Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > S16264 > L679

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
170191
FGC-BigY
ZR733
YFull-BigY
YF03599
8068096-C-T 8200055-C-T F110 M11115 YY++
24402932-A-G 22256785-A-G FGC36620 **+
23239730-C-T 21077844-C-T FGC36619 Y++
18905662-T-G 16793782-T-G FGC36618 YY*
15864016-G-T 13752136-G-T **
10081929-C-A 10244320-C-A **
10081981-G-C 10244372-G-C **
7387418-TG-T 7519377-TG-T **
13140418-C-A 10629904-C-A **
58993078-G-T 56846931-G-T **
58988696-G-T 56842549-G-T **
25201018-GAAAGAAAGA-G 23054871-GAAAGAAAGA-G g1 **
20872177-G-A 18710291-G-A P4_Dst **
15985493-A-C 13873613-A-C **
15912133-C-A 13800253-C-A **
27418151-C-A 25272004-C-A P1_g3 **
21104847-C-A 18942961-C-A **
24626401-C-A 22480254-C-A P3_t2 **
27151457-G-T 25005310-G-T P1_g3 **
21297968-C-A 19136082-C-A **
15725840-C-A 13613960-C-A **
27151514-GCCTACAA-G 25005367-GCCTACAA-G P1_g3 **
21383579-C-A 19221693-C-A **
24450436-T-C 22304289-T-C **
15700362-C-A 13588482-C-A **
21428501-C-A 19266615-C-A **
21489147-T-C 19327261-T-C **
27316356-GT-G 25170209-GT-G P1_g3 **
13588596-T-C 11432920-T-C **
13588614-C-A 11432938-C-A **
59001115-G-A 56854968-G-A **
27418206-CA-C 25272059-CA-C P1_g3 **
10081913-G-C 10244304-G-C **
27239670-CCT-C 25093523-CCT-C P1_g3 **
16284196-C-A 14172316-C-A **
19201629-C-A 17089749-C-A **
7144726-G-A 7276685-G-A **
7255504-C-A 7387463-C-A **
6992391-C-A 7124350-C-A **
6869549-A-G 7001508-A-G **
7733397-C-A 7865356-C-A **
7873040-G-T 8004999-G-T **
18439210-T-C 16327330-T-C P6_Dst **
17950825-A-AAT 15838945-A-AAT 27×AT**
18455377-G-GA 16343497-G-GA P6_Dst 9×A**
18953003-AAAAG-A 16841123-AAAAG-A 4×AAAG**
18242801-C-A 16130921-C-A **
19201455-C-A 17089575-C-A **
3389692-C-A 3521651-C-A **
21793667-G-T 19631781-G-T **
8482128-C-A 8614087-C-A **
19461345-C-A 17349465-C-A **
17491636-C-A 15379756-C-A **
2790342-C-A 2922301-C-A **
17233544-C-A 15121664-C-A **
9607099-C-A 9769490-C-A IR3_Prx **
9607152-GC-G 9769543-GC-G IR3_Prx **
16833438-C-A 14721558-C-A **
16516115-C-A 14404235-C-A **
58978681-G-A 56832534-G-A **
25256413-G-GAT 23110266-G-GAT P2_r1 21×AT**
13850084-T-A 11729378-T-A **
9994337-C-A 10156728-C-A **
14807370-T-C 12695441-T-C **
5635286-C-A 5767245-C-A **
23996883-C-A 21850736-C-A **
23350475-T-C 21188589-T-C **
28087250-A-C 25941103-A-C P1_Y2 **
13850078-A-G 11729372-A-G **
13850087-A-T 11729381-A-T **
27868049-A-G 25721902-A-G P1_Y2 **
13850101-T-C 11729395-T-C **
22125236-C-A 19963350-C-A **
22170921-C-T 20009035-C-T **
28783379-C-A 26637232-C-A **
14292801-G-T 12172095-G-T **
14470599-C-A 12349868-C-A **
23145878-C-A 20983992-C-A **
22358154-G-A 20196268-G-A DYZ19 **
22358092-C-T 20196206-C-T DYZ19 **
22358134-G-C 20196248-G-C DYZ19 **
22358088-T-C 20196202-T-C DYZ19 **
13857210-C-A 11736504-C-A **
13850099-A-G 11729393-A-G **
23412623-C-A 21250737-C-A **
14187934-C-A 12067228-C-A **
8261193-AAT-A 8393152-AAT-A **
22611370-C-A 20449484-C-A **
28731896-T-C 26585749-T-C **
26986520-A-C 24840373-A-C P1_r4 ***
26986547-A-C 24840400-A-C P1_r4 ***
26986542-T-A 24840395-T-A P1_r4 ***
26986537-T-A 24840390-T-A P1_r4 ***
26986536-C-T 24840389-C-T P1_r4 ***
26986532-A-G 24840385-A-G P1_r4 ***
26986528-T-A 24840381-T-A P1_r4 ***
26986525-G-C 24840378-G-C P1_r4 ***
26986522-G-A 24840375-G-A P1_r4 ***
27072209-A-T 24926062-A-T P1_r4 ***
27057001-A-T 24910854-A-T P1_r4 ***
26986512-T-C 24840365-T-C P1_r4 ***
26986551-A-T 24840404-A-T P1_r4 ***
26986506-T-C 24840359-T-C P1_r4 ***
26986481-C-T 24840334-C-T P1_r4 ***
26953277-G-A 24807130-G-A P1_r3 ***
26953275-G-A 24807128-G-A P1_r3 ***
26946243-C-A 24800096-C-A P1_r3 ***
27072228-T-A 24926081-T-A P1_r4 ***
26946233-G-A 24800086-G-A P1_r3 ***
26946232-G-A 24800085-G-A P1_r3 ***
27978542-A-T 25832395-A-T P1_Y2 ***
26921303-C-A 24775156-C-A P1_r3 ***
27068097-C-T 24921950-C-T P1_r4 ***
27062013-A-T 24915866-A-T P1_r4 ***
27062104-C-T 24915957-C-T P1_r4 ***
26991289-T-A 24845142-T-A P1_r4 ***
27046801-A-G 24900654-A-G P1_r4 ***
27060066-C-T 24913919-C-T P1_r4 ***
27035456-G-A 24889309-G-A P1_r4 ***
27971680-C-A 25825533-C-A P1_Y2 ***
27035452-G-T 24889305-G-T P1_r4 ***
27033033-C-A 24886886-C-A P1_r4 ***
27016031-G-A 24869884-G-A P1_r4 ***
27004356-C-A 24858209-C-A P1_r4 ***
27001804-A-T 24855657-A-T P1_r4 ***
26993038-G-T 24846891-G-T P1_r4 ***
26991367-G-A 24845220-G-A P1_r4 ***
26991286-G-A 24845139-G-A P1_r4 ***
27056942-A-G 24910795-A-G P1_r4 ***
27971727-A-C 25825580-A-C P1_Y2 ***
27060068-G-T 24913921-G-T P1_r4 ***
26914215-C-G 24768068-C-G P1_r3 ***
27971678-T-A 25825531-T-A P1_Y2 ***
27060071-C-T 24913924-C-T P1_r4 ***
26991275-T-A 24845128-T-A P1_r4 ***
26991255-T-A 24845108-T-A P1_r4 ***
27060072-A-T 24913925-A-T P1_r4 ***
26991243-T-A 24845096-T-A P1_r4 ***
27060074-G-T 24913927-G-T P1_r4 ***
26986553-C-T 24840406-C-T P1_r4 ***
27810370-A-G 25664223-A-G P1_Y2 ***
26914201-A-C 24768054-A-C P1_r3 ***
26914212-C-T 24768065-C-T P1_r3 ***
26874109-A-T 24727962-A-T P1_r3 ***
26902265-T-G 24756118-T-G P1_r3 ***
26900307-T-A 24754160-T-A P1_r3 ***
26900304-T-A 24754157-T-A P1_r3 ***
26900301-G-A 24754154-G-A P1_r3 ***
26900298-C-A 24754151-C-A P1_r3 ***
26900297-T-A 24754150-T-A P1_r3 ***
26900296-G-A 24754149-G-A P1_r3 ***
26900294-C-A 24754147-C-A P1_r3 ***
28095676-G-T 25949529-G-T P1_Y2 ***
26900292-T-A 24754145-T-A P1_r3 ***
26884409-G-T 24738262-G-T P1_r3 ***
26874117-A-T 24727970-A-T P1_r3 ***
26873927-G-T 24727780-G-T P1_r3 ***
26913977-G-T 24767830-G-T P1_r3 ***
26810627-G-T 24664480-G-T P1_g2 ***
26671190-C-A 24525043-C-A P1_g2 ***
28117196-G-T 25971049-G-T P1_b4 ***
26463213-A-G 24317066-A-G P1_Y1 ***
26463205-C-G 24317058-C-G P1_Y1 ***
26463199-C-T 24317052-C-T P1_Y1 ***
26463198-C-A 24317051-C-A P1_Y1 ***
26463196-C-T 24317049-C-T P1_Y1 ***
26463194-A-T 24317047-A-T P1_Y1 ***
26431111-C-A 24284964-C-A P1_Y1 ***
28117200-C-T 25971053-C-T P1_b4 ***
26418342-C-A 24272195-C-A P1_Y1 ***
26409313-G-T 24263166-G-T P1_Y1 ***
26912666-G-A 24766519-G-A P1_r3 ***
26913982-A-T 24767835-A-T P1_r3 ***
26914211-C-A 24768064-C-A P1_r3 ***
26914188-A-T 24768041-A-T P1_r3 ***
26914208-C-T 24768061-C-T P1_r3 ***
26914205-G-A 24768058-G-A P1_r3 ***
26914204-C-G 24768057-C-G P1_r3 ***
26914202-A-T 24768055-A-T P1_r3 ***
27968128-C-A 25821981-C-A P1_Y2 ***
26914200-C-T 24768053-C-T P1_r3 ***
26914199-T-C 24768052-T-C P1_r3 ***
26914198-C-T 24768051-C-T P1_r3 ***
26914195-A-T 24768048-A-T P1_r3 ***
26914193-C-T 24768046-C-T P1_r3 ***
26914192-C-T 24768045-C-T P1_r3 ***
26914189-C-T 24768042-C-T P1_r3 ***
27996179-G-T 25850032-G-T P1_Y2 ***
28015135-C-A 25868988-C-A P1_Y2 ***
26914167-T-C 24768020-T-C P1_r3 ***
26914186-C-T 24768039-C-T P1_r3 ***
26914184-C-T 24768037-C-T P1_r3 ***
26914183-C-T 24768036-C-T P1_r3 ***
28043465-G-T 25897318-G-T P1_Y2 ***
26914181-A-T 24768034-A-T P1_r3 ***
26914180-C-T 24768033-C-T P1_r3 ***
26914176-A-T 24768029-A-T P1_r3 ***
28045740-C-A 25899593-C-A P1_Y2 ***
26914175-C-T 24768028-C-T P1_r3 ***
26914174-T-C 24768027-T-C P1_r3 ***
28078293-G-T 25932146-G-T P1_Y2 ***
26914172-G-C 24768025-G-C P1_r3 ***
26914170-T-G 24768023-T-G P1_r3 ***
27076288-C-A 24930141-C-A P1_r4 ***
27077059-A-T 24930912-A-T P1_r4 ***
27076983-A-T 24930836-A-T P1_r4 ***
27582935-A-T 25436788-A-T P1_Y2 ***
27582961-C-A 25436814-C-A P1_Y2 ***
27582957-T-A 25436810-T-A P1_Y2 ***
27582956-A-T 25436809-A-T P1_Y2 ***
27582950-A-T 25436803-A-T P1_Y2 ***
27582948-A-T 25436801-A-T P1_Y2 ***
27582946-A-T 25436799-A-T P1_Y2 ***
27582945-C-T 25436798-C-T P1_Y2 ***
27582943-A-T 25436796-A-T P1_Y2 ***
27582942-G-T 25436795-G-T P1_Y2 ***
27582940-A-T 25436793-A-T P1_Y2 ***
27582939-C-T 25436792-C-T P1_Y2 ***
27582937-G-T 25436790-G-T P1_Y2 ***
27534257-A-C 25388110-A-C P1_Y2 ***
27821659-G-T 25675512-G-T P1_Y2 ***
27821688-T-G 25675541-T-G P1_Y2 ***
27499250-T-A 25353103-T-A P1_Y2 ***
27434854-G-A 25288707-G-A P1_g3 ***
27427449-A-G 25281302-A-G P1_g3 ***
27829116-T-G 25682969-T-G P1_Y2 ***
27829138-T-A 25682991-T-A P1_Y2 ***
27425654-C-T 25279507-C-T P1_g3 ***
27421698-G-A 25275551-G-A P1_g3 ***
27419620-T-A 25273473-T-A P1_g3 ***
27844539-A-T 25698392-A-T P1_Y2 27×T***
27415889-A-G 25269742-A-G P1_g3 ***
27399219-G-A 25253072-G-A P1_g3 ***
27397085-C-A 25250938-C-A P1_g3 ***
27821663-T-A 25675516-T-A P1_Y2 ***
27582965-C-T 25436818-C-T P1_Y2 ***
27849529-G-T 25703382-G-T P1_Y2 ***
27785853-C-A 25639706-C-A P1_Y2 ***
27819705-A-C 25673558-A-C P1_Y2 ***
27819879-T-C 25673732-T-C P1_Y2 ***
27810364-G-A 25664217-G-A P1_Y2 ***
27810363-A-G 25664216-A-G P1_Y2 ***
27810362-A-G 25664215-A-G P1_Y2 ***
27810360-G-A 25664213-G-A P1_Y2 ***
27810356-G-A 25664209-G-A P1_Y2 ***
27809442-T-C 25663295-T-C P1_Y2 ***
27793192-C-A 25647045-C-A P1_Y2 ***
27792018-A-C 25645871-A-C P1_Y2 ***
27792016-A-T 25645869-A-T P1_Y2 ***
27791844-T-C 25645697-T-C P1_Y2 ***
27786902-G-T 25640755-G-T P1_Y2 ***
27785716-C-A 25639569-C-A P1_Y2 ***
27585887-A-T 25439740-A-T P1_Y2 ***
27711613-G-T 25565466-G-T P1_Y2 ***
27686149-C-A 25540002-C-A P1_Y2 ***
27644323-A-G 25498176-A-G P1_Y2 ***
27644320-C-G 25498173-C-G P1_Y2 ***
27637260-G-T 25491113-G-T P1_Y2 ***
27821618-G-A 25675471-G-A P1_Y2 ***
27585908-A-T 25439761-A-T P1_Y2 ***
27585907-C-T 25439760-C-T P1_Y2 ***
27585902-C-T 25439755-C-T P1_Y2 ***
27821621-G-A 25675474-G-A P1_Y2 ***
27821647-C-A 25675500-C-A P1_Y2 ***
27821655-A-T 25675508-A-T P1_Y2 ***
27585901-G-T 25439754-G-T P1_Y2 ***
27389623-G-T 25243476-G-T P1_g3 ***
27376547-G-A 25230400-G-A P1_g3 ***
27076984-A-T 24930837-A-T P1_r4 ***
27077083-G-T 24930936-G-T P1_r4 ***
27873413-A-T 25727266-A-T P1_Y2 ***
27153877-C-A 25007730-C-A P1_g3 ***
27152351-G-T 25006204-G-T P1_g3 ***
27883134-G-T 25736987-G-T P1_Y2 ***
27149804-C-T 25003657-C-T P1_g3 ***
27112239-A-G 24966092-A-G P1_r4 ***
27095967-A-T 24949820-A-T P1_r4 ***
27095842-C-A 24949695-C-A P1_r4 ***
27077092-A-T 24930945-A-T P1_r4 ***
27077090-G-T 24930943-G-T P1_r4 ***
27077088-A-T 24930941-A-T P1_r4 ***
27077086-G-T 24930939-G-T P1_r4 ***
27960955-C-A 25814808-C-A P1_Y2 ***
27960994-G-T 25814847-G-T P1_Y2 ***
27155175-T-C 25009028-T-C P1_g3 ***
27077080-A-T 24930933-A-T P1_r4 ***
27077077-C-T 24930930-C-T P1_r4 ***
27077074-A-T 24930927-A-T P1_r4 ***
27962620-C-A 25816473-C-A P1_Y2 ***
27077073-C-T 24930926-C-T P1_r4 ***
27077069-C-T 24930922-C-T P1_r4 ***
27077067-A-T 24930920-A-T P1_r4 ***
27077063-C-T 24930916-C-T P1_r4 ***
27810366-A-G 25664219-A-G P1_Y2 ***
27077052-C-T 24930905-C-T P1_r4 ***
27077049-A-T 24930902-A-T P1_r4 ***
27076993-A-G 24930846-A-G P1_r4 ***
27076992-G-A 24930845-G-A P1_r4 ***
