Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > S1051 > FGC9655

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
30949
FGC
5MZY9
20819070-T-C 18657184-T-C FGC14927 P4_Gap ++
17054541-A-G 14942661-A-G FGC14919 YY++
14214652-G-T 12093946-G-T FGC14909 YY++
14318049-T-C 12197343-T-C FGC14910 YY++
14509025-T-C 12397230-T-C FGC14911 YY++
14555370-A-G 12443571-A-G FGC14912 YY+*
24398316-C-G 22252169-C-G FGC14932 Y++
14728975-C-T 12617043-C-T FGC14913 YY++
16287227-G-A 14175347-G-A FGC14914 YY++
16439248-C-T 14327368-C-T FGC14915 YY++
16791459-C-T 14679579-C-T FGC14916 YY++
16796092-G-A 14684212-G-A FGC14917 YY++
16835486-A-C 14723606-A-C FGC14918 YY++
18005457-C-T 15893577-C-T FGC14920 P7_Gap Y++
13843075-G-A 11722369-G-A FGC14907 +*
18069459-G-T 15957579-G-T FGC14921 YY++
18641213-A-T 16529333-A-T FGC14922 YY++
19080260-T-C 16968380-T-C FGC14923 YY++
19140100-C-T 17028220-C-T FGC14924 YY++
19178817-C-T 17066937-C-T FGC14925 Y+*
19197886-G-A 17086006-G-A FGC14926 YY++
21186715-CAGAGGTCACT-C 19024829-CAGAGGTCACT-C +**
21558483-C-T 19396597-C-T FGC14928 YY++
21559587-A-G 19397701-A-G FGC14929 YY++
21783193-A-C 19621307-A-C FGC14930 YY++
22722922-T-G 20561036-T-G FGC14931 YY++
14055245-C-T 11934539-C-T FGC14908 YY++
14692200-C-T 12580266-C-T BY23846 YY+**
9105286-C-T 9267677-C-T FGC14905 Y+*
8302915-G-A 8434874-G-A FGC14902 YY++
9148529-A-T 9310920-A-T Y+**
13678453-GGAATGGAAAGGAATA-G 11522777-GGAATGGAAAGGAATA-G +**
8598395-C-A 8730354-C-A FGC14903 YY++
2851754-T-A 2983713-T-A 6674404-C-TZ22771 F8506 YY+***
2890107-G-A 3022066-G-A FGC14900 YY++
8789492-C-A 8921451-C-A FGC14904 YY+*
7176376-G-T 7308335-G-T FGC14901 YY++
13490896-G-T 11335220-G-T FGC14906 ***
8913562-G-T 9045521-G-T **
13646552-AGAATG-A 11490876-AGAATG-A **
21638977-G-A 19477091-G-A Y107085 **
3185827-T-C 3317786-T-C **
22173133-G-T 20011247-G-T **
20617737-G-GA 18455851-G-GA LSC1 P4_Prx 8×A*****
18040669-C-A 15928789-C-A **
15857699-G-A 13745819-G-A CTS4843 **
17106443-T-G 14994563-T-G S4858 ZS9480 **
24270917-A-ATT 22124770-A-ATT P3_b1 19×T**
22666119-G-T 20504233-G-T **
13463586-C-A 11307910-C-A **
22602506-C-T 20440620-C-T K400 *****
22468416-A-G 20306530-A-G DYZ19 *****
28807314-T-C 26661167-T-C ***
28253569-T-A 26107422-T-A P1_b4 ***
28253568-T-A 26107421-T-A P1_b4 ***
28145176-A-C 25999029-A-C P1_b4 ***
28253566-T-A 26107419-T-A P1_b4 ***
