G-AP1_b3***
27173659-G-GAP1_g313×A***
20428495-AT-AP5_Dst15×T***
28802562-T-A***
28802561-A-G***
28253532-G-AP1_b4***
28253528-T-AP1_b4***
27873407-A-TP1_Y2***
27844528-G-TP1_Y2***
27585905-A-TP1_Y2***
27062118-C-TP1_r422×T***
26991372-C-AP1_r4***
25845062-T-AP1_b3***
25845058-T-AP1_b3***
25845055-C-AP1_b3***
25524846-A-TP1_gr1***
13203946-G-T***
13203955-C-T***
13203948-T-G***
13203949-G-T***
13203950-A-G***
13203951-T-A***
13203952-G-T***
13203954-T-G***
13203956-A-G***
24662330-A-TP3_b2***
13203957-T-A***
13833408-A-T***
20942974-T-AP4_Dst***
23693640-A-C***
24084237-A-CP3_b1***
24192261-T-AP3_b1***
7464057-G-AIR1_L***
20893454-CA-CP4_Dst10×A***
24754928-TA-TP3_b215×A***
22505037-G-TDYZ19***
27637198-T-AP1_Y217×CA***
20108239-AAT-AP5_Dst15×AT***
20914498-C-CAP4_Dst12×A***
58866148-G-C***
20884101-G-GAP4_Dst10×A***
13818015-A-C***
13480548-C-A***
22489986-C-TDYZ19***
27810206-A-GP1_Y2***
27810198-A-GP1_Y2***
27810190-A-GP1_Y2***
27791968-T-TCTGP1_Y2***
26563173-TAC-TP1_g2***
25064178-T-Gg1******
22504991-T-ADYZ19***
13452743-C-T***
13452332-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G12×ATTCC***
10026415-C-T***
10031490-G-A***
13449301-C-A***
13449306-C-T***
13449311-A-C***
13449362-T-TTCCACTCCACTCCAC***
13454005-C-G***
13815487-C-T***
13456090-T-G***
13489058-C-T***
13494326-G-A***
13811024-G-C***
13811032-T-A***
13811049-G-C***
25709383-A-TP1_b3***
20232470-T-AP5_Dst***
20253869-G-GTP5_Dst13×T***
27895974-A-CP1_Y2***
25466467-T-AP2_r2***
25504098-T-CP1_gr1***
25524814-C-TP1_gr1***
25658043-A-GP1_b3***
26089828-C-GP1_Y1***
26310873-A-CP1_Y1***
58977328-G-C***
19189498-A-T***
22272937-TAGT-GGDYZ19***
20881862-CA-CP4_Dst16×A***
10016081-AA-TC***
13463768-GCCCG-TCCCC***
13803371-AGGAG-TGGAA***
13803396-TG-CA***
25280450-T-CP2_r1***
18008713-A-TP7_Dst***
22358055-C-GDYZ19***
13704466-C-A***
13801242-T-G***
13704467-A-T***
28142885-AT-AP1_b411×T***
27368948-G-GAP1_g311×A***
27794410-AT-AP1_Y2***
3550544-T-A***
15400167-CA-C14×A***
18008709-A-TP7_Dst***
9923914-A-G***
22481595-A-TDYZ19***
59031879-C-T***
8389614-G-C***
9311496-G-C***
16691391-C-A***
9540246-CT-CIR3_Prx18×T***
27760220-G-GTP1_Y214×T***
4425853-C-A***
2753878-C-A***
2814836-T-A***
2814835-T-A***
2814834-T-A***
2814833-G-C***
2814832-A-C***
2814831-G-C***
2814830-G-T***
2814829-A-C***
2814827-T-G***
2814826-G-A***
2814825-G-C***
2814824-A-T***
2814823-G-T***
2813758-C-A***
2753026-C-A***
2814839-A-G***
13480600-A-T***
13467218-T-A***
13483448-T-G***
13801536-A-G***
23816742-G-T***
13461699-C-A***
21714723-T-G***
17661357-G-T***
2752537-C-A***
9924043-C-A***
13869490-T-A***