27864409-T-G 25718262-T-G P1_Y2 ***
27160574-A-G 25014427-A-G P1_g3 ***
27861760-G-A 25715613-G-A P1_Y2 ***
27263859-T-A 25117712-T-A P1_g3 ***
27375745-G-T 25229598-G-T P1_g3 ***
27373452-G-T 25227305-G-T P1_g3 ***
27368678-G-T 25222531-G-T P1_g3 ***
27357533-G-T 25211386-G-T P1_g3 ***
27337438-G-T 25191291-G-T P1_g3 ***
27320074-A-T 25173927-A-T P1_g3 ***
27318959-A-G 25172812-A-G P1_g3 ***
27316296-G-T 25170149-G-T P1_g3 ***
27313049-G-T 25166902-G-T P1_g3 ***
27306088-T-C 25159941-T-C P1_g3 ***
27305957-A-C 25159810-A-C P1_g3 ***
27277091-G-T 25130944-G-T P1_g3 ***
27273083-G-T 25126936-G-T P1_g3 ***
27256350-G-T 25110203-G-T P1_g3 ***
27161900-T-C 25015753-T-C P1_g3 ***
27861761-G-T 25715614-G-T P1_Y2 ***
27861763-C-A 25715616-C-A P1_Y2 ***
27253583-G-A 25107436-G-A P1_g3 ***
27248618-T-C 25102471-T-C P1_g3 ***
27248599-G-T 25102452-G-T P1_g3 ***
27235863-A-G 25089716-A-G P1_g3 ***
27190371-G-A 25044224-G-A P1_g3 ***
27190326-G-T 25044179-G-T P1_g3 ***
27186374-T-A 25040227-T-A P1_g3 ***
27186372-C-A 25040225-C-A P1_g3 ***
26397738-C-A 24251591-C-A P1_Y1 ***
27861765-C-A 25715618-C-A P1_Y2 ***
27173542-A-T 25027395-A-T P1_g3 ***
27179602-G-A 25033455-G-A P1_g3 ***
25971882-G-A 23825735-G-A P1_Y1 ***
26341611-G-T 24195464-G-T P1_Y1 ***
24582507-T-C 22436360-T-C P3_t2 ***
24671340-T-A 22525193-T-A P3_b2 ***
24662327-A-T 22516180-A-T P3_b2 ***
24662316-G-T 22516169-G-T P3_b2 ***
24658533-C-A 22512386-C-A P3_b2 ***
24654545-T-G 22508398-T-G P3_b2 ***
24650358-A-T 22504211-A-T P3_b2 ***
24646514-C-G 22500367-C-G P3_b2 ***
24646511-C-T 22500364-C-T P3_b2 ***
24637332-G-T 22491185-G-T P3_t2 ***
24614217-G-A 22468070-G-A P3_t2 ***
24614214-G-A 22468067-G-A P3_t2 ***
24614213-T-A 22468066-T-A P3_t2 ***
24597883-A-G 22451736-A-G P3_t2 ***
24582513-T-A 22436366-T-A P3_t2 ***
24582496-T-A 22436349-T-A P3_t2 ***
24675559-C-T 22529412-C-T P3_b2 ***
24536673-T-G 22390526-T-G P3_t2 ***
24277959-G-T 22131812-G-T P3_b1 ***
24304614-C-A 22158467-C-A P3_t1 ***
24404860-G-T 22258713-G-T ***
24421959-C-A 22275812-C-A ***
24424134-A-C 22277987-A-C ***
24450441-C-A 22304294-C-A ***
24544316-G-T 22398169-G-T P3_t2 ***
24582459-C-A 22436312-C-A P3_t2 ***
24545418-T-A 22399271-T-A P3_t2 ***
24549598-T-C 22403451-T-C P3_t2 ***
24553601-G-C 22407454-G-C P3_t2 ***
24554491-A-G 22408344-A-G P3_t2 ***
24582433-C-T 22436286-C-T P3_t2 ***
24582443-C-T 22436296-C-T P3_t2 ***
24671362-T-C 22525215-T-C P3_b2 ***
24676224-T-A 22530077-T-A P3_b2 ***
24240655-G-T 22094508-G-T P3_b1 ***
24792997-G-A 22646850-G-A P3_b2 ***
24775451-C-A 22629304-C-A P3_b2 ***
24783211-C-A 22637064-C-A P3_b2 ***
24783919-C-A 22637772-C-A P3_b2 ***
24785248-C-T 22639101-C-T P3_b2 ***
24789868-G-A 22643721-G-A P3_b2 9×A***
24789887-G-A 22643740-G-A P3_b2 ***
24804031-C-T 22657884-C-T P3_b2 ***
24773074-C-A 22626927-C-A P3_b2 ***
24804789-C-A 22658642-C-A P3_b2 ***
24804989-G-T 22658842-G-T P3_b2 ***
24805089-C-A 22658942-C-A P3_b2 ***
24830382-T-A 22684235-T-A P3_b2 ***
24841095-T-G 22694948-T-G P3_b2 ***
24847505-G-A 22701358-G-A P3_b2 ***
24774813-G-T 22628666-G-T P3_b2 ***
24768531-A-T 22622384-A-T P3_b2 ***
24677146-C-A 22530999-C-A P3_b2 ***
24714945-G-T 22568798-G-T P3_b2 ***
24681586-A-C 22535439-A-C P3_b2 ***
24681670-A-C 22535523-A-C P3_b2 ***
24681699-A-C 22535552-A-C P3_b2 ***
24683148-A-G 22537001-A-G P3_b2 ***
24683155-T-C 22537008-T-C P3_b2 ***
24691941-G-T 22545794-G-T P3_b2 ***
24728524-A-G 22582377-A-G P3_b2 ***
24760548-T-C 22614401-T-C P3_b2 ***
24728627-A-T 22582480-A-T P3_b2 ***
24735589-T-A 22589442-T-A P3_b2 ***
24741927-A-G 22595780-A-G P3_b2 ***
24742345-C-A 22596198-C-A P3_b2 ***
24759977-C-G 22613830-C-G P3_b2 ***
24760535-C-A 22614388-C-A P3_b2 ***
24276005-C-A 22129858-C-A P3_b1 ***
24240641-G-T 22094494-G-T P3_b1 ***
24859158-T-G 22713011-T-G P3_b2 ***
23862618-C-A 21700732-C-A ***
23599998-C-T 21438112-C-T ***
23693642-T-C 21531756-T-C ***
23801720-T-A 21639834-T-A ***
23807176-T-C 21645290-T-C ***
23831311-A-T 21669425-A-T ***
23831331-A-G 21669445-A-G ***
23862627-C-A 21700741-C-A ***
23475543-G-T 21313657-G-T ***
23888988-C-A 21727102-C-A ***
24017363-C-A 21871216-C-A ***
24025019-T-G 21878872-T-G ***
24027369-C-A 21881222-C-A ***
24027646-A-G 21881499-A-G ***
24030803-T-A 21884656-T-A ***
23588517-C-A 21426631-C-A ***
23447037-G-T 21285151-G-T ***
24036272-A-G 21890125-A-G ***
23098798-C-A 20936912-C-A ***
22816184-C-A 20654298-C-A ***
22842923-C-A 20681037-C-A ***
22953182-C-T 20791296-C-T ***
23005345-C-A 20843459-C-A ***
23013835-C-T 20851949-C-T ***
23054445-G-T 20892559-G-T ***
23098809-T-A 20936923-T-A ***
23435736-A-G 21273850-A-G ***
23098810-C-T 20936924-C-T ***
23311272-C-T 21149386-C-T 15×T***
23391621-A-C 21229735-A-C ***
23391622-C-T 21229736-C-T ***
23391623-T-G 21229737-T-G ***
23412586-C-A 21250700-C-A ***
24034817-C-A 21888670-C-A ***
24042692-A-T 21896545-A-T ***
24240578-T-G 22094431-T-G P3_b1 ***
24235338-G-A 22089191-G-A P3_b1 ***
24235304-A-T 22089157-A-T P3_b1 ***
24235315-C-A 22089168-C-A P3_b1 ***
24235322-G-A 22089175-G-A P3_b1 ***
24235325-C-A 22089178-C-A P3_b1 ***
24235331-G-A 22089184-G-A P3_b1 ***
24235336-G-A 22089189-G-A P3_b1 ***
24235342-G-A 22089195-G-A P3_b1 ***
24235302-A-T 22089155-A-T P3_b1 ***
24235348-C-A 22089201-C-A P3_b1 ***
24235368-C-A 22089221-C-A P3_b1 ***
24235372-G-A 22089225-G-A P3_b1 ***
24235493-T-A 22089346-T-A P3_b1 ***
24235503-T-A 22089356-T-A P3_b1 ***
24239964-C-A 22093817-C-A P3_b1 ***
24235303-A-T 22089156-A-T P3_b1 ***
24235300-A-C 22089153-A-C P3_b1 ***
24042752-C-T 21896605-C-T ***
24069668-G-A 21923521-G-A P3_b1 ***
24043267-T-C 21897120-T-C ***
24043551-A-G 21897404-A-G ***
24043821-G-A 21897674-G-A ***
24045534-G-T 21899387-G-T ***
24069663-T-A 21923516-T-A P3_b1 ***
24069664-C-A 21923517-C-A P3_b1 ***
24104898-G-T 21958751-G-T P3_b1 ***
24235299-A-T 22089152-A-T P3_b1 ***
24161555-C-A 22015408-C-A P3_b1 ***
24192065-T-A 22045918-T-A P3_b1 ***
24192260-G-A 22046113-G-A P3_b1 ***
24233717-C-A 22087570-C-A P3_b1 ***
24235288-T-G 22089141-T-G P3_b1 ***
24235290-G-T 22089143-G-T P3_b1 ***
24849275-T-A 22703128-T-A P3_b2 ***
24859162-C-A 22713015-C-A P3_b2 ***
26320146-C-A 24173999-C-A P1_Y1 ***
25656165-G-T 23510018-G-T P1_b3 ***
25717349-A-T 23571202-A-T P1_b3 ***
25717346-T-A 23571199-T-A P1_b3 ***
25709382-C-T 23563235-C-T P1_b3 ***
25709374-C-T 23563227-C-T P1_b3 ***
25709363-G-T 23563216-G-T P1_b3 ***
25709314-A-T 23563167-A-T P1_b3 ***
25709290-C-T 23563143-C-T P1_b3 ***
25670888-C-A 23524741-C-A P1_b3 ***
25658058-C-T 23511911-C-T P1_b3 ***
25658052-C-T 23511905-C-T P1_b3 ***
25658050-C-T 23511903-C-T P1_b3 ***
25658049-A-T 23511902-A-T P1_b3 ***
25658041-G-T 23511894-G-T P1_b3 ***
25657367-C-A 23511220-C-A P1_b3 ***
25652525-A-G 23506378-A-G P1_b3 ***
25717503-T-A 23571356-T-A P1_b3 ***
25524831-T-A 23378684-T-A P1_gr1 ***
25524802-G-A 23378655-G-A P1_gr1 ***
25524809-T-C 23378662-T-C P1_gr1 ***
25524810-G-C 23378663-G-C P1_gr1 ***
25524819-G-T 23378672-G-T P1_gr1 ***
25524825-G-C 23378678-G-C P1_gr1 ***
25524828-T-C 23378681-T-C P1_gr1 ***
25524832-G-T 23378685-G-T P1_gr1 ***
25652499-T-A 23506352-T-A P1_b3 ***
25524833-A-T 23378686-A-T P1_gr1 ***
25524843-A-T 23378696-A-T P1_gr1 ***
25524847-C-T 23378700-C-T P1_gr1 ***
25555829-C-A 23409682-C-A P1_gr1 ***
25575328-C-A 23429181-C-A P1_gr1 ***
25626874-T-A 23480727-T-A P1_b3 ***
25717387-G-A 23571240-G-A P1_b3 ***
25717533-T-C 23571386-T-C P1_b3 ***
25524794-G-C 23378647-G-C P1_gr1 ***
26144677-A-G 23998530-A-G P1_Y1 ***
25990667-A-G 23844520-A-G P1_Y1 ***
26029732-A-T 23883585-A-T P1_Y1 ***
26097947-T-A 23951800-T-A P1_Y1 ***
26100746-C-G 23954599-C-G P1_Y1 ***
26100747-A-G 23954600-A-G P1_Y1 ***
26135828-C-A 23989681-C-A P1_Y1 ***
26149755-A-G 24003608-A-G P1_Y1 ***
25971899-G-A 23825752-G-A P1_Y1 ***
26228797-G-T 24082650-G-T P1_Y1 ***
26248017-G-A 24101870-G-A P1_Y1 ***
26277719-A-T 24131572-A-T P1_Y1 ***
26277811-G-A 24131664-G-A P1_Y1 ***
26279901-C-A 24133754-C-A P1_Y1 ***
26283421-C-A 24137274-C-A P1_Y1 ***
25987993-G-A 23841846-G-A P1_Y1 ***
25971898-G-A 23825751-G-A P1_Y1 ***
25719936-G-A 23573789-G-A P1_b3 ***
25804982-C-A 23658835-C-A P1_b3 ***
25762973-T-C 23616826-T-C P1_b3 ***
25766507-A-G 23620360-A-G P1_b3 ***
25766639-A-C 23620492-A-C P1_b3 ***
25780960-G-T 23634813-G-T P1_b3 ***
25791870-G-T 23645723-G-T P1_b3 ***
25804981-A-C 23658834-A-C P1_b3 ***
25804986-G-T 23658839-G-T P1_b3 ***
28117217-C-T 25971070-C-T P1_b4 ***
25831891-A-T 23685744-A-T P1_b3 ***
25831973-G-T 23685826-G-T P1_b3 ***
25845005-A-G 23698858-A-G P1_b3 ***
25845059-G-A 23698912-G-A P1_b3 ***
25883630-C-T 23737483-C-T P1_Y1 17×T***
25883669-C-T 23737522-C-T P1_Y1 11×T***
25524797-T-C 23378650-T-C P1_gr1 ***
25524793-G-C 23378646-G-C P1_gr1 ***
24859795-T-A 22713648-T-A P3_b2 ***
25232809-C-T 23086662-C-T P2_r1 ***
25231937-T-G 23085790-T-G P2_r1 ***
25232771-C-T 23086624-C-T P2_r1 ***
25232783-A-C 23086636-A-C P2_r1 ***
25232790-T-C 23086643-T-C P2_r1 ***
25232792-T-C 23086645-T-C P2_r1 ***
25232802-G-T 23086655-G-T P2_r1 ***
25246492-A-T 23100345-A-T P2_r1 ***
25225284-T-A 23079137-T-A P2_r1 ***
25253452-G-T 23107305-G-T P2_r1 ***
25270233-C-A 23124086-C-A P2_r1 ***
25327662-T-A 23181515-T-A P2_r1 ***
25327934-G-A 23181787-G-A P2_r1 ***
25327947-G-A 23181800-G-A P2_r1 ***
25333856-C-T 23187709-C-T P2_r1 32×T***
25231936-T-G 23085789-T-G P2_r1 ***
25207626-A-C 23061479-A-C P2_r1 ***
25364374-T-C 23218227-T-C P2_r2 ***
25146697-C-A 23000550-C-A g1 ***
24864679-G-T 22718532-G-T P3_b2 ***
24895738-A-T 22749591-A-T g1 ***
24895744-A-T 22749597-A-T g1 ***
24895745-G-T 22749598-G-T g1 ***
24895774-A-G 22749627-A-G g1 ***
24898661-A-C 22752514-A-C g1 ***
25176894-G-C 23030747-G-C g1 ***
25176967-A-T 23030820-A-T g1 ***
25176902-G-C 23030755-G-C g1 ***
25176913-A-G 23030766-A-G g1 ***
25176925-C-T 23030778-C-T g1 ***
25176933-G-C 23030786-G-C g1 ***
25176952-T-C 23030805-T-C g1 ***
25176962-A-G 23030815-A-G g1 ***
25333944-A-T 23187797-A-T P2_r1 ***
25366651-T-C 23220504-T-C P2_r2 ***
25524791-T-C 23378644-T-C P1_gr1 ***
25502017-C-A 23355870-C-A P1_gr1 ***
25466485-T-A 23320338-T-A P2_r2 ***
25466495-C-A 23320348-C-A P2_r2 ***
25466500-T-A 23320353-T-A P2_r2 ***
25471048-G-T 23324901-G-T P2_r2 ***
25492215-C-A 23346068-C-A P2_r2 ***
25500157-T-G 23354010-T-G P2_r2 ***
25511923-C-A 23365776-C-A P1_gr1 ***
25461588-A-T 23315441-A-T P2_r2 ***
25524747-A-C 23378600-A-C P1_gr1 ***
25524772-A-T 23378625-A-T P1_gr1 ***
25524777-A-C 23378630-A-C P1_gr1 ***
25524780-T-C 23378633-T-C P1_gr1 ***
25524782-A-C 23378635-A-C P1_gr1 ***