28253556-G-A 26107409-G-A P1_b4 ***
28253561-T-C 26107414-T-C P1_b4 ***
28156907-G-A 26010760-G-A P1_b4 ***
28253559-G-A 26107412-G-A A10492 P1_b4 ***
28180774-G-C 26034627-G-C P1_b4 ***
28225632-A-G 26079485-A-G P1_b4 ***
28253552-G-A 26107405-G-A P1_b4 ***
28802826-A-G 26656679-A-G ***
28793121-G-T 26646974-G-T ***
28253570-T-A 26107423-T-A P1_b4 ***
28793136-T-G 26646989-T-G ***
28788048-G-A 26641901-G-A ***
28764794-G-C 26618647-G-C ***
28793126-G-A 26646979-G-A ***
28632291-C-A 26486144-C-A ***
28622663-C-A 26476516-C-A ***
28542952-C-A 26396805-C-A ***
28516884-G-A 26370737-G-A ***
28406906-G-A 26260759-G-A P1_gr2 ***
28793140-T-G 26646993-T-G ***
28253572-G-A 26107425-G-A P1_b4 ***
28364100-A-G 26217953-A-G P1_gr2 ***
28793141-G-A 26646994-G-A ***
28797898-A-G 26651751-A-G ***
28253578-C-T 26107431-C-T P1_b4 ***
28793120-T-G 26646973-T-G ***
28797900-G-C 26651753-G-C ***
28797901-T-A 26651754-T-A ***
28797902-G-C 26651755-G-C ***
28253574-G-A 26107427-G-A P1_b4 ***
28090628-T-G 25944481-T-G P1_Y2 ***
13430256-C-T 11274580-C-T ***
28071904-G-A 25925757-G-A P1_Y2 ***
27778207-G-A 25632060-G-A P1_Y2 ***
27854898-T-A 25708751-T-A P1_Y2 ***
27842562-G-T 25696415-G-T P1_Y2 ***
27807456-G-T 25661309-G-T P1_Y2 ***
27793198-G-T 25647051-G-T P1_Y2 ***
27792160-A-C 25646013-A-C P1_Y2 ***
27780532-C-A 25634385-C-A P1_Y2 ***
27778209-G-T 25632062-G-T P1_Y2 ***
27778208-G-A 25632061-G-A P1_Y2 ***
27778206-T-C 25632059-T-C P1_Y2 ***
27889206-T-G 25743059-T-G P1_Y2 ***
27778205-T-C 25632058-T-C P1_Y2 ***
27778204-A-C 25632057-A-C P1_Y2 ***
27778201-T-A 25632054-T-A P1_Y2 ***
27778199-C-A 25632052-C-A P1_Y2 ***
27778198-A-C 25632051-A-C P1_Y2 ***
27772621-G-A 25626474-G-A P1_Y2 ***
27761269-T-G 25615122-T-G P1_Y2 ***
27745639-C-A 25599492-C-A P1_Y2 ***
27873300-T-C 25727153-T-C P1_Y2 ***
27889215-C-G 25743068-C-G P1_Y2 ***
28015141-C-A 25868994-C-A P1_Y2 ***
27937918-G-A 25791771-G-A P1_Y2 ***
28007988-G-T 25861841-G-T P1_Y2 ***
27976967-T-A 25830820-T-A P1_Y2 ***
27965836-C-A 25819689-C-A P1_Y2 ***
27958797-C-A 25812650-C-A P1_Y2 ***
27957975-C-G 25811828-C-G P1_Y2 ***
27957864-T-A 25811717-T-A P1_Y2 ***
27957861-T-A 25811714-T-A P1_Y2 ***
27957860-C-A 25811713-C-A P1_Y2 ***
27898479-G-C 25752332-G-C P1_Y2 ***
27889219-T-G 25743072-T-G P1_Y2 ***
28807317-A-T 26661170-A-T ***
27889252-T-G 25743105-T-G P1_Y2 ***
27889251-C-A 25743104-C-A P1_Y2 ***