28784531-G-A***
13850142-G-T***
58980701-A-T***
2744676-A-G***
2814838-A-T***
2814840-A-C***
13487771-G-T***
3550468-T-A***
4243333-A-T***
4243332-C-A***
4243331-A-G***
4243330-A-G***
4243329-G-T***
3990609-T-A***
3990606-C-G***
3990603-C-G***
3990588-C-A***
3990585-G-T***
3951284-C-A***
3716132-C-A***
3592569-C-A***
3550494-T-A***
3550465-C-G***
2814841-C-T***
2814850-C-A***
2814842-C-G***
2814843-A-G***
2814845-C-A***
2814846-C-T***
2814848-G-A***
2814849-G-C***
2814851-C-G***
3005690-C-A***
2814852-A-G***
2814853-A-C***
2853557-G-A***
2860531-C-A***
2873912-C-A***
2877925-C-A***
21853674-T-A***
13801131-A-G***
24618868-C-CTP3_t212×T***
27166686-G-GAP1_g311×A***
18369731-A-GP6_Prx***
18369724-A-CP6_Prx***
27585915-G-TP1_Y2***
27585914-A-TP1_Y2***
58975737-CCAT-ACAC***
19537901-CA-C17×A***
58985437-TCTGC-CCTGT***
58823679-TCCATTTGATGCCATC-T***
28260208-CT-CP1_b413×T***
27991626-GGA-GP1_Y213×GA***
27868124-CA-CP1_Y213×A***
27736672-G-GAP1_Y210×A***
27583214-G-GTP1_Y211×T***
27398536-GCAAAC-AAAAAAP1_g3***
27046828-CT-CP1_r410×T***
26463200-A-TP1_Y1***
16162095-CA-CP8_Dst19×A***
9591034-GA-GIR3_Prx12×A***
13681005-GA-CG***
13681013-GTGGA-ACAAT***
13801234-AAG-GAA***
13855157-AA-TT***
16150095-CTT-CP8_Dst22×T***
18490252-C-CTP6_Dst11×T***
26931754-C-CAP1_r38×A***
20848244-A-ATP4_Dst19×T***
20949887-AAGC-CAGTP4_Dst***
20949903-TCC-CCTP4_Dst***
21030546-T-TAP4_Dst13×A***
22273537-GACTTCA-CACCTTDYZ19***
22341511-TTTCG-GTTCTDYZ19***
25466540-G-AP2_r2***
27082215-G-AP1_r4***
13487746-C-A***
6133763-C-G***
27313118-A-ATP1_g39×T***
27963480-C-CAP1_Y211×A***
13859602-A-T***
13132116-C-T***
6878800-A-CM5386***
13467229-A-G***
19007641-C-T***
17584196-T-G***
21839981-A-T***
58977126-T-C***
58977125-A-G***
26900291-G-AP1_r3***
13469066-T-G***
9923988-A-C***
25427340-A-CP2_r2***
16104472-A-TP8_Prx***
9731612-GTTTG-TTTTTIR3_Prx***
10075752-G-A***
20872237-AT-AP4_Dst11×T***
28814964-G-T***
28814967-T-A***
14604587-CTTC-TTTT***
13704046-C-A***
10039846-G-C***
10075778-G-GTT***
59027543-T-C***
13711815-A-C***
22358065-T-ADYZ19***
28796363-GTAATGCAATGGAATT-G***
58974190-C-T***
58982021-C-T***
58989104-G-C***
13850129-G-A***
13850132-G-A***
22703594-T-A***
20084547-C-TP5_Dst***
20142098-G-CP5_Dst***
20142085-C-AP5_Dst***
20137961-G-AP5_Dst***
20130747-T-AP5_Dst***
20112840-G-TP5_Dst***
20107299-G-AP5_Dst24×A***
20105783-T-AP5_Dst***
20097549-T-AP5_Dst***
20089283-G-AP5_Dst***
20089241-G-TP5_Dst***
20089232-C-TP5_Dst***
20087732-T-AP5_Dst***
20084550-T-CP5_Dst***
20084549-G-TP5_Dst***
20084542-T-CP5_Dst***
20194872-A-GP5_Dst***
20019177-G-TP5_Prx***
19892926-G-CP5_Prx***