25524785-G-C 23378638-G-C P1_gr1 ***
25466471-G-C 23320324-G-C P2_r2 ***
25461557-T-A 23315410-T-A P2_r2 ***
25366662-C-A 23220515-C-A P2_r2 ***
25429116-C-A 23282969-C-A P2_r2 ***
25370510-G-T 23224363-G-T P2_r2 ***
25385232-T-A 23239085-T-A P2_r2 ***
25385373-C-T 23239226-C-T P2_r2 ***
25388683-T-A 23242536-T-A P2_r2 ***
25425520-T-C 23279373-T-C P2_r2 ***
25427009-A-G 23280862-A-G P2_r2 ***
25431645-C-A 23285498-C-A P2_r2 ***
25461553-C-A 23315406-C-A P2_r2 ***
25437892-C-A 23291745-C-A P2_r2 ***
25446361-G-T 23300214-G-T P2_r2 ***
25446440-C-T 23300293-C-T P2_r2 21×T***
25453324-C-G 23307177-C-G P2_r2 ***
25454057-T-A 23307910-T-A P2_r2 ***
25454092-A-C 23307945-A-C P2_r2 ***
28117207-A-T 25971060-A-T P1_b4 ***
28253470-T-A 26107323-T-A P1_b4 ***
28117222-C-T 25971075-C-T P1_b4 ***
21477860-A-AAAGC 19315974-A-AAAGC ***
23519572-TA-T 21357686-TA-T ***
23435202-C-TTT 21273316-C-TTT ***
23196627-TAAAA-T 21034741-TAAAA-T 17×A***
22481607-TT-CG 20319721-TT-CG DYZ19 ***
22358161-GT-TC 20196275-GT-TC DYZ19 ***
22358088-TTACC-CTACT 20196202-TTACC-CTACT DYZ19 ***
22353065-AATAAT-CCGACC 20191179-AATAAT-CCGACC DYZ19 ***
22293412-CCTTA-GCTC 20131526-CCTTA-GCTC DYZ19 ***
22256886-ATTTACG-TTTGTTC 20095000-ATTTACG-TTTGTTC DYZ19 ***
22244982-GTTATATCCAGAGT-CTGCAGCATCATTC 20083096-GTTATATCCAGAGT-CTGCAGCATCATTC DYZ19 ***
22236252-GACC-CACA 20074366-GACC-CACA DYZ19 ***
22113187-CAAAAAAA-C 19951301-CAAAAAAA-C 23×A***
22023684-GTTTT-G 19861798-GTTTT-G 17×T***
21853659-GACGACAGAG-AACAACAAAA 19691773-GACGACAGAG-AACAACAAAA ***
21477840-A-AAAGT 19315954-A-AAAGT ***
24017408-G-GT 21871261-G-GT 12×T***
20975335-G-GA 18813449-G-GA P4_Dst ***
20868952-TA-T 18707066-TA-T P4_Dst 12×A***
20871048-CT-C 18709162-CT-C P4_Dst 8×T***
20875153-C-CT 18713267-C-CT P4_Dst 10×T***
20888588-TAA-T 18726702-TAA-T P4_Dst 15×A***
20894542-GA-G 18732656-GA-G P4_Dst ***
20966227-GAA-G 18804341-GAA-G P4_Dst 11×A***
20993598-CAA-C 18831712-CAA-C P4_Dst 17×A***
21477816-A-AAAGG 19315930-A-AAAGG ***
21003227-G-GTTT 18841341-G-GTTT P4_Dst 14×T***
21008974-GTTTTTA-G 18847088-GTTTTTA-G P4_Dst ***
21008982-TAC-T 18847096-TAC-T P4_Dst ***
21008990-TCA-T 18847104-TCA-T P4_Dst ***
21251809-T-TA 19089923-T-TA ***
21402181-CTTT-C 19240295-CTTT-C 34×T***
24015843-CTCTTCT-C 21869696-CTCTTCT-C 5×TCT***
24027722-TCA-T 21881575-TCA-T ***
20717038-TC-AA 18555152-TC-AA P4_Prx ***
24750181-GT-G 22604034-GT-G P3_b2 ***
24665751-TA-T 22519604-TA-T P3_b2 ***
24667645-CT-C 22521498-CT-C P3_b2 ***
24671142-C-CA 22524995-C-CA P3_b2 14×A***
24685101-GTTTTTTTATATATGTATATATTTGTATA-G 22538954-GTTTTTTTATATATGTATATATTTGTATA-G P3_b2 ***
24735797-C-CT 22589650-C-CT P3_b2 8×T***
24739651-CTT-C 22593504-CTT-C P3_b2 13×T***
24754582-C-AA 22608435-C-AA P3_b2 ***
24660489-GCCTTACT-G 22514342-GCCTTACT-G P3_b2 ***
24759302-AT-A 22613155-AT-A P3_b2 9×T***
24779006-CGGA-GGGG 22632859-CGGA-GGGG P3_b2 ***
24779904-AC-A 22633757-AC-A P3_b2 ***
24785337-CCT-C 22639190-CCT-C P3_b2 ***
24792898-AGAGTCCTTGCGGG-A 22646751-AGAGTCCTTGCGGG-A P3_b2 ***
24793957-CTGGGG-C 22647810-CTGGGG-C P3_b2 ***
24662318-CTAA-TTAT 22516171-CTAA-TTAT P3_b2 ***
24654094-TTG-T 22507947-TTG-T P3_b2 ***
24028762-C-TGAGTTAAT 21882615-C-TGAGTTAAT ***
24577878-CAA-C 22431731-CAA-C P3_t2 25×A***
24032362-G-GA 21886215-G-GA ***
24033727-ATTT-A 21887580-ATTT-A ***
24052805-C-CT 21906658-C-CT P3_b1 10×T***
24542285-CA-C 22396138-CA-C P3_t2 8×A***
24545449-T-TC 22399302-T-TC P3_t2 ***
24552391-C-CT 22406244-C-CT P3_t2 ***
24587333-A-AT 22441186-A-AT P3_t2 9×T***
24643210-CTTCTA-TTTTTT 22497063-CTTCTA-TTTTTT P3_t2 ***
24597813-CT-C 22451666-CT-C P3_t2 22×T***
24601759-GT-G 22455612-GT-G P3_t2 11×T***
24607321-CTTTT-C 22461174-CTTTT-C P3_t2 12×T***
24626441-AT-A 22480294-AT-A P3_t2 10×T***
24638020-C-CA 22491873-C-CA P3_t2 10×A***
24641828-A-AT 22495681-A-AT P3_t2 ***
20850693-G-GTA 18688807-G-GTA P4_Dst 12×TA***
20602145-CTTTTTATGGC-ACTATAAATTA 18440259-CTTTTTATGGC-ACTATAAATTA P5_Dst ***
24803075-CTCCA-C 22656928-CTCCA-C P3_b2 ***
19682387-GAAA-G 17570507-GAAA-G P5_Prx ***
18926872-CAA-C 16814992-CAA-C 17×A***
19113723-TAAA-T 17001843-TAAA-T 28×A***
19124920-CTTTT-C 17013040-CTTTT-C 15×T***
19359822-CACACATACATATATACA-TGTATATATGTATGTGTG 17247942-CACACATACATATATACA-TGTATATATGTATGTGTG ***
19359857-TA-GTATTGTG 17247977-TA-GTATTGTG ***
19647571-CTTT-C 17535691-CTTT-C P5_Prx 16×T***
19739799-G-GA 17627919-G-GA P5_Prx 16×A***
18487171-A-AT 16375291-A-AT P6_Dst ***
19745475-CTT-C 17633595-CTT-C P5_Prx 18×T***
19765959-GCCCACCA-CCCCCCCC 17654079-GCCCACCA-CCCCCCCC P5_Prx ***
19925893-T-TA 17814013-T-TA P5_Prx 13×A***
19987682-GT-G 17875802-GT-G P5_Prx 15×T***
20045224-AAAAAAAAAAAAAAA-GAACAAGACCCTGTC 17933344-AAAAAAAAAAAAAAA-GAACAAGACCCTGTC P5_Prx ***
20081154-TA-T 17969274-TA-T P5_Dst ***
18513323-TA-T 16401443-TA-T P6_Dst 8×A***
18453796-TA-T 16341916-TA-T P6_Dst 8×A***
20096718-CA-C 17984838-CA-C P5_Dst 10×A***
20084540-T-G 17972660-T-G P5_Dst ***
13869553-TGGTAT-GGAATG 11748847-TGGTAT-GGAATG ***
14026022-G-GAAAT 11905316-G-GAAAT ***
14339106-CTTTT-C 12218401-CTTTT-C 19×T***
14937835-T-TTTCTTTTCTC 12825910-T-TTTCTTTTCTC ***
15157860-CAAAAAAAA-C 13045947-CAAAAAAA-C 21×A***
15171226-CTTTTT-C 13059312-CTTTTT-C 19×T***
15423440-ACT-CCC 13311560-ACT-CCC ***
18439292-TCG-CCC 16327412-TCG-CCC P6_Dst ***
16119964-T-TTTCG 14008084-T-TTTCG P8_Prx ***
16119970-T-TCTTG 14008090-T-TCTTG P8_Prx ***
16148183-C-CTT 14036303-C-CTT P8_Dst 27×T***
16150948-TAA-T 14039068-TAA-T P8_Dst 22×A***
16595919-CTTT-C 14484039-CTTT-C 17×T***
17994851-CAAA-C 15882971-CAAA-C P7_Prx 17×A***
20082755-AT-A 17970875-AT-A P5_Dst 9×T***
20097620-A-AT 17985740-A-AT P5_Dst 9×T***
20602137-TTTTTTT-CTCTATA 18440251-TTTTTTT-CTCTATA P5_Dst ***
20530282-C-CAAAAAAAA 18368396-C-CAAAAAAAA P5_Dst ***
20434280-TAA-T 18272394-TAA-T P5_Dst 18×A***
20442453-GA-G 18280567-GA-G P5_Dst 11×A***
20449946-GA-G 18288060-GA-G P5_Dst ***
20479152-CTTTTTTAGTTACTTTTGTTATCATT-C 18317266-CTTTTTTAGTTACTTTTGTTATCATT-C P5_Dst ***
20479819-A-AT 18317933-A-AT P5_Dst 14×T***
20495619-CT-C 18333733-CT-C P5_Dst ***
20530293-CA-TG 18368407-CA-TG P5_Dst ***
20378391-CTT-C 18216505-CTT-C P5_Dst ***
20567702-AT-A 18405816-AT-A P5_Dst 10×T***
20579119-C-CAT 18417233-C-CAT P5_Dst ***
20584677-TAAATACAAGTA-T 18422791-TAAATACAAGTA-T P5_Dst ***
20593055-CA-C 18431169-CA-C P5_Dst 22×A***
20602008-AAAAGAGAA-GTAAAAAAG 18440122-AAAAGAGAA-GTAAAAAAG P5_Dst ***
20602125-AATG-CAAA 18440239-AATG-CAAA P5_Dst ***
20387096-GA-G 18225210-GA-G P5_Dst 11×A***
20368108-CTTT-C 18206222-CTTT-C P5_Dst 22×T***
20097820-TTTC-T 17985940-TTTC-T P5_Dst 5×TTC***
20213957-TA-T 18052071-TA-T P5_Dst ***
20112192-TCTTGTCCATCAGCCTGGAACCTGGACCTCAGGCTGTAA-T 18000312-TCTTGTCCATCAGCCTGGAACCTGGACCTCAGGCTGTAA-T P5_Dst ***
20142089-CAAGA-AAAAC 18030209-CAAGA-AAAAC P5_Dst ***
20195543-G-GA 18033657-G-GA P5_Dst 10×A***
20205142-CT-C 18043256-CT-C P5_Dst ***
20207102-C-CA 18045216-C-CA P5_Dst 10×A***
20212297-C-CA 18050411-C-CA P5_Dst 16×A***
20217548-C-CT 18055662-C-CT P5_Dst ***
20362564-C-CTT 18200678-C-CTT P5_Dst 11×T***
20223521-CA-C 18061635-CA-C P5_Dst ***
20232462-CC-TG 18070576-CC-TG P5_Dst ***
20232493-AGAGA-GGAGT 18070607-AGAGA-GGAGT P5_Dst ***
20323695-CT-C 18161809-CT-C P5_Dst 9×T***
20334605-GA-G 18172719-GA-G P5_Dst ***
20360957-A-ATT 18199071-A-ATT P5_Dst 10×T***
24796652-G-GT 22650505-G-GT P3_b2 8×T***
24860879-TTAATAACAATGATACAATAAACA-T 22714732-TTAATAACAATGATACAATAAACA-T P3_b2 ***
13869419-GGAATG-TGACTC 11748713-GGAATG-TGACTC ***
28142037-A-AT 25995890-A-AT P1_b4 9×T***
58822358-ATTCCATTCCT-A 56768498-AGGAAAGGAAT-A ***
58822238-AT-A 56768625-GA-G ***
58821640-TCG-AAC 56769229-CGA-GTT ***
58821633-TTTCGT-ATTCTA 56769233-ACGAAA-TAGAAT ***
58819638-C-CT 56771229-G-GA ***
28803746-GCAG-ACAA 26657599-GCAG-ACAA ***
28392034-AT-A 26245887-AT-A P1_gr2 ***
28315828-CTGTG-C 26169681-CTGTG-C P1_b4 21×TG***
28245714-A-ATT 26099567-A-ATT P1_b4 15×T***
28229322-TA-T 26083175-TA-T P1_b4 17×A***
28184488-ATAT-A 26038341-ATAT-A P1_b4 14×TAT***
28175354-C-CAA 26029207-C-CAA P1_b4 ***
28146580-AT-A 26000433-AT-A P1_b4 10×T***
28142055-AT-A 25995908-AT-A P1_b4 ***
28078316-T-TA 25932169-T-TA P1_Y2 10×A***
58834871-TTTCCA-T 56755981-CGAATG-C ***
27916437-CAAACAGAATGAAACAC-AAAAAAAAAAAAAAAAA 25770290-CAAACAGAATGAAACAC-AAAAAAAAAAAAAAAAA P1_Y2 ***
27761167-TA-T 25615020-TA-T P1_Y2 ***
27777099-GT-G 25630952-GT-G P1_Y2 9×T***
27809575-TT-AA 25663428-TT-AA P1_Y2 ***
27815070-C-CT 25668923-C-CT P1_Y2 10×T***
27904476-C-CT 25758329-C-CT P1_Y2 11×T***
27909316-GA-G 25763169-GA-G P1_Y2 ***
27937952-TCAGGAAAATCCTTCAAAAATCCATGAATC-T 25791805-TCAGGAAAATCCTTCAAAAATCCATGAATC-T P1_Y2 ***
28015149-CAA-C 25869002-CAA-C P1_Y2 9×A***
27942188-CAGAGAGA-C 25796041-CAGAGAGA-C P1_Y2 ***
27962556-AT-A 25816409-AT-A P1_Y2 8×T***
27968354-C-CT 25822207-C-CT P1_Y2 14×T***
27978560-ATT-A 25832413-ATT-A P1_Y2 14×T***
27997713-CAGGCAGAG-AAAAAAAAA 25851566-CAGGCAGAG-AAAAAAAAA P1_Y2 ***
28007101-GAAAACTTCC-G 25860954-GAAAACTTCC-G P1_Y2 ***
58826874-CCATTG-C 56763987-GAATGC-G ***
58848072-GA-TC 56742798-TC-GA ***
27745674-T-TA 25599527-T-TA P1_Y2 12×A***
58982249-ACTG-TCTC 56836102-ACTG-TCTC ***
58981288-TTG-CTT 56835141-TTG-CTT ***
58981662-CC-AA 56835515-CC-AA ***
58981677-ACA-CCT 56835530-ACA-CCT ***
58981697-GATCC-TATCT 56835550-GATCC-TATCT ***
58981831-A-ATTCTT 56835684-A-ATTCTT ***
58982078-CTCAAT-C 56835931-CTCAAT-C ***
59004463-A-AAAAGAAAGAAAGAAAG 56858316-A-AAAAGAAAGAAAGAAAG 15×AAAG***
58978672-T-TCCACC 56832525-T-TCCACC ***
59030498-C-CAAAA 56884351-C-CAAAA ***
59030568-T-TTTAA 56884421-T-TTTAA ***
8555568-T-TGTTTTC 8687527-T-TGTTTTC ***
14937826-T-TTCTTTTCTTG 12825901-T-TTCTTTTCTTG ***
14937858-C-CTTTTCTTTTA 12825933-C-CTTTTCTTTTA ***
27579076-TC-T 25432929-TC-T P1_Y2 ***
58978713-AA-GC 56832566-AA-GC ***
58977556-TGT-CAC 56831409-TGT-CAC ***
58855276-ACCATTCC-TCGAGTCG 56735588-GGAATGGT-CGACTCGA ***
58973093-GC-CG 56826946-GC-CG ***
58855325-TTC-ATT 56735544-GAA-AAT ***
58855332-G-GCACACGGGTT 56735536-A-ATGAACCCGTG 4×CATTC***
58858832-CAGTCCATTACTATCCA-GGGTTGATTCCATTGCT 56732023-TGGATAGTAATGGACTG-AGCAATGGAATCAACCC ***
58858936-GCACTCC-AGGATTG 56731929-GGAGTGC-CAATCCT ***
58858951-ACATTCTACTCTA-GACAGGATCTCAC 56731908-TAGAGTAGAATGT-GTGAGATCCTGTC ***
58972725-GATTCT-CAGTCC 56826578-GATTCT-CAGTCC ***
58974210-CA-TG 56828063-CA-TG ***
58977241-TT-CA 56831094-TT-CA ***
58975770-CT-TG 56829623-CT-TG ***
58975933-TACTTCACCTCA-CATTGCATTCGT 56829786-TACTTCACCTCA-CATTGCATTCGT ***
58976377-TTA-CTC 56830230-TTA-CTC ***
58976384-ACATTCCATTGCA-CCAAACCACTCCT 56830237-ACATTCCATTGCA-CCAAACCACTCCT ***