27889248-A-G 25743101-A-G P1_Y2 ***
27889247-G-A 25743100-G-A P1_Y2 ***
27889245-T-A 25743098-T-A P1_Y2 ***
27889243-G-T 25743096-G-T P1_Y2 ***
27889228-T-G 25743081-T-G P1_Y2 ***
28807316-G-C 26661169-G-C ***
58856014-T-G 56734857-A-C ***
28815132-T-C 26668985-T-C ***
19739799-GA-G 17627919-GA-G P5_Prx 16×A***
6308050-GCACA-G 6440009-GCACA-G IR3_Dst 9×CA***
24612840-AT-A 22466693-AT-A P3_t2 16×T***
24671142-CA-C 22524995-CA-C P3_b2 14×A***
20391409-G-GA 18229523-G-GA P5_Dst 12×A***
25273788-AT-A 23127641-AT-A P2_r1 21×T***
20107299-GA-G 17995419-GA-G P5_Dst 24×A***
20078758-C-CA 17966878-C-CA P5_Dst 16×A***
27311977-CA-C 25165830-CA-C P1_g3 16×A***
25883630-CT-C 23737483-CT-C P1_Y1 17×T***
20428495-A-AT 18266609-A-AT P5_Dst 15×T***
19700241-CA-C 17588361-CA-C P5_Prx 19×A***
25831940-C-CT 23685793-C-CT P1_b3 16×T***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
13468149-TTG-GTA 11312473-TTG-GTA ***
19831920-AAC-A 17720040-AAC-A P5_Prx 10×AC***
13505190-GAC-TAT 11349514-GAC-TAT ***
19763364-GA-G 17651484-GA-G P5_Prx 15×A***
13484928-ATG-TTC 11329252-ATG-TTC ***
9713326-GCACA-G 9875717-GCACA-G IR3_Prx 20×CA***
27166209-G-GA 25020062-G-GA P1_g3 11×A***
25592898-CTCTA-C 23446751-CTCTA-C P1_gr1 ***
8702810-GTTTTT-G 8834769-GTTTTT-G 21×T***
9575622-AT-A 9738013-AT-A IR3_Prx 10×T***
9574853-C-CA 9737244-C-CA IR3_Prx 12×A***
9535155-AT-A 9697546-AT-A IR3_Prx 17×T***
9336682-G-GA 9499073-G-GA 10×A***
9227529-GAA-G 9389920-GAA-G 13×A***
9215572-GT-G 9377963-GT-G ***
9215562-AGGC-GGGG 9377953-AGGC-GGGG ***
9075183-CTTATC-TTTTTT 9237574-CTTATC-TTTTTT ***
8555547-T-TTTTGTG 8687506-T-TTTTGTG ***
2817709-C-AA 2949668-C-AA 30×A***
7414303-AAG-A 7546262-AAG-A ***
7270276-C-TT 7402235-C-TT 25×T***
6960237-TAAAA-T 7092196-TAAAA-T 15×A***
6335208-CA-C 6467167-CA-C IR3_Dst 17×A***
6279798-CA-C 6411757-CA-C IR3_Dst 13×A***
5194004-CT-C 5325963-CT-C ***
4289043-GATCA-TATCG 4421002-GATCA-TATCG ***
3550569-CAACTC-AAAAAA 3682528-CAACTC-AAAAAA ***
19052438-AG-A 16940558-AG-A ***
7723829-GAAGAAAAGAA-G 7855788-GAAGAAAAGAA-G 12×AAGAA***
28816141-T-G 26669994-T-G ***
58824886-T-A 56765985-A-T ***
58848254-A-G 56742617-T-C ***
58848120-C-G 56742751-G-C ***
58848108-T-G 56742763-A-C ***
58830344-C-G 56760527-G-C ***
58830343-C-G 56760528-G-C ***
58826974-G-C 56763897-C-G ***
58825820-C-A 56765051-G-T ***
58825819-A-G 56765052-T-C ***