19910367-C-AP5_Prx***
19926017-G-AP5_Prx***
19926077-G-TP5_Prx***
19977128-C-AP5_Prx***
19998816-T-CP5_Prx***
20036241-T-GP5_Prx***
20084541-C-TP5_Dst***
20039526-C-AP5_Prx***
20078779-T-GP5_Dst***
20082705-T-CP5_Dst***
20084533-G-TP5_Dst***
20084534-G-TP5_Dst***
20084535-C-GP5_Dst***
20194525-G-TP5_Dst***
20196237-A-GP5_Dst***
19829283-A-TP5_Prx***
20325439-C-GP5_Dst***
20497609-G-TP5_Dst***
20497238-T-CP5_Dst***
20497231-A-CP5_Dst***
20479850-T-GP5_Dst***
20479194-T-AP5_Dst***
20442391-G-AP5_Dst***
20428379-A-CP5_Dst***
20428131-G-TP5_Dst***
20427754-G-TP5_Dst***
20420560-C-AP5_Dst***
20394513-G-AP5_Dst***
20379085-G-TP5_Dst***
20362527-T-CP5_Dst***
20332046-T-AP5_Dst***
20318815-A-TP5_Dst***
20197311-G-TP5_Dst***
20230236-G-AP5_Dst***
20197355-A-GP5_Dst***
20197415-A-GP5_Dst***
20199868-T-AP5_Dst***
20200065-A-TP5_Dst***
20200111-T-CP5_Dst***
20200950-C-TP5_Dst***
20243019-G-TP5_Dst***
20312756-G-AP5_Dst***
20243030-G-AP5_Dst***
20243042-T-AP5_Dst***
20247630-A-GP5_Dst***
20252687-C-AP5_Dst***
20256282-T-GP5_Dst***
20284423-C-TP5_Dst***
19867373-C-AP5_Prx***
19817453-G-TP5_Prx***
20507919-G-TP5_Dst***
19187497-C-T***
19189551-C-A***
19189475-T-C***
19189474-G-C***
19189473-A-C***
19189470-C-G***
19189469-A-G***
19189467-A-G***
19187531-C-T***
19187508-G-C***
19187507-G-C***
19187506-A-C***
19187502-G-T***
19187501-C-T***
19187499-G-T***
19187495-C-T***
19189555-C-T***
19117358-T-C***
19007643-C-T***
19007644-A-G***
19007647-C-T***
19036750-A-T***
19041272-A-C***
19043027-C-A***
19124277-C-A***
19187494-G-C***
19124293-C-T***
19187441-A-G***
19187485-C-G***
19187488-A-G***
19187491-C-T***
19187493-C-T***
19189553-T-A***
19206713-T-G***
19817452-G-TP5_Prx***
19681958-T-GP5_Prx***
19668709-C-AP5_Prx***
19668712-G-AP5_Prx***
19668716-T-AP5_Prx***
19668751-C-AP5_Prx***
19668761-C-AP5_Prx***
19678542-G-TP5_Prx***
19682119-T-AP5_Prx***
19543973-C-A***
19700766-A-GP5_Prx***
19711943-A-GP5_Prx***
19727366-T-CP5_Prx***
19743705-T-AP5_Prx***
19754426-T-CP5_Prx***
19765957-A-TP5_Prx***
19553794-C-A***
19467008-C-A***
19206717-C-A***
19359826-C-T***
19231377-A-G***
19303926-G-T***
19333357-C-A***
19359822-C-T***
19359823-A-G***
19359824-C-T***
19359830-C-T***
19403872-C-A***
19359831-A-G***
19359835-A-G***
19359837-A-G***
19359838-C-T***
19359839-A-G***
19359858-A-G***
20500970-T-CP5_Dst***
20530271-T-AP5_Dst***
18982530-G-A***
21935166-C-A***
22247187-T-CDYZ19***
22223285-C-TDYZ19***
22055470-T-C***
22055455-G-A***
22055453-T-C***
22055449-C-T***
22023278-A-T***
22023276-T-C***
22023265-G-C***
22023254-A-G***
22023250-T-G***
22000666-T-C***