58976964-CTCCAC-A 56830817-CTCCAC-A ***
58977126-TTCCG-CTCCA 56830979-TTCCG-CTCCA ***
27756148-ACAC-A 25610001-ACAC-A P1_Y2 ***
27739907-GAA-G 25593760-GAA-G P1_Y2 10×A***
25250612-GGTGTGTGT-G 23104465-GGTGTGTGT-G P2_r1 21×GT***
25670996-GGGTCT-G 23524849-GGGTCT-G P1_b3 ***
25473356-TTTATTAATCAAGCTTCATTA-T 23327209-TTTATTAATCAAGCTTCATTA-T P2_r2 ***
25490732-CA-C 23344585-CA-C P2_r2 ***
25524836-AGC-TGT 23378689-AGC-TGT P1_gr1 ***
25658036-G-TTT 23511889-G-TTT P1_b3 ***
25662111-TAA-T 23515964-TAA-T P1_b3 14×A***
25668660-C-CT 23522513-C-CT P1_b3 9×T***
25689959-TA-T 23543812-TA-T P1_b3 13×A***
25460675-TATA-T 23314528-TATA-T P2_r2 13×ATA***
25698641-ATG-A 23552494-ATG-A P1_b3 8×TG***
25763125-TA-T 23616978-TA-T P1_b3 9×A***
25766674-CA-C 23620527-CA-C P1_b3 ***
25964715-GTTTCA-TTTTTT 23818568-GTTTCA-TTTTTT P1_Y1 ***
26228685-CTTTC-TTTTT 24082538-CTTTC-TTTTT P1_Y1 ***
26395278-G-GT 24249131-G-GT P1_Y1 11×T***
25470597-TCCTC-T 23324450-TCCTC-T P2_r2 4×CCTC***
25445580-GTA-G 23299433-GTA-G P2_r2 10×TA***
26834599-CAAAGAAAGAAAG-C 24688452-CAAAGAAAGAAAG-C P1_g2 16×AAAG***
25366915-GA-G 23220768-GA-G P2_r2 ***
25283792-TA-T 23137645-TA-T P2_r1 13×A***
25287876-TTACCGAAGAATGAAGTAGGCAGACACATAAGGAG-AGTGTAAGCAGGATCAGAGAAATTAGATGCAAGA 23141729-TTACCGAAGAATGAAGTAGGCAGACACATAAGGAG-AGTGTAAGCAGGATCAGAGAAATTAGATGCAAGA P2_r1 ***
25287915-GCTTTCATTC-CACGGGATTT 23141768-GCTTTCATTC-CACGGGATTT P2_r1 ***
25287926-CT-TA 23141779-CT-TA P2_r1 ***
25365149-TATCTCTTGAAAG-T 23219002-TATCTCTTGAAAG-T P2_r2 ***
25366671-AT-A 23220524-AT-A P2_r2 ***
25382069-GTA-G 23235922-GTA-G P2_r2 ***
25442253-AT-A 23296106-AT-A P2_r2 ***
25385362-TC-T 23239215-TC-T P2_r2 ***
25388722-G-GT 23242575-G-GT P2_r2 8×T***
25393996-ACGT-A 23247849-ACGT-A P2_r2 ***
25425541-G-GA 23279394-G-GA P2_r2 ***
25427715-GGATTT-G 23281568-GGATTT-G P2_r2 ***
25430759-CT-C 23284612-CT-C P2_r2 8×T***
26400765-A-AT 24254618-A-AT P1_Y1 11×T***
26884348-GGTGTGTGT-G 24738201-GGTGTGTGT-G P1_r3 22×GT***
27717288-TA-T 25571141-TA-T P1_Y2 ***
27412976-GTT-G 25266829-GTT-G P1_g3 ***
27315379-TA-T 25169232-TA-T P1_g3 ***
27316208-TG-T 25170061-TG-T P1_g3 ***
27316407-G-GTT 25170260-G-GTT P1_g3 9×T***
27337461-CAATTCCTTTGACA-C 25191314-CAATTCCTTTGACA-C P1_g3 ***
27344661-GA-G 25198514-GA-G P1_g3 ***
27354859-AT-A 25208712-AT-A P1_g3 8×T***
27424163-CTT-C 25278016-CTT-C P1_g3 17×T***
27253568-G-GA 25107421-G-GA P1_g3 9×A***
27564840-T-TA 25418693-T-TA P1_Y2 9×A***
27583000-C-CT 25436853-C-CT P1_Y2 22×T***
27586578-CATAA-C 25440431-CATAA-C P1_Y2 ***
27711095-G-GT 25564948-G-GT P1_Y2 8×T***
27711690-CTT-C 25565543-CTT-C P1_Y2 17×T***
27713162-AT-A 25567015-AT-A P1_Y2 ***
27256040-C-CA 25109893-C-CA P1_g3 9×A***
27248568-G-GT 25102421-G-GT P1_g3 18×T***
26893687-GA-G 24747540-GA-G P1_r3 8×A***
27070993-TA-T 24924846-TA-T P1_r4 ***
26942287-AT-A 24796140-AT-A P1_r3 ***
26943646-CA-C 24797499-CA-C P1_r3 ***
26953773-G-GA 24807626-G-GA P1_r3 ***
26990528-TG-T 24844381-TG-T P1_r4 ***
27001771-CTT-C 24855624-CTT-C P1_r4 24×T***
27042638-A-AT 24896491-A-AT P1_r4 10×T***
27076355-TATAATA-T 24930208-TATAATA-T P1_r4 9×ATA***
27248303-GA-G 25102156-GA-G P1_g3 ***
27122869-T-TA 24976722-T-TA P1_g3 8×A***
27124134-AAAGT-A 24977987-AAAGT-A P1_g3 6×AAGT***
27162085-GAC-AAA 25015938-GAC-AAA P1_g3 ***
27178881-G-GA 25032734-G-GA P1_g3 ***
27199330-GTC-G 25053183-GTC-G P1_g3 ***
27228156-GA-G 25082009-GA-G P1_g3 ***
13869512-AT-TG 11748806-AT-TG ***
13869313-TGGACTCAAAA-AGGAGTCCAAT 11748607-TGGACTCAAAA-AGGAGTCCAAT ***
28120453-A-G 25974306-A-G P1_b4 ***
58825007-C-A 56765864-G-T ***
58905385-G-A 56685486-C-T ***
58884897-T-C 56705974-A-G ***
58884875-C-A 56705996-G-T ***
58865975-G-C 56724896-C-G ***
58858972-G-A 56731899-C-T ***
58858970-T-A 56731901-A-T ***
58858968-A-T 56731903-T-A ***
58858862-C-G 56732009-G-C ***
58858855-A-T 56732016-T-A ***
58855369-A-G 56735502-T-C ***
58855367-C-T 56735504-G-A ***
58855362-G-C 56735509-C-G ***
58830518-C-T 56760353-G-A ***
58825008-T-A 56765863-A-T ***
58822432-A-T 56768439-T-A ***
58974490-A-C 56828343-A-C ***
28806578-G-T 26660431-G-T ***
28806570-A-G 26660423-A-G ***
28806571-T-A 26660424-T-A ***
28806572-T-A 26660425-T-A ***
28806573-G-T 26660426-G-T ***
28806575-A-G 26660428-A-G ***
28806577-T-A 26660430-T-A ***
28806580-A-G 26660433-A-G ***
58822425-G-T 56768446-C-A ***
28806582-T-A 26660435-T-A ***
28806583-G-T 26660436-G-T ***
28809305-T-G 26663158-T-G ***
58819772-G-C 56771099-C-G ***
58820203-C-A 56770668-G-T ***
58822217-A-T 56768654-T-A ***
58973368-G-A 56827221-G-A ***
58975940-C-T 56829793-C-T ***
28806566-G-A 26660419-G-A ***
27936764-C-CA 25790617-C-CA P1_Y2 15×A***
18499927-GA-G 16388047-GA-G P6_Dst 13×A***
9566983-CTG-C 9729374-CTG-C IR3_Prx ***
20920178-C-CA 18758292-C-CA P4_Dst 14×A***
9924014-TGACCCTGTGTGATGAATTTAT-CAACTTCGTGAGATTAATGGAC 10086405-TGACCCTGTGTGATGAATTTAT-CAACTTCGTGAGATTAATGGAC ***
13489012-ATGCCC-GTGACA 11333336-ATGCCC-GTGACA ***
58980808-TG-CA 56834661-TG-CA ***
27337691-G-GA 25191544-G-GA P1_g3 9×A***
26544618-GAT-G 24398471-GAT-G P1_g2 14×AT***
9551440-G-GT 9713831-G-GT IR3_Prx 11×T***
28103949-C-CT 25957802-C-CT P1_Y2 22×T***
13860078-TA-AC 11739372-TA-AC ***
21002535-TTCTC-T 18840649-TTCTC-T P4_Dst 16×TC***
27780449-CA-C 25634302-CA-C P1_Y2 18×A***
20917254-C-CA 18755368-C-CA P4_Dst 14×A***
14179193-GA-G 12058487-GA-G 10×A***
19449428-GA-G 17337548-GA-G 23×A***
58977244-C-A 56831097-C-A ***
59001248-A-C 56855101-A-C ***
58977246-T-C 56831099-T-C ***
58978685-A-T 56832538-A-T ***
58981532-C-A 56835385-C-A ***
58981978-T-C 56835831-T-C ***
58982234-A-T 56836087-A-T ***
58982530-C-A 56836383-C-A ***
59031853-G-T 56885706-G-T ***
10012600-TT-GG 10174991-TT-GG ***
9342865-T-TG 9505256-T-TG ***
22352949-CCGGTGA-GTGTTGC 20191063-CCGGTGA-GTGTTGC DYZ19 ***
7103038-TACAC-T 7234997-TACAC-T 17×AC***
21562049-T-TCA 19400163-T-TCA 18×CA***
14331156-TG-T 12210450-TG-T ***
27570867-CGTGT-C 25424720-CGTGT-C P1_Y2 20×GT***
28806568-G-T 26660421-G-T ***
28806565-A-G 26660418-A-G ***
13804186-CAA-AAT 11683480-CAA-AAT ***
28372840-T-C 26226693-T-C P1_gr2 ***
28184557-G-T 26038410-G-T P1_b4 ***
28225814-T-G 26079667-T-G P1_b4 ***
22793185-C-A 20631299-C-A ***
28253542-T-A 26107395-T-A P1_b4 ***
28257546-G-T 26111399-G-T P1_b4 ***
28270445-G-T 26124298-G-T P1_b4 ***
28583298-G-T 26437151-G-T ***
28175320-C-A 26029173-C-A P1_b4 ***
28583299-T-G 26437152-T-G ***
28583300-C-G 26437153-C-G ***
28583301-A-G 26437154-A-G ***
28587966-A-C 26441819-A-C ***
28608508-C-A 26462361-C-A ***
28609737-G-T 26463590-G-T ***
28184467-G-T 26038320-G-T P1_b4 ***
28170543-G-A 26024396-G-A P1_b4 ***
28687503-C-A 26541356-C-A ***
28160697-G-T 26014550-G-T P1_b4 ***
28120469-G-C 25974322-G-C P1_b4 ***
28120509-C-G 25974362-C-G P1_b4 ***
28132532-T-G 25986385-T-G P1_b4 ***
28133068-A-T 25986921-A-T P1_b4 ***
28143445-C-A 25997298-C-A P1_b4 ***
28146491-G-T 26000344-G-T P1_b4 ***
28160701-G-T 26014554-G-T P1_b4 ***
28170498-A-C 26024351-A-C P1_b4 ***
28160724-G-T 26014577-G-T P1_b4 ***
28160725-A-T 26014578-A-T P1_b4 ***
28160729-C-T 26014582-C-T P1_b4 ***
28160765-A-G 26014618-A-G P1_b4 ***
28170490-G-A 26024343-G-A P1_b4 ***
28170495-T-A 26024348-T-A P1_b4 ***
28622124-T-C 26475977-T-C ***
28733323-G-T 26587176-G-T ***
28806564-G-A 26660417-G-A ***
28806553-G-T 26660406-G-T ***
28803718-C-A 26657571-C-A ***
28803726-G-C 26657579-G-C ***
28803729-T-C 26657582-T-C ***
28803735-A-G 26657588-A-G ***
28806550-A-G 26660403-A-G ***
28806551-C-A 26660404-C-A ***
28806555-A-G 26660408-A-G ***
28800147-G-T 26654000-G-T ***
28806557-T-A 26660410-T-A ***
28806558-G-T 26660411-G-T ***
28806560-A-G 26660413-A-G ***
28806561-G-A 26660414-G-A ***
28806562-T-A 26660415-T-A ***
28806563-G-T 26660416-G-T ***
28803710-T-G 26657563-T-G ***
28797500-A-C 26651353-A-C ***
28742648-C-A 26596501-C-A ***
28784545-T-A 26638398-T-A ***
28757032-G-T 26610885-G-T ***
28773532-C-A 26627385-C-A ***
28784534-T-C 26638387-T-C ***
28784538-A-T 26638391-A-T ***
28784543-A-T 26638396-A-T ***
28784544-T-G 26638397-T-G ***
28784546-G-A 26638399-G-A ***
28796182-T-C 26650035-T-C ***
28784548-A-T 26638401-A-T ***
28787997-A-G 26641850-A-G 4×GAGTG***
28788010-G-A 26641863-G-A ***
28788012-G-T 26641865-G-T ***
28788015-G-C 26641868-G-C ***
28788018-A-C 26641871-A-C ***
9557063-TTG-T 9719454-TTG-T IR3_Prx ***
27368714-G-GA 25222567-G-GA P1_g3 10×A***
13869234-AGG-GGA 11748528-AGG-GGA ***
13489730-TGGCC-CGGCG 11334054-TGGCC-CGGCG ***
13803167-AGACTC-GGACAT 11682461-AGACTC-GGACAT ***
13801542-CGGAA-TTGAG 11680836-CGGAA-TTGAG ***
13801160-AATG-CATC 11680454-AATG-CATC ***
13799165-C-GCAATG 11678459-C-GCAATG ***
13799151-TAAT-GAAA 11678445-TAAT-GAAA ***
13799075-GGACT-CTACA 11678369-GGACT-CTACA ***
13704431-ATGGAACTAAACGTAATGAACTC-GACTAATGGAATAGAATCAAATG 11548755-ATGGAACTAAACGTAATGAACTC-GACTAATGGAATAGAATCAAATG ***
13704404-TACTCAAATGGATTA-GAATGGAGATTAATG 11548728-TACTCAAATGGATTA-GAATGGAGATTAATG ***
13702782-GAATTC-AAATGG 11547106-GAATTC-AAATGG ***
13702759-GAAGAGATAAAT-ACGGACTGGAGA 11547083-GAAGAGATAAAT-ACGGACTGGAGA ***
13699729-GGAATT-G 11544053-GGAATT-G ***
13690848-CAA-GAT 11535172-CAA-GAT ***
13681022-TCTCCAATGT-AATGGTACCG 11525346-TCTCCAATGT-AATGGTACCG ***
13680939-AGATATCGAATG-TGGAATTGAAAT 11525263-AGATATCGAATG-TGGAATTGAAAT ***
13489367-TCCC-CCCA 11333691-TCCC-CCCA ***
13803187-CGAATGGAATTTACTCAAATAC-TTAATAGAAATTTTTCGAACAG 11682481-CGAATGGAATTTACTCAAATAC-TTAATAGAAATTTTTCGAACAG ***
13474751-CT-C 11319075-CT-C ***
13461044-TAT-CCC 11305368-TAT-CCC ***
13463860-CACGCGGGATTGG-GACGAGGGGTTGA 11308184-CACGCGGGATTGG-GACGAGGGGTTGA ***
13463893-GGGT-TTGC 11308217-GGGT-TTGC ***
13465969-AGTA-GATG 11310293-AGTA-GATG ***
13466029-GG-AA 11310353-GG-AA ***
13471972-TG-CT 11316296-TG-CT ***
13481403-TAGAAAAG-AAGACAAC 11325727-TAGAAAAG-AAGACAAC ***
13488837-GCCGGTTG-AACGGGCT 11333161-GCCGGTTG-AACGGGCT ***
13485613-AATGC-GATT 11329937-AATGC-GATT ***
13485843-TCAGA-AAATG 11330167-TCAGA-AAATG ***
13485852-CACCG-TATCA 11330176-CACCG-TATCA ***
13487800-GGGGCTGG-CGAGCGGT 11332124-GGGGCTGG-CGAGCGGT ***
13488808-GAGGACCC-AAGACTG 11333132-GAGGACCC-AAGACTG ***
13488827-GTGACA-ACGACG 11333151-GTGACA-ACGACG ***
13803179-GAC-AAT 11682473-GAC-AAT ***
13803263-GAAT-AAAC 11682557-GAAT-AAAC ***
13456687-CCGTCCTT-AAGTTGAA 11301011-CCGTCCTT-AAGTTGAA ***
13860018-TAG-ACA 11739312-TAG-ACA ***
13850261-C-CAAATGGAATG 11729555-C-CAAATGGAATG ***
13855516-CAAACGGATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG-GAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACCCGAGTAAAGTT 11734810-CAAACGGATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG-GAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACCCGAGTAAAGTT ***
13858729-CGACTGGAATGGAATGGAATGGAATGG-GGAATCGAAGGAATTGGAACAA 11738023-CGACTGGAATGGAATGGAATGGAATGG-GGAATCGAAGGAATTGGAACAA ***
13858759-AC-CG 11738053-AC-CG ***
13858767-CAC-AGG 11738061-CAC-AGG ***
13859884-GGAA-AGAG 11739178-GGAA-AGAG ***
13860093-AT-TG 11739387-AT-TG ***
13850084-TTCA-ATCT 11729378-TTCA-ATCT ***
13860133-TTCGTTGGAACTT-AGGAATAGAATGG 11739427-TTCGTTGGAACTT-AGGAATAGAATGG ***
13860367-TTTGGA-AAT 11739661-TTTGGA-AAT ***
13866834-CT-GG 11746128-CT-GG ***
13866855-GACTC-CACTT 11746149-GACTC-CACTT ***
13866864-GA-AG 11746158-GA-AG ***
13869213-ATGAA-TCAGT 11748507-ATGAA-TCAGT ***
13850099-ATT-GTC 11729393-ATT-GTC ***
13850067-GATTCA-G 11729361-GATTCA-G ***
13803275-CC-AA 11682569-CC-AA ***
13804159-CGGAA-TGCAG 11683453-CGGAA-TGCAG ***
13803301-AGG-TGA 11682595-AGG-TGA ***
13803323-CAAA-TGAT 11682617-CAAA-TGAT ***
13803332-TGAC-AGAT 11682626-TGAC-AGAT ***
13803340-CTGTA-ATGTT 11682634-CTGTA-ATGTT ***
13804122-GATC-AATA 11683416-GATC-AATA ***
13804150-AGAA-GGAC 11683444-AGAA-GGAC ***
13804231-TA-GC 11683525-TA-GC ***
13847496-TTCTAAAG-CTCAAAAT 11726790-TTCTAAAG-CTCAAAAT ***
13818030-AG-GT 11697324-AG-GT ***
13818038-CATTG-GAATA 11697332-CATTG-GAATA ***
13833374-AT-A 11712668-AT-A ***
13838711-GT-AG 11718005-GT-AG ***
13838730-TCA-CCG 11718024-TCA-CCG ***
13839844-CGT-TGG 11719138-CGT-TGG ***
13456703-CCTTGGGTTG-ATTGCATTCC 11301027-CCTTGGGTTG-ATTGCATTCC ***
13454342-CA-GG 11298666-CA-GG ***
13868845-TT-GG 11748139-TT-GG ***
9634219-C-CT 9796610-C-CT IR3_Prx 9×T***
9554422-TGAAGAGTA-T 9716813-TGAAGAGTA-T IR3_Prx ***
9566727-CA-C 9729118-CA-C IR3_Prx 13×A***
9587293-CA-C 9749684-CA-C IR3_Prx ***
9589945-CT-C 9752336-CT-C IR3_Prx 10×T***
9621478-CA-C 9783869-CA-C IR3_Prx ***
9629451-C-CA 9791842-C-CA IR3_Prx 12×A***
9671312-CA-C 9833703-CA-C IR3_Prx 9×A***
9503819-C-CTATA 9666210-C-CTATA ***
9728574-TTCCCACTGGC-T 9890965-TTCCCACTGGC-T IR3_Prx ***
9751854-CA-C 9914245-CA-C ***
9753975-CTTT-C 9916366-CTTT-C 20×T***
9923934-AG-TT 10086325-AG-TT ***
9923972-ACAA-GT 10086363-ACAA-GT ***
9924000-TC-AG 10086391-TC-AG ***
9535155-ATT-A 9697546-ATT-A IR3_Prx 17×T***
9342871-GC-G 9505262-GC-G ***
9974499-TC-CT 10136890-TC-CT ***
6279798-CAA-C 6411757-CAA-C IR3_Dst 13×A***
3550471-AACCC-CCGGG 3682430-AACCC-CCGGG ***
4113116-TAA-T 4245075-TAA-T 16×A***
5785603-GATAC-AAAAA 5917562-GATAC-AAAAA ***
6226071-C-CTTTCTTTA 6358030-C-CTTTCTTTA IR3_Dst ***
6226074-T-TCTTTCTTC 6358033-T-TCTTTCTTC IR3_Dst ***
6226086-T-TCTTC 6358045-T-TCTTC IR3_Dst ***
6492158-TA-T 6624117-TA-T ***
9073219-CTTTT-C 9235610-CTTTT-C 15×T***
7532276-GTATATATATA-G 7664235-GTATATATATA-G 28×TA***
8555559-T-TTTTGTC 8687518-T-TTTTGTC ***
8628154-CTTT-C 8760113-CTTT-C 16×T***
8768612-TACAC-T 8900571-TACAC-T 17×AC***
8842203-T-TAA 8974162-T-TAA 12×A***
8888375-CTTTTT-C 9020334-CTTTTT-C 25×T***
9961312-ACT-GG 10123703-ACT-GG ***
10070068-ATTCTA-GCACTG 10232459-ATTCTA-GCACTG ***
13452806-CACTGCACTACATTCCACTGAATTCCAC-TATTCAACTCCCTTACTCTCCATTACAT 11297130-CACTGCACTACATTCCACTGAATTCCAC-TATTCAACTCCCTTACTCTCCATTACAT ***
13447764-CACT-TTCA 11292088-CACT-TTCA ***
13447223-GCTA-ACTC 11291547-GCTA-ACTC ***
13447234-TCCCATC-ATCAATT 11291558-TCCCATC-ATCAATT ***
13447259-TTT-CTC 11291583-TTT-CTC ***
13447264-CTCCACTCCA-TTCTATTCCG 11291588-CTCCACTCCA-TTCTATTCCG ***
13447311-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA 11291635-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA ***
13447752-TC-CA 11292076-TC-CA ***
13447773-GCA-ATC 11292097-GCA-ATC ***
13385797-GC-AA 11230121-GC-AA ***
13451051-CATTCCA-AATTACT 11295375-CATTCCA-AATTACT ***
13452715-ACTC-CAAT 11297039-ACTC-CAAT ***
13452723-CTCCTCTGCAC-TTGCATTCCAT 11297047-CTCCTCTGCAC-TTGCATTCCAT ***
13452758-CTTCTTTCAACTCCACTCATC-TTCCATTCCATTCCGTTCTAT 11297082-CTTCTTTCAACTCCACTCATC-TTCCATTCCATTCCGTTCTAT ***
13452788-ATT-TTA 11297112-ATT-TTA ***
13452796-CATTCC-GGATTG 11297120-CATTCC-GGATTG ***
13442512-C-AT 11286836-C-AT ***
13203925-CATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-GTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT 11048249-CATTGTGATAGAGATGATTGAGGTGATGGTCATCATTATGGATGACCACCCCGCCTC-GTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGTAT ***
10075709-AAAGGTAG-GAATGTAT 10238100-AAAGGTAG-GAATGTAT ***
13140096-TCAGA-ACACT 10629582-TCAGA-ACACT ***
10081845-CAG-AAT 10244236-CAG-AAT ***
10081858-ACTCTATC-GCTATATGA 10244249-ACTCTATC-GCTATATGA ***
10081874-GG-TC 10244265-GG-TC ***
10081889-TATGAAG-GACGTAT 10244280-TATGAAG-GACGTAT ***
10081903-GCACAA-TAACAG 10244294-GCACAA-TAACAG ***
13132134-GGGAAC-AGAAAG 10621620-GGGAAC-AGAAAG ***
13140125-G-CACTC 10629611-G-CACTC 6×CACTC***
13196148-GGCTCC-CATTCT 11040472-GGCTCC-CATTCT ***
13140214-CCT-TCC 10629700-CCT-TCC ***
13141991-AAC-CAT 10631477-AAC-CAT 4×ACTCC***
13143883-TCCAGTT-ACCATTC 10633369-TCCAGTT-ACCATTC ***
13196092-ACAC-CTGT 11040416-ACAC-CTGT ***
13196107-CCTCTCC-GCACTCA 11040431-CCTCTCC-GCACTCA ***
13196132-GCATCCCATTAC-CCAATCCACTAT 11040456-GCATCCCATTAC-CCAATCCACTAT ***
22810272-C-A 20648386-C-A ***
22319046-A-C 20157160-A-C DYZ19 ***
22739657-C-A 20577771-C-A ***
8735700-T-G 8867659-T-G ***
9175495-A-G 9337886-A-G ***
9175489-A-G 9337880-A-G ***
9175486-T-G 9337877-T-G ***
9175473-C-G 9337864-C-G ***
9175471-T-G 9337862-T-G ***
9175465-A-G 9337856-A-G ***
9175455-T-G 9337846-T-G ***
9175452-G-C 9337843-G-C ***
9175451-A-C 9337842-A-C ***
9094246-C-A 9256637-C-A ***
9001128-G-T 9163519-G-T ***
8799254-C-A 8931213-C-A ***
8793053-C-A 8925012-C-A ***
8768590-A-T 8900549-A-T ***
8698041-C-A 8830000-C-A ***
9191775-C-G 9354166-C-G ***
8181267-C-T 8313226-C-T ***
8181251-A-T 8313210-A-T ***
8181252-G-T 8313211-G-T ***
8181253-T-G 8313212-T-G ***
8181255-G-C 8313214-G-C ***
8181256-C-G 8313215-C-G ***
8181264-C-G 8313223-C-G ***
8207952-G-T 8339911-G-T ***
8652861-A-C 8784820-A-C ***
8216467-C-G 8348426-C-G ***
8216651-C-T 8348610-C-T ***
8253564-T-C 8385523-T-C ***
8293840-G-T 8425799-G-T ***
8486655-G-T 8618614-G-T ***
8514314-C-A 8646273-C-A ***
9191774-G-T 9354165-G-T ***
9191776-A-T 9354167-A-T ***
8181248-T-G 8313207-T-G ***
9564408-G-T 9726799-G-T IR3_Prx ***
9700917-A-C 9863308-A-C IR3_Prx ***
9700913-T-G 9863304-T-G IR3_Prx ***
9700911-G-A 9863302-G-A IR3_Prx ***
9700910-T-G 9863301-T-G IR3_Prx ***
9700889-G-A 9863280-G-A IR3_Prx ***
9700702-C-G 9863093-C-G IR3_Prx ***
9634161-A-T 9796552-A-T IR3_Prx ***
9629420-G-T 9791811-G-T IR3_Prx ***
9602643-T-A 9765034-T-A IR3_Prx ***
9601655-T-C 9764046-T-C IR3_Prx ***
9601573-T-C 9763964-T-C IR3_Prx ***
9596527-A-G 9758918-A-G IR3_Prx ***
9574486-T-G 9736877-T-G IR3_Prx ***
9572360-G-C 9734751-G-C IR3_Prx ***
9564391-T-G 9726782-T-G IR3_Prx ***
9191778-C-T 9354169-C-T ***
9340653-G-T 9503044-G-T ***
9191780-G-T 9354171-G-T ***
9191782-A-T 9354173-A-T ***
9191786-A-T 9354177-A-T ***
9229655-T-A 9392046-T-A ***
9306180-C-A 9468571-C-A ***
9320591-T-C 9482982-T-C ***
9342980-C-G 9505371-C-G ***
9551427-A-G 9713818-A-G IR3_Prx ***
9345476-A-G 9507867-A-G ***
9398133-C-A 9560524-C-A ***
9457172-T-G 9619563-T-G ***
9478111-A-C 9640502-A-C ***
9528801-A-T 9691192-A-T ***
9539327-C-T 9701718-C-T IR3_Prx ***
8181250-C-T 8313209-C-T ***
8181247-G-T 8313206-G-T ***
9745941-A-C 9908332-A-C ***
6674653-G-T 6806612-G-T ***
7186041-C-A 7318000-C-A ***
7182924-C-A 7314883-C-A ***
7099082-C-A 7231041-C-A ***
7056218-T-C 7188177-T-C ***
6944071-G-A 7076030-G-A ***
6939998-G-A 7071957-G-A ***
6931350-T-G 7063309-T-G ***
6901143-G-T 7033102-G-T ***
6900905-C-T 7032864-C-T ***
6869553-A-G 7001512-A-G ***
6869552-C-A 7001511-C-A ***
6757115-C-A 6889074-C-A ***
6734809-C-T 6866768-C-T ***
6708999-A-C 6840958-A-C ***
6664065-G-T 6796024-G-T ***
7190636-C-A 7322595-C-A ***
6137892-T-G 6269851-T-G IR3_Dst ***
5317367-G-A 5449326-G-A ***
5755691-A-G 5887650-A-G ***
5785598-C-A 5917557-C-A ***
5874059-C-A 6006018-C-A ***
6090422-T-G 6222381-T-G ***
6104709-G-A 6236668-G-A ***
6140957-C-A 6272916-C-A IR3_Dst ***
6509869-C-A 6641828-C-A ***
6158846-G-T 6290805-G-T IR3_Dst ***
6174500-T-G 6306459-T-G IR3_Dst ***
6246812-A-T 6378771-A-T IR3_Dst ***
6298678-T-A 6430637-T-A IR3_Dst ***
6389589-G-T 6521548-G-T ***
6400089-G-T 6532048-G-T ***
7186835-G-T 7318794-G-T ***
7246024-G-T 7377983-G-T ***
8181246-A-T 8313205-A-T ***
7875283-C-A 8007242-C-A ***
8181244-G-T 8313203-G-T ***
8181243-T-C 8313202-T-C ***
8181242-C-G 8313201-C-G ***
8181240-G-C 8313199-G-C ***
8181239-A-T 8313198-A-T ***
8181235-G-C 8313194-G-C ***
8181232-G-C 8313191-G-C ***
8181214-G-T 8313173-G-T ***
8171740-G-T 8303699-G-T ***
8163748-C-A 8295707-C-A ***
8159562-T-G 8291521-T-G ***
8130607-G-T 8262566-G-T ***
8129293-C-A 8261252-C-A ***
8022757-C-G 8154716-C-G ***
7873081-G-T 8005040-G-T ***
7253660-C-A 7385619-C-A ***
7387420-A-T 7519379-A-T ***
7270318-C-T 7402277-C-T ***
7270339-G-T 7402298-G-T ***
7270340-G-C 7402299-G-C ***
7270341-A-T 7402300-A-T ***
7270344-G-T 7402303-G-T ***
7287043-C-A 7419002-C-A ***
7387421-G-T 7519380-G-T ***
7753707-T-G 7885666-T-G ***
7397633-C-A 7529592-C-A ***
7401961-C-A 7533920-C-A ***
7414265-G-A 7546224-G-A ***
7487948-C-A 7619907-C-A IR1_L ***
7497619-C-A 7629578-C-A IR1_L ***
7642911-C-A 7774870-C-A ***
9745940-A-C 9908331-A-C ***
9746018-C-T 9908409-C-T ***
4561563-C-A 4693522-C-A ***
13489046-T-G 11333370-T-G ***
13718506-G-C 11562830-G-C ***
13704059-C-G 11548383-C-G ***
13704058-A-T 11548382-A-T ***
13704057-A-C 11548381-A-C ***
13704055-A-G 11548379-A-G ***
13704050-C-A 11548374-C-A ***
13652363-G-T 11496687-G-T ***
13632733-C-A 11477057-C-A ***
13489508-G-A 11333832-G-A ***
13489500-A-C 11333824-A-C ***
13489495-C-A 11333819-C-A ***
13489466-T-G 11333790-T-G ***
13489089-G-A 11333413-G-A ***
13489077-T-G 11333401-T-G ***
13489042-C-T 11333366-C-T ***
13720131-C-T 11564455-C-T ***
13482112-G-A 11326436-G-A ***
13480591-T-C 11324915-T-C ***
13480653-G-A 11324977-G-A ***
13480682-T-G 11325006-T-G ***
13480703-C-A 11325027-C-A ***
13482062-G-C 11326386-G-C ***
13482081-A-T 11326405-A-T ***
13487790-C-A 11332114-C-A ***
13489041-G-A 11333365-G-A ***
13488793-C-T 11333117-C-T ***
13488810-G-A 11333134-G-A ***
13488837-G-A 11333161-G-A ***
13488844-G-T 11333168-G-T ***
13488918-C-A 11333242-C-A ***
13489000-C-A 11333324-C-A ***
13720127-A-T 11564451-A-T ***
13720132-A-G 11564456-A-G ***
13480141-G-A 11324465-G-A ***
13801495-A-G 11680789-A-G ***
13850131-G-A 11729425-G-A ***
13850129-G-A 11729423-G-A ***
13850126-A-G 11729420-A-G ***
13850125-T-G 11729419-T-G ***