58822244-T-A 56768627-A-T ***
58856006-C-A 56734865-G-T ***
58822242-T-G 56768629-A-C ***
58821950-T-C 56768921-A-G ***
58821949-T-A 56768922-A-T ***
58821948-A-G 56768923-T-C ***
58821947-C-A 56768924-G-T ***
58821946-C-T 56768925-G-A ***
58820520-C-T 56770351-G-A ***
28816144-G-T 26669997-G-T ***
58848256-A-T 56742615-T-A ***
27534262-A-G 25388115-A-G P1_Y2 ***
16990247-AG-A 14878367-AG-A ***
58908825-C-G 56682046-G-C ***
15491536-C-CA 13379656-C-CA ***
59030594-A-C 56884447-A-C ***
59030591-A-T 56884444-A-T ***
59022255-G-A 56876108-G-A ***
59015887-C-T 56869740-C-T ***
59009279-C-A 56863132-C-A ***
58993351-G-A 56847204-G-A ***
58982289-A-G 56836142-A-G ***
58908822-A-G 56682049-T-C ***
58856017-C-G 56734854-G-C ***
58880691-C-T 56710180-G-A ***
58880230-A-T 56710641-T-A ***
58873179-A-C 56717692-T-G ***
58873165-A-T 56717706-T-A ***
58862755-A-G 56728116-T-C ***
58856039-T-A 56734832-A-T ***
58856031-C-T 56734840-G-A ***
58856023-A-G 56734848-T-C ***
27585886-T-A 25439739-T-A P1_Y2 ***
27156249-A-T 25010102-A-T P1_g3 ***
27427856-C-G 25281709-C-G P1_g3 ***
25264625-G-A 23118478-G-A P2_r1 ***
25422154-G-T 23276007-G-T P2_r2 ***
25411105-C-A 23264958-C-A P2_r2 ***
25411103-T-A 23264956-T-A P2_r2 ***
25388378-A-C 23242231-A-C P2_r2 ***
25388374-T-G 23242227-T-G P2_r2 ***
25379019-G-C 23232872-G-C P2_r2 ***
25362560-A-G 23216413-A-G P2_r2 ***
25231902-T-G 23085755-T-G P2_r1 ***
25426960-C-A 23280813-C-A P2_r2 ***
25177351-T-A 23031204-T-A g1 ***
24865953-A-G 22719806-A-G P3_b2 ***
24861639-A-C 22715492-A-C P3_b2 ***
24859754-C-A 22713607-C-A P3_b2 ***
24791048-C-T 22644901-C-T P3_b2 ***
24783435-C-A 22637288-C-A P3_b2 ***
24781396-T-C 22635249-T-C P3_b2 ***
24778472-A-T 22632325-A-T P3_b2 ***
25426949-A-T 23280802-A-T P2_r2 ***
25440100-T-C 23293953-T-C P2_r2 ***
24778331-C-A 22632184-C-A P3_b2 ***
25899758-C-A 23753611-C-A P1_Y1 ***
26416267-G-A 24270120-G-A P1_Y1 ***
26416265-C-A 24270118-C-A P1_Y1 ***
26416264-C-T 24270117-C-T P1_Y1 ***
26292696-G-T 24146549-G-T P1_Y1 ***
26246479-A-C 24100332-A-C P1_Y1 ***
26135601-A-T 23989454-A-T P1_Y1 ***
26010312-A-G 23864165-A-G P1_Y1 ***
26010298-A-G 23864151-A-G P1_Y1 ***
25766612-A-T 23620465-A-T P1_b3 ***
25461157-C-A 23315010-C-A P2_r2 ***
25690027-G-T 23543880-G-T P1_b3 ***
25679434-G-T 23533287-G-T P1_b3 ***
25660427-G-C 23514280-G-C P1_b3 ***
25656540-C-T 23510393-C-T P1_b3 ***