21975276-C-T***
21963685-C-A***
21853676-T-A***
22262326-G-TDYZ19***
21551384-G-T***
21515819-C-G***
21515822-C-A***
21515824-C-G***
21515825-T-G***
21515852-G-A***
21530868-G-T***
21714721-C-G***
21853654-G-A***
21714722-C-A***
21714728-G-A***
21714730-C-A***
21714738-G-A***
21714740-C-A***
21714746-C-A***
22261635-G-ADYZ19***
22290881-T-CDYZ19***
21515816-T-A***
22334796-G-TDYZ19***
22703568-C-T***
22485115-G-ADYZ19***
22485097-C-TDYZ19***
22481392-C-GDYZ19***
22447615-G-TDYZ19***
22431187-A-TDYZ19***
22367824-G-TDYZ19***
22358177-G-CDYZ19***
22358162-T-CDYZ19***
22358161-G-TDYZ19***
22358057-T-ADYZ19***
22358056-T-GDYZ19***
22344911-A-GDYZ19***
22336980-C-ADYZ19***
22319064-A-TDYZ19***
22290889-G-CDYZ19***
22319050-G-ADYZ19***
22290894-A-TDYZ19***
22307303-T-GDYZ19***
22319044-T-ADYZ19***
20084551-T-CP5_Dst***
22319046-A-CDYZ19***
22319049-G-TDYZ19***
22319051-T-ADYZ19***
22319062-G-ADYZ19***
22319053-A-TDYZ19***
22319055-T-CDYZ19***
22319056-G-TDYZ19***
22319057-T-GDYZ19***
22319060-C-ADYZ19***
22319061-A-CDYZ19***
21515817-C-A***
21515815-A-C***
20530307-T-GP5_Dst***
20756508-C-TP4_Prx***
20937148-G-AP4_Dst***
20932788-A-GP4_Dst***
20920234-C-AP4_Dst***
20915768-C-TP4_Dst***
20915296-T-CP4_Dst***
20894476-A-GP4_Dst***
20886864-A-TP4_Dst***
20886851-C-GP4_Dst***
20872395-C-TP4_Dst***
20870919-T-GP4_Dst***
20870790-T-GP4_Dst***
20867232-T-AP4_Dst***
20853417-G-TP4_Dst***
20849687-G-TP4_Dst***
20751238-G-TP4_Prx***
20959417-G-TP4_Dst***
20602143-T-AP5_Dst***
20530331-C-AP5_Dst***
20534054-C-AP5_Dst***
20593080-G-AP5_Dst***
20602137-T-CP5_Dst***
20602139-T-CP5_Dst***
20602141-T-AP5_Dst***
20603957-G-TP5_Dst***
20722328-G-TP4_Prx***
20645955-A-TP4_Prx***
20716960-G-AP4_Prx***
20716969-G-AP4_Prx***
20716972-G-AP4_Prx***
20717032-T-AP4_Prx***
20717036-T-AP4_Prx***
20951260-C-AP4_Dst***
20982314-A-TP4_Dst***
21515814-G-T***
21515800-T-G***
21306571-G-A***
21306573-C-A***
21402217-C-T***
21402218-T-A***
21405899-G-T***
21515798-G-A***
21515802-G-T***
21306562-T-A***
21515804-A-T***
21515805-G-A***
21515806-T-G***
21515809-G-C***
21515810-C-T***
21515813-A-G***
21306569-C-A***
21306559-G-A***
20990517-G-TP4_Dst***
21139563-G-T***
20993541-G-TP4_Dst***
21014287-G-TP4_Dst***
21030501-G-AP4_Dst***
21084343-A-G***
21090845-C-A***
21100405-C-A***
21148588-T-A***
21306553-G-A***
21200753-C-A***
21201596-C-A***
21220260-G-T***
21248808-A-G***
21261823-C-T***
21306547-T-A***
18982545-C-G***
18959185-A-C***
13850139-G-A***
15622673-G-A***
15815270-G-A***
15815269-G-A***
15815267-G-A***
15815266-G-A***
15815264-G-A***
15815263-G-A***
15815262-G-A***
15770823-T-G***