13850122-A-G 11729416-A-G ***
13850120-A-T 11729414-A-T ***
13850117-G-A 11729411-G-A ***
13850116-T-G 11729410-T-G ***
13850115-T-A 11729409-T-A ***
13850111-T-G 11729405-T-G ***
13838692-G-T 11717986-G-T ***
13828546-G-T 11707840-G-T ***
13818045-A-T 11697339-A-T ***
13803225-A-G 11682519-A-G ***
13801123-G-T 11680417-G-T ***
13720136-T-A 11564460-T-A ***
13720163-G-T 11564487-G-T ***
13720137-C-G 11564461-C-G ***
13720141-T-C 11564465-T-C ***
13720142-T-G 11564466-T-G ***
13720147-G-A 11564471-G-A ***
13720148-G-T 11564472-G-T ***
13720152-G-A 11564476-G-A ***
13722228-T-C 11566552-T-C ***
13801114-G-T 11680408-G-T ***
13722229-A-G 11566553-A-G ***
13722233-A-G 11566557-A-G ***
13722234-T-G 11566558-T-G ***
13728638-G-A 11572962-G-A ***
13735155-G-T 11579479-G-T ***
13740868-C-A 11585192-C-A ***
13480461-A-G 11324785-A-G ***
13478258-A-G 11322582-A-G ***
9749917-A-G 9912308-A-G ***
10013131-C-A 10175522-C-A ***
13132226-G-C 10621712-G-C ***
13126058-A-T 10615544-A-T ***
10081908-A-G 10244299-A-G ***
10081847-G-T 10244238-G-T ***
10081845-C-A 10244236-C-A ***
10075782-C-T 10238173-C-T ***
10075763-G-C 10238154-G-C ***
10075730-A-T 10238121-A-T ***
10075704-T-C 10238095-T-C ***
10070058-G-A 10232449-G-A ***
10033408-C-A 10195799-C-A ***
10025267-C-A 10187658-C-A ***
10023027-C-A 10185418-C-A ***
10019109-T-G 10181500-T-G ***
10004366-A-C 10166757-A-C ***
13140093-A-T 10629579-A-T ***
9923981-G-T 10086372-G-T ***
9750015-G-T 9912406-G-T ***
9772116-C-A 9934507-C-A ***
9784666-G-T 9947057-G-T ***
9907509-G-T 10069900-G-T ***
9923899-T-C 10086290-T-C ***
9923961-T-C 10086352-T-C ***
9924053-C-A 10086444-C-A ***
9966136-C-A 10128527-C-A ***
9934935-A-T 10097326-A-T ***
9935926-C-T 10098317-C-T ***
9940905-G-T 10103296-G-T ***
9941285-C-T 10103676-C-T ***
9955472-A-G 10117863-A-G ***
9955525-C-A 10117916-C-A ***
13140091-T-A 10629577-T-A ***
13140094-A-C 10629580-A-C ***
13478251-G-T 11322575-G-T ***
13467226-G-A 11311550-G-A ***
13464369-C-A 11308693-C-A ***
13465929-T-A 11310253-T-A ***
13466001-C-G 11310325-C-G ***
13467155-C-A 11311479-C-A ***
13467219-A-T 11311543-A-T ***
13467225-T-C 11311549-T-C ***
13467235-G-T 11311559-G-T ***
13457643-G-T 11301967-G-T ***
13467240-G-C 11311564-G-C ***
13468319-A-G 11312643-A-G ***
13469346-G-T 11313670-G-T ***
13469348-G-C 11313672-G-C ***
13471991-T-A 11316315-T-A ***
13478250-G-T 11322574-G-T ***
13457646-G-C 11301970-G-C ***
13457642-G-A 11301966-G-A ***
13140095-A-C 10629581-A-C ***
13325975-A-G 11170299-A-G ***
13194303-T-C 11038627-T-C ***
13196119-A-C 11040443-A-C ***
13239362-A-C 11083686-A-C ***
13249148-C-A 11093472-C-A ***
13253352-A-T 11097676-A-T ***
13255996-G-T 11100320-G-T ***
13325977-T-G 11170301-T-G ***
13456716-A-C 11301040-A-C ***
13405112-A-T 11249436-A-T ***
13410664-T-A 11254988-T-A ***
13448858-C-A 11293182-C-A ***
13448859-C-A 11293183-C-A ***
13454350-T-C 11298674-T-C ***
13454352-C-T 11298676-C-T ***
4926002-T-C 5057961-T-C ***
4557458-C-A 4689417-C-A ***
13850139-G-A 11729433-G-A ***
13203927-T-A 11048251-T-A ***
13203942-T-A 11048266-T-A ***
13203941-A-G 11048265-A-G ***
13203940-G-T 11048264-G-T ***
13203939-T-A 11048263-T-A ***
13203938-A-G 11048262-A-G ***
13203937-G-T 11048261-G-T ***
13203936-A-G 11048260-A-G ***
13203935-G-A 11048259-G-A ***
13203934-A-T 11048258-A-T ***
13203933-T-A 11048257-T-A ***
13203932-A-G 11048256-A-G ***
13203931-G-T 11048255-G-T ***
13203930-T-A 11048254-T-A ***
13203929-G-T 11048253-G-T ***
13203926-A-T 11048250-A-T ***
13203946-G-T 11048270-G-T ***
18804472-GAA-G 16692592-GAA-G ***
19604809-CA-C 17492929-CA-C P5_Prx 19×A***
13437695-G-T 11282019-G-T ***
10023585-T-G 10185976-T-G ***
13256126-G-GT 11100450-G-GT ***
15928397-TG-T 13816517-TG-T ***
18468583-TTG-T 16356703-TTG-T P6_Dst 11×TG***
18908110-GTA-G 16796230-GTA-G ***
13203925-C-G 11048249-C-G ***
19407606-CT-C 17295726-CT-C 17×T***
8439220-G-GTTT 8571179-G-GTTT 14×T***
9745937-G-C 9908328-G-C ***
9745939-G-C 9908330-G-C ***
9745942-G-C 9908333-G-C ***
13203923-G-T 11048247-G-T ***
13203945-A-G 11048269-A-G ***
13203948-T-G 11048272-T-G ***
7464063-G-A 7596022-G-A IR1_L ***
25845058-T-A 23698911-T-A P1_b3 ***
24754928-TA-T 22608781-TA-T P3_b2 15×A***
9540246-CT-C 9702637-CT-C IR3_Prx 18×T***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
20428495-AT-A 18266609-AT-A P5_Dst 15×T***
28802562-T-A 26656415-T-A ***
28802561-A-G 26656414-A-G ***
28253532-G-A 26107385-G-A P1_b4 ***
28253528-T-A 26107381-T-A P1_b4 ***
27873407-A-T 25727260-A-T P1_Y2 ***
27844528-G-T 25698381-G-T P1_Y2 ***
27585905-A-T 25439758-A-T P1_Y2 ***
27062118-C-T 24915971-C-T P1_r4 22×T***
26991372-C-A 24845225-C-A P1_r4 ***
25845062-T-A 23698915-T-A P1_b3 ***
25845055-C-A 23698908-C-A P1_b3 ***
13203949-G-T 11048273-G-T ***
13203957-T-A 11048281-T-A ***
13203950-A-G 11048274-A-G ***
13203951-T-A 11048275-T-A ***
13203952-G-T 11048276-G-T ***
13203954-T-G 11048278-T-G ***
13203955-C-T 11048279-C-T ***
13203956-A-G 11048280-A-G ***
13833408-A-T 11712702-A-T ***
25626845-G-A 23480698-G-A P1_b3 ***
20942974-T-A 18781088-T-A P4_Dst ***
23693640-A-C 21531754-A-C ***
24084237-A-C 21938090-A-C P3_b1 ***
24192261-T-A 22046114-T-A P3_b1 ***
24662330-A-T 22516183-A-T P3_b2 ***
25524846-A-T 23378699-A-T P1_gr1 ***
24673369-T-TA 22527222-T-TA P3_b2 10×A***
7464057-G-A 7596016-G-A IR1_L ***
24618868-C-CT 22472721-C-CT P3_t2 12×T***
22505037-G-T 20343151-G-T DYZ19 ***
25709383-A-T 23563236-A-T P1_b3 ***
20108239-AAT-A 17996359-AAT-A P5_Dst 15×AT***
20914498-C-CA 18752612-C-CA P4_Dst 12×A***
58866148-G-C 56724723-C-G ***
20884101-G-GA 18722215-G-GA P4_Dst 10×A***
13818015-A-C 11697309-A-C ***
13480548-C-A 11324872-C-A ***
22489986-C-T 20328100-C-T DYZ19 ***
27810206-A-G 25664059-A-G P1_Y2 ***
27810198-A-G 25664051-A-G P1_Y2 ***
27810190-A-G 25664043-A-G P1_Y2 ***
27791968-T-TCTG 25645821-T-TCTG P1_Y2 ***
26563173-TAC-T 24417026-TAC-T P1_g2 ***
25064178-T-G 22918031-T-G g1 ******
22504991-T-A 20343105-T-A DYZ19 ***
20232470-T-A 18070584-T-A P5_Dst ***
13452332-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G 11296656-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G 12×ATTCC***
10026415-C-T 10188806-C-T ***
10031490-G-A 10193881-G-A ***
13449301-C-A 11293625-C-A ***
13449306-C-T 11293630-C-T ***
13449311-A-C 11293635-A-C ***
13449362-T-TTCCACTCCACTCCAC 11293686-T-TTCCACTCCACTCCAC ***
13454005-C-G 11298329-C-G ***
13815487-C-T 11694781-C-T ***
13456090-T-G 11300414-T-G ***
13489058-C-T 11333382-C-T ***
13494326-G-A 11338650-G-A ***
13811024-G-C 11690318-G-C ***
13811032-T-A 11690326-T-A ***
13811049-G-C 11690343-G-C ***
13452743-C-T 11297067-C-T ***
22358055-C-G 20196169-C-G DYZ19 ***
58975760-TTCCG-CTCCA 56829613-TTCCG-CTCCA ***
25466467-T-A 23320320-T-A P2_r2 ***
20893454-CA-C 18731568-CA-C P4_Dst 10×A***
20253869-G-GT 18091983-G-GT P5_Dst 13×T***
13803396-TG-CA 11682690-TG-CA ***
13803371-AGGAG-TGGAA 11682665-AGGAG-TGGAA ***
13463768-GCCCG-TCCCC 11308092-GCCCG-TCCCC ***
10016081-AA-TC 10178472-AA-TC ***
20881862-CA-C 18719976-CA-C P4_Dst 16×A***
58977328-G-C 56831181-G-C ***
27895974-A-C 25749827-A-C P1_Y2 ***
26310873-A-C 24164726-A-C P1_Y1 ***
26089828-C-G 23943681-C-G P1_Y1 ***
25658043-A-G 23511896-A-G P1_b3 ***
25524814-C-T 23378667-C-T P1_gr1 ***
25504098-T-C 23357951-T-C P1_gr1 ***
25280450-T-C 23134303-T-C P2_r1 ***
13801242-T-G 11680536-T-G ***
15400167-CA-C 13288287-CA-C 14×A***
13704467-A-T 11548791-A-T ***
28142885-AT-A 25996738-AT-A P1_b4 11×T***
27368948-G-GA 25222801-G-GA P1_g3 11×A***
27794410-AT-A 25648263-AT-A P1_Y2 ***
3550544-T-A 3682503-T-A ***
13704466-C-A 11548790-C-A ***
9923914-A-G 10086305-A-G ***
19189498-A-T 17077618-A-T ***
22481595-A-T 20319709-A-T DYZ19 ***
8389614-G-C 8521573-G-C ***
9311496-G-C 9473887-G-C ***
16691391-C-A 14579511-C-A ***
18008709-A-T 15896829-A-T P7_Dst ***
18008713-A-T 15896833-A-T P7_Dst ***
27760220-G-GT 25614073-G-GT P1_Y2 14×T***
9591034-GA-G 9753425-GA-G IR3_Prx 12×A***
4537932-C-A 4669891-C-A ***
2814824-A-T 2946783-A-T ***
2814840-A-C 2946799-A-C ***
2814839-A-G 2946798-A-G ***
2814838-A-T 2946797-A-T ***
2814836-T-A 2946795-T-A ***
2814835-T-A 2946794-T-A ***
2814834-T-A 2946793-T-A ***
2814833-G-C 2946792-G-C ***
2814832-A-C 2946791-A-C ***
2814831-G-C 2946790-G-C ***
2814830-G-T 2946789-G-T ***
2814829-A-C 2946788-A-C ***
2814827-T-G 2946786-T-G ***
2814826-G-A 2946785-G-A ***
2814825-G-C 2946784-G-C ***
2814823-G-T 2946782-G-T ***
2814842-C-G 2946801-C-G ***
13869490-T-A 11748784-T-A ***
23816742-G-T 21654856-G-T ***
13461699-C-A 11306023-C-A ***
21714723-T-G 19552837-T-G ***
13480600-A-T 11324924-A-T ***
17661357-G-T 15549477-G-T ***
9924043-C-A 10086434-C-A ***
28784531-G-A 26638384-G-A ***
2813758-C-A 2945717-C-A ***
13850142-G-T 11729436-G-T ***
58980701-A-T 56834554-A-T ***
2744676-A-G 2876635-A-G ***
2752537-C-A 2884496-C-A ***
2753026-C-A 2884985-C-A ***
2753878-C-A 2885837-C-A ***
2814841-C-T 2946800-C-T ***
2814843-A-G 2946802-A-G ***
13483448-T-G 11327772-T-G ***
3716132-C-A 3848091-C-A ***
4509590-C-A 4641549-C-A ***
4460679-C-A 4592638-C-A ***
4425853-C-A 4557812-C-A ***
4243333-A-T 4375292-A-T ***
4243332-C-A 4375291-C-A ***
4243331-A-G 4375290-A-G ***
4243330-A-G 4375289-A-G ***
4243329-G-T 4375288-G-T ***
3990609-T-A 4122568-T-A ***
3990606-C-G 4122565-C-G ***
3990603-C-G 4122562-C-G ***
3990588-C-A 4122547-C-A ***
3990585-G-T 4122544-G-T ***
3951284-C-A 4083243-C-A ***
3592569-C-A 3724528-C-A ***
2814845-C-A 2946804-C-A ***
2814853-A-C 2946812-A-C ***
2814846-C-T 2946805-C-T ***
2814848-G-A 2946807-G-A ***
2814849-G-C 2946808-G-C ***
2814850-C-A 2946809-C-A ***
2814851-C-G 2946810-C-G ***
2814852-A-G 2946811-A-G ***
2853557-G-A 2985516-G-A ***
3550494-T-A 3682453-T-A ***
2860531-C-A 2992490-C-A ***
2873912-C-A 3005871-C-A ***
2877925-C-A 3009884-C-A ***
3005690-C-A 3137649-C-A ***
3550465-C-G 3682424-C-G ***
3550468-T-A 3682427-T-A ***
13801536-A-G 11680830-A-G ***
13467218-T-A 11311542-T-A ***
13681005-GA-CG 11525329-GA-CG ***
27583214-G-GT 25437067-G-GT P1_Y2 11×T***
26463200-A-T 24317053-A-T P1_Y1 ***
25466540-G-A 23320393-G-A P2_r2 ***
18369731-A-G 16257851-A-G P6_Prx ***
18369724-A-C 16257844-A-C P6_Prx ***
27585915-G-T 25439768-G-T P1_Y2 ***
27585914-A-T 25439767-A-T P1_Y2 ***
58975737-CCAT-ACAC 56829590-CCAT-ACAC ***
19537901-CA-C 17426021-CA-C 17×A***
58985437-TCTGC-CCTGT 56839290-TCTGC-CCTGT ***
58823679-TCCATTTGATGCCATC-T 56767172-CATGGGATGGCATCAA-C ***
28260208-CT-C 26114061-CT-C P1_b4 13×T***
27991626-GGA-G 25845479-GGA-G P1_Y2 13×GA***
27868124-CA-C 25721977-CA-C P1_Y2 13×A***