25651436-A-C 23505289-A-C P1_b3 ***
25592924-A-C 23446777-A-C P1_gr1 ***
25491449-G-A 23345302-G-A P2_r2 ***
25462473-T-C 23316326-T-C P2_r2 ***
24778353-T-C 22632206-T-C P3_b2 ***
24766925-G-A 22620778-G-A P3_b2 ***
26416320-G-A 24270173-G-A P1_Y1 ***
24677761-A-G 22531614-A-G P3_b2 ***
24680305-T-G 22534158-T-G P3_b2 ***
24680301-A-G 22534154-A-G P3_b2 ***
24680300-C-G 22534153-C-G P3_b2 ***
24680299-A-C 22534152-A-C P3_b2 ***
24680298-G-T 22534151-G-T P3_b2 ***
24680297-A-C 22534150-A-C P3_b2 ***
24680296-A-G 22534149-A-G P3_b2 ***
24680295-A-G 22534148-A-G P3_b2 ***
24655780-C-A 22509633-C-A P3_b2 ***
24680309-C-A 22534162-C-A P3_b2 ***
24640538-G-T 22494391-G-T P3_t2 ***
24607276-G-A 22461129-G-A P3_t2 ***
24587844-C-G 22441697-C-G P3_t2 ***
24579655-G-T 22433508-G-T P3_t2 ***
24566453-T-C 22420306-T-C P3_t2 ***
24553945-G-A 22407798-G-A P3_t2 ***
24549642-G-C 22403495-G-C P3_t2 ***
24432627-G-T 22286480-G-T ***
24680307-T-G 22534160-T-G P3_b2 ***
24680310-A-T 22534163-A-T P3_b2 ***
24741664-G-T 22595517-G-T P3_b2 ***
24714105-G-C 22567958-G-C P3_b2 ***
24739332-C-T 22593185-C-T P3_b2 ***
24731520-T-A 22585373-T-A P3_b2 ***
24728982-C-A 22582835-C-A P3_b2 ***
24728547-G-T 22582400-G-T P3_b2 ***
24714120-A-G 22567973-A-G P3_b2 ***
24714113-C-T 22567966-C-T P3_b2 ***
24714112-C-G 22567965-C-G P3_b2 ***
24714107-T-G 22567960-T-G P3_b2 ***
24714103-A-G 22567956-A-G P3_b2 ***
24680311-T-A 22534164-T-A P3_b2 ***
24710683-C-T 22564536-C-T P3_b2 ***
24709600-G-T 22563453-G-T P3_b2 ***
24680318-G-A 22534171-G-A P3_b2 ***
24680317-G-C 22534170-G-C P3_b2 ***
24680316-T-A 22534169-T-A P3_b2 ***
24680315-C-G 22534168-C-G P3_b2 ***
24680313-A-G 22534166-A-G P3_b2 ***
24680312-C-A 22534165-C-A P3_b2 ***
26416269-C-A 24270122-C-A P1_Y1 ***
26416321-G-A 24270174-G-A P1_Y1 ***
27382640-G-T 25236493-G-T P1_g3 ***
27035425-G-T 24889278-G-T P1_r4 ***
9671339-CT-C 9833730-CT-C IR3_Prx 14×T***
27154703-T-C 25008556-T-C P1_g3 ***
27151300-A-C 25005153-A-C P1_g3 ***
27149695-T-A 25003548-T-A P1_g3 ***
27131569-T-G 24985422-T-G P1_g3 ***
27080501-A-T 24934354-A-T P1_r4 ***
27080494-G-T 24934347-G-T P1_r4 ***
27033051-G-T 24886904-G-T P1_r4 ***
27217562-A-T 25071415-A-T P1_g3 ***
27033049-A-C 24886902-A-C P1_r4 ***
27033046-C-T 24886899-C-T P1_r4 ***
27030486-T-C 24884339-T-C P1_r4 ***
26993696-G-T 24847549-G-T P1_r4 ***
26993594-A-G 24847447-A-G P1_r4 ***