15768996-C-A***
15740325-C-A***
15722024-T-G***
15718940-G-T***
15707135-C-A***
15689186-G-T***
15496995-A-G***
15815283-G-A***
15410620-T-G***
15260711-A-T***
15262458-C-A30×A***
15363995-G-A***
15364001-A-G***
15364005-A-G***
15410615-C-A***
15410622-A-G***
15496991-T-C***
15410626-T-C***
15430643-C-A***
15432928-C-A***
15493238-T-C***
15496988-A-G***
15496990-A-G***
15815272-G-A***
15815286-G-A***
15211246-G-T***
16146447-T-CP8_Dst***
16148237-G-CP8_Dst***
16148231-C-TP8_Dst***
16148230-T-CP8_Dst***
16148227-C-TP8_Dst***
16148226-T-CP8_Dst***
16148223-C-TP8_Dst***
16148222-T-CP8_Dst***
16148219-G-TP8_Dst***
16148218-A-GP8_Dst***
16148215-C-GP8_Dst***
16148214-A-CP8_Dst***
16148213-G-AP8_Dst***
16148212-A-GP8_Dst***
16147827-T-AP8_Dst***
16118225-A-GP8_Prx***
15882009-A-G***
15904036-G-A***
15882013-A-G***
15882018-A-G***
15882020-A-G***
15882042-T-G***
15894315-A-T***
15894372-G-T***
15917597-C-A***
16118209-G-AP8_Prx***
15992289-G-T***
16021032-A-C***
16034209-C-A***
16047050-T-G***
16089724-C-A***
16118198-T-AP8_Prx***
15260710-G-T***
15151484-C-A***
16148240-T-GP8_Dst***
13869538-T-G***
14073028-G-T***
14050767-C-A***
14030774-C-A***
13982640-C-A***
13978662-T-G***
13940288-C-A***
13937077-C-A***
13929472-A-C***
13869550-G-A***
13869548-T-G***
13869547-C-T***
13869545-G-A***
13869542-A-T***
13869540-G-A***
13869536-A-G***
14147077-C-A***
13869510-G-A***
13850141-G-C***
13850146-G-T***
13858799-T-G***
13869489-A-G***
13869503-C-G***
13869508-T-G***
13869515-G-A***
13869530-G-A***
13869518-T-C***
13869520-G-A***
13869522-G-T***
13869523-T-G***
13869525-G-A***
13869528-T-G***
14077821-A-C***
14153013-C-A***
15106929-T-A***
14754114-A-T***
14629755-C-A***
14645163-T-G***
14645499-T-A***
14673390-T-G***
14693550-T-A***
14746086-C-A***
14765724-G-T***
14602227-C-A***
14765725-G-C***
14765726-C-T***
14798735-T-A***
14986602-C-A***
15069051-C-A***
15070422-G-T***
14626977-C-A***
14600115-G-T***
14179340-C-A***
14324992-T-C***
14194283-T-C***
14241359-G-T***
14324959-A-G***
14324960-G-C***
14324961-T-G***
14324972-C-G***
14332668-T-G***
14582455-G-T***
14355540-C-A***
14386809-C-A***
14446467-C-A***
14519431-C-A***
14528629-C-A***
14529064-C-T***
16148238-G-CP8_Dst***
16148249-G-AP8_Dst***
18959182-T-C***
18195228-C-A***
18439313-A-TP6_Dst***
18439306-A-CP6_Dst***
18439302-G-CP6_Dst***
18439296-T-CP6_Dst***
18369737-A-GP6_Prx***
18369721-T-GP6_Prx***
18369717-G-AP6_Prx***
18369716-T-GP6_Prx***
18369713-G-AP6_Prx***
18369627-C-AP6_Prx***
18369619-C-AP6_Prx***
18311685-C-AP6_Prx***
18297872-C-AP6_Prx***
18195310-C-A***
18195203-T-C***