27736672-G-GA 25590525-G-GA P1_Y2 10×A***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
9731612-GTTTG-TTTTT 9894003-GTTTG-TTTTT IR3_Prx ***
20848244-A-AT 18686358-A-AT P4_Dst 19×T***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13801234-AAG-GAA 11680528-AAG-GAA ***
13855157-AA-TT 11734451-AA-TT ***
16150095-CTT-C 14038215-CTT-C P8_Dst 22×T***
16162095-CA-C 14050215-CA-C P8_Dst 19×A***
18490252-C-CT 16378372-C-CT P6_Dst 11×T***
20949887-AAGC-CAGT 18788001-AAGC-CAGT P4_Dst ***
27166686-G-GA 25020539-G-GA P1_g3 11×A***
20949903-TCC-CCT 18788017-TCC-CCT P4_Dst ***
21030546-T-TA 18868660-T-TA P4_Dst 13×A***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
22341511-TTTCG-GTTCT 20179625-TTTCG-GTTCT DYZ19 ***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
27046828-CT-C 24900681-CT-C P1_r4 10×T***
27082215-G-A 24936068-G-A P1_r4 ***
20872237-AT-A 18710351-AT-A P4_Dst 11×T***
21853674-T-A 19691788-T-A ***
58977126-T-C 56830979-T-C ***
13132116-C-T 10621602-C-T ***
6878800-A-C 7010759-A-C M5386 ***
13467229-A-G 11311553-A-G ***
6133763-C-G 6265722-C-G ***
19007641-C-T 16895761-C-T ***
21839981-A-T 19678095-A-T ***
58977125-A-G 56830978-A-G ***
27963480-C-CA 25817333-C-CA P1_Y2 11×A***
26900291-G-A 24754144-G-A P1_r3 ***
13469066-T-G 11313390-T-G ***
9923988-A-C 10086379-A-C ***
13487746-C-A 11332070-C-A ***
13801131-A-G 11680425-A-G ***
13487771-G-T 11332095-G-T ***
13859602-A-T 11738896-A-T ***
27313118-A-AT 25166971-A-AT P1_g3 9×T***
28814964-G-T 26668817-G-T ***
22358065-T-A 20196179-T-A DYZ19 ***
28814967-T-A 26668820-T-A ***
14604587-CTTC-TTTT 12492789-CTTC-TTTT ***
13704046-C-A 11548370-C-A ***
10039846-G-C 10202237-G-C ***
10075752-G-A 10238143-G-A ***
10075778-G-GTT 10238169-G-GTT ***
28796363-GTAATGCAATGGAATT-G 26650216-GTAATGCAATGGAATT-G ***
25427340-A-C 23281193-A-C P2_r2 ***
58974190-C-T 56828043-C-T ***
58982021-C-T 56835874-C-T ***
58989104-G-C 56842957-G-C ***
59027543-T-C 56881396-T-C ***
16104472-A-T 13992592-A-T P8_Prx ***
17584196-T-G 15472316-T-G ***
13850132-G-A 11729426-G-A ***
13850141-G-C 11729435-G-C ***
22703595-C-A 20541709-C-A 30×A***
20084549-G-T 17972669-G-T P5_Dst ***
20194525-G-T 18032639-G-T P5_Dst ***
20142098-G-C 18030218-G-C P5_Dst ***
20142085-C-A 18030205-C-A P5_Dst ***
20137961-G-A 18026081-G-A P5_Dst ***
20130747-T-A 18018867-T-A P5_Dst ***
20112840-G-T 18000960-G-T P5_Dst ***
20107299-G-A 17995419-G-A P5_Dst 24×A***
20105783-T-A 17993903-T-A P5_Dst ***
20097549-T-A 17985669-T-A P5_Dst ***
20089283-G-A 17977403-G-A P5_Dst ***
20089241-G-T 17977361-G-T P5_Dst ***
20089232-C-T 17977352-C-T P5_Dst ***
20087732-T-A 17975852-T-A P5_Dst ***
20084550-T-C 17972670-T-C P5_Dst ***
20084547-C-T 17972667-C-T P5_Dst ***
20196237-A-G 18034351-A-G P5_Dst ***
20036241-T-G 17924361-T-G P5_Prx ***
19910367-C-A 17798487-C-A P5_Prx ***
19926017-G-A 17814137-G-A P5_Prx ***
19926077-G-T 17814197-G-T P5_Prx ***
19977128-C-A 17865248-C-A P5_Prx ***
19998816-T-C 17886936-T-C P5_Prx ***
20019177-G-T 17907297-G-T P5_Prx ***
20039526-C-A 17927646-C-A P5_Prx ***
20084542-T-C 17972662-T-C P5_Dst ***
20078779-T-G 17966899-T-G P5_Dst ***
20082705-T-C 17970825-T-C P5_Dst ***
20084533-G-T 17972653-G-T P5_Dst ***
20084534-G-T 17972654-G-T P5_Dst ***
20084535-C-G 17972655-C-G P5_Dst ***
20084541-C-T 17972661-C-T P5_Dst ***
20194872-A-G 18032986-A-G P5_Dst ***
20197311-G-T 18035425-G-T P5_Dst ***
19867373-C-A 17755493-C-A P5_Prx ***
20332046-T-A 18170160-T-A P5_Dst ***
20500970-T-C 18339084-T-C P5_Dst ***
20497609-G-T 18335723-G-T P5_Dst ***
20497238-T-C 18335352-T-C P5_Dst ***
20497231-A-C 18335345-A-C P5_Dst ***
20479850-T-G 18317964-T-G P5_Dst ***
20479194-T-A 18317308-T-A P5_Dst ***
20442391-G-A 18280505-G-A P5_Dst ***
20428379-A-C 18266493-A-C P5_Dst ***
20428131-G-T 18266245-G-T P5_Dst ***
20427754-G-T 18265868-G-T P5_Dst ***
20420560-C-A 18258674-C-A P5_Dst ***
20394513-G-A 18232627-G-A P5_Dst ***
20379085-G-T 18217199-G-T P5_Dst ***
20362527-T-C 18200641-T-C P5_Dst ***
20325439-C-G 18163553-C-G P5_Dst ***
20197355-A-G 18035469-A-G P5_Dst ***
20243019-G-T 18081133-G-T P5_Dst ***
20197415-A-G 18035529-A-G P5_Dst ***
20199868-T-A 18037982-T-A P5_Dst ***
20200065-A-T 18038179-A-T P5_Dst ***
20200111-T-C 18038225-T-C P5_Dst ***
20200950-C-T 18039064-C-T P5_Dst ***
20230236-G-A 18068350-G-A P5_Dst ***
20243030-G-A 18081144-G-A P5_Dst ***
20318815-A-T 18156929-A-T P5_Dst ***
20243042-T-A 18081156-T-A P5_Dst ***
20247630-A-G 18085744-A-G P5_Dst ***
20252687-C-A 18090801-C-A P5_Dst ***
20256282-T-G 18094396-T-G P5_Dst ***
20284423-C-T 18122537-C-T P5_Dst ***
20312756-G-A 18150870-G-A P5_Dst ***
19892926-G-C 17781046-G-C P5_Prx ***
19829283-A-T 17717403-A-T P5_Prx ***
20530271-T-A 18368385-T-A P5_Dst ***
19187501-C-T 17075621-C-T ***
19189555-C-T 17077675-C-T ***
19189553-T-A 17077673-T-A ***
19189551-C-A 17077671-C-A ***
19189475-T-C 17077595-T-C ***
19189474-G-C 17077594-G-C ***
19189473-A-C 17077593-A-C ***
19189470-C-G 17077590-C-G ***
19189469-A-G 17077589-A-G ***
19189467-A-G 17077587-A-G ***
19187531-C-T 17075651-C-T ***
19187508-G-C 17075628-G-C ***
19187507-G-C 17075627-G-C ***
19187506-A-C 17075626-A-C ***
19187502-G-T 17075622-G-T ***
19187499-G-T 17075619-G-T ***
19206717-C-A 17094837-C-A ***
19124293-C-T 17012413-C-T ***
19007647-C-T 16895767-C-T ***
19036750-A-T 16924870-A-T ***
19041272-A-C 16929392-A-C ***
19043027-C-A 16931147-C-A ***
19117358-T-C 17005478-T-C ***
19124277-C-A 17012397-C-A ***
19187441-A-G 17075561-A-G ***
19187497-C-T 17075617-C-T ***
19187485-C-G 17075605-C-G ***
19187488-A-G 17075608-A-G ***
19187491-C-T 17075611-C-T ***
19187493-C-T 17075613-C-T ***
19187494-G-C 17075614-G-C ***
19187495-C-T 17075615-C-T ***
19206713-T-G 17094833-T-G ***
19231377-A-G 17119497-A-G ***
19817453-G-T 17705573-G-T P5_Prx ***
19668709-C-A 17556829-C-A P5_Prx ***
19817452-G-T 17705572-G-T P5_Prx ***
19765957-A-T 17654077-A-T P5_Prx ***
19754426-T-C 17642546-T-C P5_Prx ***
19743705-T-A 17631825-T-A P5_Prx ***
19727366-T-C 17615486-T-C P5_Prx ***
19711943-A-G 17600063-A-G P5_Prx ***
19700766-A-G 17588886-A-G P5_Prx ***
19682119-T-A 17570239-T-A P5_Prx ***
19681958-T-G 17570078-T-G P5_Prx ***
19678542-G-T 17566662-G-T P5_Prx ***
19668761-C-A 17556881-C-A P5_Prx ***
19668751-C-A 17556871-C-A P5_Prx ***
19668716-T-A 17556836-T-A P5_Prx ***
19668712-G-A 17556832-G-A P5_Prx ***
19553794-C-A 17441914-C-A ***
19303926-G-T 17192046-G-T ***
19359831-A-G 17247951-A-G ***
19333357-C-A 17221477-C-A ***
19359822-C-T 17247942-C-T ***
19359823-A-G 17247943-A-G ***
19359824-C-T 17247944-C-T ***
19359826-C-T 17247946-C-T ***
19359830-C-T 17247950-C-T ***
19359835-A-G 17247955-A-G ***
19543973-C-A 17432093-C-A ***
19359837-A-G 17247957-A-G ***
19359838-C-T 17247958-C-T ***
19359839-A-G 17247959-A-G ***
19359858-A-G 17247978-A-G ***
19403872-C-A 17291992-C-A ***
19467008-C-A 17355128-C-A ***
20507919-G-T 18346033-G-T P5_Dst ***
20530307-T-G 18368421-T-G P5_Dst ***
19007643-C-T 16895763-C-T ***
21963685-C-A 19801799-C-A ***
22261635-G-A 20099749-G-A DYZ19 ***
22247187-T-C 20085301-T-C DYZ19 ***
22223285-C-T 20061399-C-T DYZ19 ***
22055470-T-C 19893584-T-C ***
22055455-G-A 19893569-G-A ***
22055453-T-C 19893567-T-C ***
22055449-C-T 19893563-C-T ***
22023278-A-T 19861392-A-T ***
22023276-T-C 19861390-T-C ***
22023265-G-C 19861379-G-C ***
22023254-A-G 19861368-A-G ***
22023250-T-G 19861364-T-G ***
22000666-T-C 19838780-T-C ***
21975276-C-T 19813390-C-T ***
21935166-C-A 19773280-C-A ***
22290881-T-C 20128995-T-C DYZ19 ***
21714721-C-G 19552835-C-G ***
21515822-C-A 19353936-C-A ***
21515824-C-G 19353938-C-G ***
21515825-T-G 19353939-T-G ***
21515852-G-A 19353966-G-A ***
21530868-G-T 19368982-G-T ***
21551384-G-T 19389498-G-T ***
21714722-C-A 19552836-C-A ***
21853676-T-A 19691790-T-A ***
21714728-G-A 19552842-G-A ***
21714730-C-A 19552844-C-A ***
21714738-G-A 19552852-G-A ***
21714740-C-A 19552854-C-A ***
21714746-C-A 19552860-C-A ***
21853654-G-A 19691768-G-A ***
22262326-G-T 20100440-G-T DYZ19 ***
22290889-G-C 20129003-G-C DYZ19 ***
21515817-C-A 19353931-C-A ***
22336980-C-A 20175094-C-A DYZ19 ***
22703594-T-A 20541708-T-A ***
22703568-C-T 20541682-C-T ***
22485115-G-A 20323229-G-A DYZ19 ***
22485097-C-T 20323211-C-T DYZ19 ***
22481392-C-G 20319506-C-G DYZ19 ***
22447615-G-T 20285729-G-T DYZ19 ***
22431187-A-T 20269301-A-T DYZ19 ***
22367824-G-T 20205938-G-T DYZ19 ***
22358177-G-C 20196291-G-C DYZ19 ***
22358162-T-C 20196276-T-C DYZ19 ***
22358161-G-T 20196275-G-T DYZ19 ***
22358057-T-A 20196171-T-A DYZ19 ***
22358056-T-G 20196170-T-G DYZ19 ***
22344911-A-G 20183025-A-G DYZ19 ***
22334796-G-T 20172910-G-T DYZ19 ***
22290894-A-T 20129008-A-T DYZ19 ***
22319051-T-A 20157165-T-A DYZ19 ***
22307303-T-G 20145417-T-G DYZ19 ***
22319044-T-A 20157158-T-A DYZ19 ***
22319045-T-C 20157159-T-C DYZ19 ***
20084551-T-C 17972671-T-C P5_Dst ***
22319049-G-T 20157163-G-T DYZ19 ***
22319050-G-A 20157164-G-A DYZ19 ***
22319053-A-T 20157167-A-T DYZ19 ***
22319064-A-T 20157178-A-T DYZ19 ***
22319055-T-C 20157169-T-C DYZ19 ***
22319056-G-T 20157170-G-T DYZ19 ***
22319057-T-G 20157171-T-G DYZ19 ***
22319060-C-A 20157174-C-A DYZ19 ***
22319061-A-C 20157175-A-C DYZ19 ***
22319062-G-A 20157176-G-A DYZ19 ***
21515819-C-G 19353933-C-G ***
21515816-T-A 19353930-T-A ***
20530331-C-A 18368445-C-A P5_Dst ***
20849687-G-T 18687801-G-T P4_Dst ***
20951260-C-A 18789374-C-A P4_Dst ***
20937148-G-A 18775262-G-A P4_Dst ***
20932788-A-G 18770902-A-G P4_Dst ***
20920234-C-A 18758348-C-A P4_Dst ***
20915768-C-T 18753882-C-T P4_Dst ***
20915296-T-C 18753410-T-C P4_Dst ***
20894476-A-G 18732590-A-G P4_Dst ***
20886864-A-T 18724978-A-T P4_Dst ***
20886851-C-G 18724965-C-G P4_Dst ***
20872395-C-T 18710509-C-T P4_Dst ***
20870919-T-G 18709033-T-G P4_Dst ***
20870790-T-G 18708904-T-G P4_Dst ***
20867232-T-A 18705346-T-A P4_Dst ***
20853417-G-T 18691531-G-T P4_Dst ***
20756508-C-T 18594622-C-T P4_Prx ***
20982314-A-T 18820428-A-T P4_Dst ***
20603957-G-T 18442071-G-T P5_Dst ***
20534054-C-A 18372168-C-A P5_Dst ***
20593080-G-A 18431194-G-A P5_Dst ***
20602137-T-C 18440251-T-C P5_Dst ***
20602139-T-C 18440253-T-C P5_Dst ***
20602141-T-A 18440255-T-A P5_Dst ***
20602143-T-A 18440257-T-A P5_Dst ***
20645955-A-T 18484069-A-T P4_Prx ***
20751238-G-T 18589352-G-T P4_Prx ***
20716960-G-A 18555074-G-A P4_Prx ***
20716969-G-A 18555083-G-A P4_Prx ***
20716972-G-A 18555086-G-A P4_Prx ***
20717032-T-A 18555146-T-A P4_Prx ***
20717036-T-A 18555150-T-A P4_Prx ***
20722328-G-T 18560442-G-T P4_Prx ***
20959417-G-T 18797531-G-T P4_Dst ***
20990517-G-T 18828631-G-T P4_Dst ***