26992945-C-A 24846798-C-A P1_r4 ***
26992936-C-T 24846789-C-T P1_r4 ***
26990069-C-T 24843922-C-T P1_r4 ***
27167874-T-G 25021727-T-G P1_g3 ***
27217588-T-A 25071441-T-A P1_g3 ***
26943759-A-G 24797612-A-G P1_r3 ***
27300998-T-A 25154851-T-A P1_g3 ***
27381824-T-A 25235677-T-A P1_g3 ***
27375822-A-T 25229675-A-T P1_g3 ***
27362789-C-A 25216642-C-A P1_g3 ***
27354843-A-T 25208696-A-T P1_g3 ***
27344272-T-C 25198125-T-C P1_g3 ***
27315566-G-T 25169419-G-T P1_g3 ***
27315343-A-C 25169196-A-C P1_g3 ***
27311995-T-G 25165848-T-G P1_g3 ***
27300845-G-T 25154698-G-T P1_g3 ***
27231451-G-A 25085304-G-A P1_g3 ***
27300823-T-C 25154676-T-C P1_g3 ***
27300099-A-G 25153952-A-G P1_g3 ***
27299097-T-A 25152950-T-A P1_g3 ***
27271119-G-A 25124972-G-A P1_g3 ***
27256433-G-A 25110286-G-A P1_g3 ***
27234696-G-T 25088549-G-T P1_g3 ***
27233673-G-T 25087526-G-T P1_g3 ***
27233583-A-C 25087436-A-C P1_g3 ***
26953166-G-C 24807019-G-C P1_r3 ***
26914067-G-T 24767920-G-T P1_r3 ***
26416322-C-A 24270175-C-A P1_Y1 ***
26416336-T-A 24270189-T-A P1_Y1 ***
26416345-T-A 24270198-T-A P1_Y1 ***
26416344-G-A 24270197-G-A P1_Y1 ***
26416343-T-A 24270196-T-A P1_Y1 ***
26416342-C-A 24270195-C-A P1_Y1 ***
26416341-C-A 24270194-C-A P1_Y1 ***
26416340-G-A 24270193-G-A P1_Y1 ***
26416339-C-A 24270192-C-A P1_Y1 ***
26416337-C-A 24270190-C-A P1_Y1 ***
26416335-C-A 24270188-C-A P1_Y1 ***
26416349-C-A 24270202-C-A P1_Y1 ***
26416332-T-A 24270185-T-A P1_Y1 ***
26416329-C-A 24270182-C-A P1_Y1 ***
26416328-G-A 24270181-G-A P1_Y1 ***
26416327-T-A 24270180-T-A P1_Y1 ***
26416326-G-A 24270179-G-A P1_Y1 ***
26416325-G-A 24270178-G-A P1_Y1 ***
26416324-G-A 24270177-G-A P1_Y1 ***
26416323-T-A 24270176-T-A P1_Y1 ***
26416348-T-A 24270201-T-A P1_Y1 ***
26416350-C-A 24270203-C-A P1_Y1 ***
26914064-C-T 24767917-C-T P1_r3 ***
26884356-T-G 24738209-T-G P1_r3 ***
26914047-C-T 24767900-C-T P1_r3 ***
26914044-C-T 24767897-C-T P1_r3 ***
26912594-T-C 24766447-T-C P1_r3 ***
26902359-G-A 24756212-G-A P1_r3 ***
26902353-T-A 24756206-T-A P1_r3 ***
26902340-G-A 24756193-G-A P1_r3 ***
26902334-T-C 24756187-T-C P1_r3 ***
26884393-C-G 24738246-C-G P1_r3 ***
26544669-T-A 24398522-T-A P1_g2 ***
26416351-C-A 24270204-C-A P1_Y1 ***
26529496-G-T 24383349-G-T P1_g2 ***
26529480-G-T 24383333-G-T P1_g2 ***
26416360-G-A 24270213-G-A P1_Y1 ***
26416359-T-A 24270212-T-A P1_Y1 ***
26416358-T-A 24270211-T-A P1_Y1 ***