18439315-T-CP6_Dst***
18008714-G-TP7_Dst***
17922474-G-T***
17946944-G-T***
17956072-C-A***
18008706-G-TP7_Dst***
18008710-C-AP7_Dst***
18008711-G-TP7_Dst***
18008715-T-CP7_Dst***
18195202-G-T***
18020006-T-G***
18078582-G-T***
18093386-G-T***
18133147-A-G***
18147563-A-C***
18195197-G-T***
18439314-G-TP6_Dst***
18439325-G-CP6_Dst***
17907835-C-A***
18615980-C-T***
18959177-T-C***
18959168-T-C***
18959160-A-G***
18959158-T-G***
18959146-C-G***
18947916-C-A***
18919893-C-A***
18876383-C-A***
18853104-C-A***
18738188-C-A***
18687488-C-A***
18652936-G-T***
18652897-G-T***
18615981-A-T***
18615962-G-T***
18439334-C-GP6_Dst***
18480129-T-AP6_Dst***
18439342-A-GP6_Dst***
18439345-C-GP6_Dst***
18439350-C-GP6_Dst***
18460848-G-TP6_Dst***
18467297-C-TP6_Dst***
18480063-T-AP6_Dst***
18480130-C-GP6_Dst***
18615961-A-T***
18480132-C-AP6_Dst***
18480137-C-AP6_Dst***
18512448-G-TP6_Dst***
18513257-C-AP6_Dst***
18534163-C-TP6_Dst***
18565060-T-A***
17916320-G-C***
17889925-C-A***
16148251-G-TP8_Dst***
16294450-C-A***
16568263-C-A***
16549620-C-A***
16457314-C-A***
16451785-C-A***
16451781-C-T***
16441132-C-A***
16437481-G-A***
16427695-A-G***
16424871-C-A***
16409146-G-A***
16359717-G-A***
16305878-T-C***
16305877-A-C***
16305732-C-T***
16292643-C-T***
16648161-C-T***
16148260-T-AP8_Dst***
16148252-G-TP8_Dst***
16148254-G-TP8_Dst***
16148255-C-TP8_Dst***
16148256-G-CP8_Dst***
16148257-A-GP8_Dst***
16148259-C-TP8_Dst***
16148269-T-CP8_Dst***
16292641-A-T***
16164357-T-GP8_Dst***
16205753-A-C***
16292613-G-T***
16292617-C-T***
16292619-C-T***
16292620-A-T***
16598981-C-A***
16703863-G-T***
17871704-C-A***
17701396-C-T***
17406764-C-A***
17446814-C-T***
17498839-A-G***
17517100-C-A***
17588607-T-G***
17606340-C-A***
17707374-C-G***
17289768-C-A***
17763983-T-C***
17764744-T-G***
17770123-C-A***
17802164-A-T***
17832432-C-A***
17854455-C-A***
17320573-A-T***
17159005-C-T***
16730242-C-A***
16990025-A-T***
16768350-C-A***
16853777-A-T***
16855352-A-C***
16860748-G-T***
16867594-C-A***
16990024-A-G***
16990027-A-G***
17158995-G-T***
16990029-A-C***
16990030-A-G***
16990031-T-G***
16990032-A-G***
17041897-C-A***
17056887-T-C***
13865900-A-C,G***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Bond1224151011-14121213131329169-1010112515192914-15-15-15111119-231615181636-36121211915-1681010810101223-231610121215814222114121113111112123415916132526191311131211912121011113012122113101020152013241812162412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1701911008801860621157257607
Used in age calculations1008801860621157257607
Counts of SNPs00



Big Tree Main Page