21515815-A-C 19353929-A-C ***
21515802-G-T 19353916-G-T ***
21306573-C-A 19144687-C-A ***
21402217-C-T 19240331-C-T ***
21402218-T-A 19240332-T-A ***
21405899-G-T 19244013-G-T ***
21515798-G-A 19353912-G-A ***
21515800-T-G 19353914-T-G ***
21515804-A-T 19353918-A-T ***
21306569-C-A 19144683-C-A ***
21515805-G-A 19353919-G-A ***
21515806-T-G 19353920-T-G ***
21515809-G-C 19353923-G-C ***
21515810-C-T 19353924-C-T ***
21515813-A-G 19353927-A-G ***
21515814-G-T 19353928-G-T ***
21306571-G-A 19144685-G-A ***
21306562-T-A 19144676-T-A ***
20993541-G-T 18831655-G-T P4_Dst ***
21148588-T-A 18986702-T-A ***
21014287-G-T 18852401-G-T P4_Dst ***
21030501-G-A 18868615-G-A P4_Dst ***
21084343-A-G 18922457-A-G ***
21090845-C-A 18928959-C-A ***
21100405-C-A 18938519-C-A ***
21139563-G-T 18977677-G-T ***
21200753-C-A 19038867-C-A ***
21306559-G-A 19144673-G-A ***
21201596-C-A 19039710-C-A ***
21220260-G-T 19058374-G-T ***
21248808-A-G 19086922-A-G ***
21261823-C-T 19099937-C-T ***
21306547-T-A 19144661-T-A ***
21306553-G-A 19144667-G-A ***
19007644-A-G 16895764-A-G ***
18982545-C-G 16870665-C-G ***
13850146-G-T 11729440-G-T ***
15707135-C-A 13595255-C-A ***
15815283-G-A 13703403-G-A ***
15815272-G-A 13703392-G-A ***
15815270-G-A 13703390-G-A ***
15815269-G-A 13703389-G-A ***
15815267-G-A 13703387-G-A ***
15815266-G-A 13703386-G-A ***
15815264-G-A 13703384-G-A ***
15815263-G-A 13703383-G-A ***
15815262-G-A 13703382-G-A ***
15770823-T-G 13658943-T-G ***
15768996-C-A 13657116-C-A ***
15740325-C-A 13628445-C-A ***
15722024-T-G 13610144-T-G ***
15718940-G-T 13607060-G-T ***
15689186-G-T 13577306-G-T ***
15882009-A-G 13770129-A-G ***
15410626-T-C 13298746-T-C ***
15363995-G-A 13252115-G-A ***
15364001-A-G 13252121-A-G ***
15364005-A-G 13252125-A-G ***
15410615-C-A 13298735-C-A ***
15410620-T-G 13298740-T-G ***
15410622-A-G 13298742-A-G ***
15430643-C-A 13318763-C-A ***
15622673-G-A 13510793-G-A ***
15432928-C-A 13321048-C-A ***
15493238-T-C 13381358-T-C ***
15496988-A-G 13385108-A-G ***
15496990-A-G 13385110-A-G ***
15496991-T-C 13385111-T-C ***
15496995-A-G 13385115-A-G ***
15815286-G-A 13703406-G-A ***
15882013-A-G 13770133-A-G ***
15260711-A-T 13148795-A-T ***
16148212-A-G 14036332-A-G P8_Dst ***
16148240-T-G 14036360-T-G P8_Dst ***
16148238-G-C 14036358-G-C P8_Dst ***
16148237-G-C 14036357-G-C P8_Dst ***
16148231-C-T 14036351-C-T P8_Dst ***
16148230-T-C 14036350-T-C P8_Dst ***
16148227-C-T 14036347-C-T P8_Dst ***
16148226-T-C 14036346-T-C P8_Dst ***
16148223-C-T 14036343-C-T P8_Dst ***
16148222-T-C 14036342-T-C P8_Dst ***
16148219-G-T 14036339-G-T P8_Dst ***
16148218-A-G 14036338-A-G P8_Dst ***
16148215-C-G 14036335-C-G P8_Dst ***
16148214-A-C 14036334-A-C P8_Dst ***
16148213-G-A 14036333-G-A P8_Dst ***
16147827-T-A 14035947-T-A P8_Dst ***
15882018-A-G 13770138-A-G ***
15992289-G-T 13880409-G-T ***
15882020-A-G 13770140-A-G ***
15882042-T-G 13770162-T-G ***
15894315-A-T 13782435-A-T ***
15894372-G-T 13782492-G-T ***
15904036-G-A 13792156-G-A ***
15917597-C-A 13805717-C-A ***
16021032-A-C 13909152-A-C ***
16146447-T-C 14034567-T-C P8_Dst ***
16034209-C-A 13922329-C-A ***
16047050-T-G 13935170-T-G ***
16089724-C-A 13977844-C-A ***
16118198-T-A 14006318-T-A P8_Prx ***
16118209-G-A 14006329-G-A P8_Prx ***
16118225-A-G 14006345-A-G P8_Prx ***
15262458-C-A 13150542-C-A 30×A***
15260710-G-T 13148794-G-T ***
16148251-G-T 14036371-G-T P8_Dst ***
13869542-A-T 11748836-A-T ***
14147077-C-A 12026371-C-A ***
14077821-A-C 11957115-A-C ***
14073028-G-T 11952322-G-T ***
14050767-C-A 11930061-C-A ***
14030774-C-A 11910068-C-A ***
13982640-C-A 11861934-C-A ***
13978662-T-G 11857956-T-G ***
13940288-C-A 11819582-C-A ***
13937077-C-A 11816371-C-A ***
13929472-A-C 11808766-A-C ***
13869550-G-A 11748844-G-A ***
13869548-T-G 11748842-T-G ***
13869547-C-T 11748841-C-T ***
13869545-G-A 11748839-G-A ***
13869540-G-A 11748834-G-A ***
14179340-C-A 12058634-C-A ***
13869518-T-C 11748812-T-C ***
13858799-T-G 11738093-T-G ***
13869489-A-G 11748783-A-G ***
13869503-C-G 11748797-C-G ***
13869508-T-G 11748802-T-G ***
13869510-G-A 11748804-G-A ***
13869515-G-A 11748809-G-A ***
13869520-G-A 11748814-G-A ***
13869538-T-G 11748832-T-G ***
13869522-G-T 11748816-G-T ***
13869523-T-G 11748817-T-G ***
13869525-G-A 11748819-G-A ***
13869528-T-G 11748822-T-G ***
13869530-G-A 11748824-G-A ***
13869536-A-G 11748830-A-G ***
14153013-C-A 12032307-C-A ***
14194283-T-C 12073577-T-C ***
15211246-G-T 13099332-G-T ***
14765725-G-C 12653794-G-C ***
14645499-T-A 12533563-T-A ***
14673390-T-G 12561456-T-G ***
14693550-T-A 12581616-T-A ***
14746086-C-A 12634155-C-A ***
14754114-A-T 12642183-A-T ***
14765724-G-T 12653793-G-T ***
14765726-C-T 12653795-C-T ***
14629755-C-A 12517824-C-A ***
14798735-T-A 12686806-T-A ***
14986602-C-A 12874670-C-A ***
15069051-C-A 12957142-C-A ***
15070422-G-T 12958513-G-T ***
15106929-T-A 12995016-T-A ***
15151484-C-A 13039571-C-A ***
14645163-T-G 12533232-T-G ***
14626977-C-A 12515045-C-A ***
14241359-G-T 12120653-G-T ***
14355540-C-A 12234835-C-A ***
14324959-A-G 12204253-A-G ***
14324960-G-C 12204254-G-C ***
14324961-T-G 12204255-T-G ***
14324972-C-G 12204266-C-G ***
14324992-T-C 12204286-T-C ***
14332668-T-G 12211962-T-G ***
14386809-C-A 12266105-C-A ***
14602227-C-A 12490429-C-A ***
14446467-C-A 12325740-C-A ***
14519431-C-A 12407632-C-A ***
14528629-C-A 12416830-C-A ***
14529064-C-T 12417265-C-T ***
14582455-G-T 12470655-G-T ***
14600115-G-T 12488315-G-T ***
16148249-G-A 14036369-G-A P8_Dst ***
16148252-G-T 14036372-G-T P8_Dst ***
18982530-G-A 16870650-G-A ***
18297872-C-A 16185992-C-A P6_Prx ***
18439315-T-C 16327435-T-C P6_Dst ***
18439314-G-T 16327434-G-T P6_Dst ***
18439313-A-T 16327433-A-T P6_Dst ***
18439306-A-C 16327426-A-C P6_Dst ***
18439302-G-C 16327422-G-C P6_Dst ***
18439296-T-C 16327416-T-C P6_Dst ***
18369737-A-G 16257857-A-G P6_Prx ***
18369721-T-G 16257841-T-G P6_Prx ***
18369717-G-A 16257837-G-A P6_Prx ***
18369716-T-G 16257836-T-G P6_Prx ***
18369713-G-A 16257833-G-A P6_Prx ***
18369627-C-A 16257747-C-A P6_Prx ***
18369619-C-A 16257739-C-A P6_Prx ***
18311685-C-A 16199805-C-A P6_Prx ***
18195310-C-A 16083430-C-A ***
18439334-C-G 16327454-C-G P6_Dst ***
18020006-T-G 15908126-T-G ***
17956072-C-A 15844192-C-A ***
18008706-G-T 15896826-G-T P7_Dst ***
18008710-C-A 15896830-C-A P7_Dst ***
18008711-G-T 15896831-G-T P7_Dst ***
18008714-G-T 15896834-G-T P7_Dst ***
18008715-T-C 15896835-T-C P7_Dst ***
18078582-G-T 15966702-G-T ***
18195228-C-A 16083348-C-A ***
18093386-G-T 15981506-G-T ***
18133147-A-G 16021267-A-G ***
18147563-A-C 16035683-A-C ***
18195197-G-T 16083317-G-T ***
18195202-G-T 16083322-G-T ***
18195203-T-C 16083323-T-C ***
18439325-G-C 16327445-G-C P6_Dst ***
18439342-A-G 16327462-A-G P6_Dst ***
17922474-G-T 15810594-G-T ***
18652897-G-T 16541017-G-T ***
18959185-A-C 16847305-A-C ***
18959182-T-C 16847302-T-C ***
18959177-T-C 16847297-T-C ***
18959168-T-C 16847288-T-C ***
18959160-A-G 16847280-A-G ***
18959158-T-G 16847278-T-G ***
18959146-C-G 16847266-C-G ***
18947916-C-A 16836036-C-A ***
18919893-C-A 16808013-C-A ***
18876383-C-A 16764503-C-A ***
18853104-C-A 16741224-C-A ***
18738188-C-A 16626308-C-A ***
18687488-C-A 16575608-C-A ***
18652936-G-T 16541056-G-T ***
18615981-A-T 16504101-A-T ***
18439345-C-G 16327465-C-G P6_Dst ***
18480132-C-A 16368252-C-A P6_Dst ***
18439350-C-G 16327470-C-G P6_Dst ***
18460848-G-T 16348968-G-T P6_Dst ***
18467297-C-T 16355417-C-T P6_Dst ***
18480063-T-A 16368183-T-A P6_Dst ***
18480129-T-A 16368249-T-A P6_Dst ***
18480130-C-G 16368250-C-G P6_Dst ***
18480137-C-A 16368257-C-A P6_Dst ***
18615980-C-T 16504100-C-T ***
18512448-G-T 16400568-G-T P6_Dst ***
18513257-C-A 16401377-C-A P6_Dst ***
18534163-C-T 16422283-C-T P6_Dst ***
18565060-T-A 16453180-T-A ***
18615961-A-T 16504081-A-T ***
18615962-G-T 16504082-G-T ***
17946944-G-T 15835064-G-T ***
17916320-G-C 15804440-G-C ***
16148254-G-T 14036374-G-T P8_Dst ***
16305877-A-C 14193997-A-C ***
16648161-C-T 14536281-C-T ***
16598981-C-A 14487101-C-A ***
16568263-C-A 14456383-C-A ***
16549620-C-A 14437740-C-A ***
16457314-C-A 14345434-C-A ***
16451785-C-A 14339905-C-A ***
16451781-C-T 14339901-C-T ***
16441132-C-A 14329252-C-A ***
16437481-G-A 14325601-G-A ***
16427695-A-G 14315815-A-G ***
16424871-C-A 14312991-C-A ***
16409146-G-A 14297266-G-A ***
16359717-G-A 14247837-G-A ***
16305878-T-C 14193998-T-C ***
16305732-C-T 14193852-C-T ***
16730242-C-A 14618362-C-A ***
16164357-T-G 14052477-T-G P8_Dst ***
16148255-C-T 14036375-C-T P8_Dst ***
16148256-G-C 14036376-G-C P8_Dst ***
16148257-A-G 14036377-A-G P8_Dst ***
16148259-C-T 14036379-C-T P8_Dst ***
16148260-T-A 14036380-T-A P8_Dst ***
16148269-T-C 14036389-T-C P8_Dst ***
16205753-A-C 14093873-A-C ***
16294450-C-A 14182570-C-A ***
16292613-G-T 14180733-G-T ***
16292617-C-T 14180737-C-T ***
16292619-C-T 14180739-C-T ***
16292620-A-T 14180740-A-T ***
16292641-A-T 14180761-A-T ***
16292643-C-T 14180763-C-T ***
16703863-G-T 14591983-G-T ***
16768350-C-A 14656470-C-A ***
17907835-C-A 15795955-C-A ***
17763983-T-C 15652103-T-C ***
17498839-A-G 15386959-A-G ***
17517100-C-A 15405220-C-A ***
17588607-T-G 15476727-T-G ***
17606340-C-A 15494460-C-A ***
17701396-C-T 15589516-C-T ***
17707374-C-G 15595494-C-G ***
17764744-T-G 15652864-T-G ***
17406764-C-A 15294884-C-A ***
17770123-C-A 15658243-C-A ***
17802164-A-T 15690284-A-T ***
17832432-C-A 15720552-C-A ***
17854455-C-A 15742575-C-A ***
17871704-C-A 15759824-C-A ***
17889925-C-A 15778045-C-A ***
17446814-C-T 15334934-C-T ***
17320573-A-T 15208693-A-T ***
16853777-A-T 14741897-A-T ***
16990029-A-C 14878149-A-C ***
16855352-A-C 14743472-A-C ***
16860748-G-T 14748868-G-T ***
16867594-C-A 14755714-C-A ***
16990024-A-G 14878144-A-G ***
16990025-A-T 14878145-A-T ***
16990027-A-G 14878147-A-G ***
16990030-A-G 14878150-A-G ***
17289768-C-A 15177888-C-A ***
16990031-T-G 14878151-T-G ***
16990032-A-G 14878152-A-G ***
17041897-C-A 14930017-C-A ***
17056887-T-C 14945007-T-C ***
17158995-G-T 15047115-G-T ***
17159005-C-T 15047125-C-T ***
13865900-A-C,G 11745194-A-C,G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Bond1224151011-14121213131329169-1010112515192914-15-15-15111119-231615181636-36121211915-1681010810101223-231610121215814222114121113111112123415916132526191311131211912121011113012122113101020152013241812162412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1701911008801872079357257607
Used in age calculations1008801872079357257607
Counts of SNPs32
Variant counts last updated 2017-11-13 20:43:36.



Big Tree Main Page