26416357-T-A 24270210-T-A P1_Y1 ***
26416356-C-A 24270209-C-A P1_Y1 ***
26416353-G-A 24270206-G-A P1_Y1 ***
9656115-TGAGCAGCAGAGGGAGGAGCTGG-T 9818506-TGAGCAGCAGAGGGAGGAGCTGG-T IR3_Prx ***
13472128-TG-CT 11316452-TG-CT ***
9700802-AAT-A 9863193-AAT-A IR3_Prx ***
27760365-G-GT 25614218-G-GT P1_Y2 9×T***
27957956-AGACTGAGGCTTATTTCT-CTGTCTCTTATACACATC 25811809-AGACTGAGGCTTATTTCT-CTGTCTCTTATACACATC P1_Y2 ***
27881475-CT-C 25735328-CT-C P1_Y2 12×T***
27868124-C-CA 25721977-C-CA P1_Y2 13×A***
27808854-T-TA 25662707-T-TA P1_Y2 10×A***
27794677-CATATATATAT-C 25648530-CATATATATAT-C P1_Y2 12×AT***
27791904-C-CTCTTCT 25645757-C-CTCTTCT P1_Y2 25×TCT***
27780449-C-CA 25634302-C-CA P1_Y2 18×A***
27760106-CA-C 25613959-CA-C P1_Y2 16×A***
27994688-TA-T 25848541-TA-T P1_Y2 13×A***
27739907-G-GA 25593760-G-GA P1_Y2 10×A***
27719028-CCTGG-C 25572881-CCTGG-C P1_Y2 5×CTGG***
27665355-AAT-A 25519208-AAT-A P1_Y2 ***
27641766-C-CT 25495619-C-CT P1_Y2 14×T***
27550462-CT-C 25404315-CT-C P1_Y2 13×T***
27477668-T-TA 25331521-T-TA P1_Y2 8×A***
27433614-TAG-T 25287467-TAG-T P1_g3 ***
27427815-GA-G 25281668-GA-G P1_g3 14×A***
27960966-TAAAA-T 25814819-TAAAA-T P1_Y2 18×A***
28010653-AAATTCCT-GTGTATAA 25864506-AAATTCCT-GTGTATAA P1_Y2 ***
27412865-ATG-A 25266718-ATG-A P1_g3 17×TG***
28453895-C-CA 26307748-C-CA P1_gr2 14×A***
28805345-CA-AT 26659198-CA-AT ***
28803845-AG-TA 26657698-AG-TA ***
28802841-TTGG-GCGA 26656694-TTGG-GCGA ***
28802831-ATTGAG-GTGGAC 26656684-ATTGAG-GTGGAC ***
28788027-GGAG-TGAA 26641880-GGAG-TGAA ***
28585667-CTG-GTA 26439520-CTG-GTA ***
28585643-GTTAT-G 26439496-GTTAT-G ***
28545693-CTAC-TTTA 26399546-CTAC-TTTA ***
28406839-CA-C 26260692-CA-C P1_gr2 16×A***
28010760-TGGTA-CTGTC 25864613-TGGTA-CTGTC P1_Y2 ***
28384346-TAAAAATGTATAAAGTAAAAAAATTATAGTA-T 26238199-TAAAAATGTATAAAGTAAAAAAATTATAGTA-T P1_gr2 ***
28359941-GACAAAA-G 26213794-GACAAAA-G P1_gr2 ***
28230906-TATTCATACAGTTGACTGGAAA-T 26084759-TATTCATACAGTTGACTGGAAA-T P1_b4 ***
28228315-C-CA 26082168-C-CA P1_b4 11×A***
28180717-AG-A 26034570-AG-A P1_b4 ***
28103948-TC-T 25957801-TC-T P1_Y2 ***
28103658-GT-G 25957511-GT-G P1_Y2 ***
28033129-CAAAAA-C 25886982-CAAAAA-C P1_Y2 17×A***
27427485-CA-C 25281338-CA-C P1_g3 8×A***
27357557-TAA-T 25211410-TAA-T P1_g3 14×A***
58821862-GATTCC-G 56768990-TAATGG-T ***
25462499-TCTT-AGACA 23316352-TCTT-AGACA P2_r2 ***
25781074-G-GT 23634927-G-GT P1_b3 12×T***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25675782-TA-T 23529635-TA-T P1_b3 12×A***
25651595-TCTTC-T 23505448-TCTTC-T P1_b3 ***
25626843-AAG-A 23480696-AAG-A P1_b3 ***
25466562-AGGGA-GGGGG 23320415-AGGGA-GGGGG P2_r2 ***
25466146-G-GA 23319999-G-GA P2_r2 12×A***
25462474-TTGGTTACTGTAGCTTAGTA-GTCGGCAGCGTCAGATGTGT 23316327-TTGGTTACTGTAGCTTAGTA-GTCGGCAGCGTCAGATGTGT P2_r2 ***
26102968-CTTTA-TTTTT 23956821-CTTTA-TTTTT P1_Y1 ***
25460841-A-AG 23314694-A-AG P2_r2 ***
25452458-GT-G 23306311-GT-G P2_r2 13×T***
25445578-CTGTATATATATATATATATATA-C 23299431-CTGTATATATATATATATATATA-C P2_r2 ***
25426962-A-AT 23280815-A-AT P2_r2 10×T***
25412886-CT-C 23266739-CT-C P2_r2 ***
25403566-TG-T 23257419-TG-T P2_r2 ***
25312610-AAG-A 23166463-AAG-A P2_r1 ***
25303350-GA-G 23157203-GA-G P2_r1 ***
25940445-CTT-C 23794298-CTT-C P1_Y1 17×T***
26167728-GTATA-G 24021581-GTATA-G P1_Y1 12×TA***
27357387-AGACAGTGAT-CGGCAGCGTC 25211240-AGACAGTGAT-CGGCAGCGTC P1_g3 ***
27029157-AT-A 24883010-AT-A P1_r4 ***
27315588-G-GA 25169441-G-GA P1_g3 10×A***
27233561-CAAA-C 25087414-CAAA-C P1_g3 ***
27232906-CT-C 25086759-CT-C P1_g3 ***
27214310-CT-C 25068163-CT-C P1_g3 10×T***
27186323-GA-G 25040176-GA-G P1_g3 19×A***
27181012-TG-T 25034865-TG-T P1_g3 ***
27173659-G-AAA 25027512-G-AAA P1_g3 13×A***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
26942264-G-GA 24796117-G-GA P1_r3 ***
26179768-AAC-A 24033621-AAC-A P1_Y1 ***
26900285-AAG-A 24754138-AAG-A P1_r3 ***
26890135-GATATATAT-G 24743988-GATATATAT-G P1_r3 20×AT***
26880197-TC-T 24734050-TC-T P1_r3 ***
26834526-C-CAAGA 24688379-C-CAAGA P1_g2 ***
26541535-TA-T 24395388-TA-T P1_g2 21×A***
26416270-TCCCCA-T 24270123-TCCCCA-T P1_Y1 ***
26277532-CT-C 24131385-CT-C P1_Y1 ***
26269442-GA-G 24123295-GA-G P1_Y1 14×A***
58820412-TA-C 56770458-TA-G ***
58822245-TC-T 56768624-CG-C ***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
13472112-CGCACGCGCA-TGCATGCGAG 11316436-CGCACGCGCA-TGCATGCGAG ***
22361071-CTA-AG 20199185-CTA-AG DYZ19 ***
13709505-AGCTCCAATGGAATGGAG-GGC 11553829-AGCTCCAATGGAATGGAG-GGC ***
23505519-C-AAA 21343633-C-AAA ***
24096551-AATAAAAGCT-TAAGAGACAG 21950404-AATAAAAGCT-TAAGAGACAG P3_b1 ***
13833405-TTGATTA-CAGATTG 11712699-TTGATTA-CAGATTG ***
4288981-AAACAA-GAAC 4420940-AAACAA-GAAC ***
9745961-GGTAGCTAGGC-TATAAGAGACA 9908352-GGTAGCTAGGC-TATAAGAGACA ***
20084452-CTTTCTTTC-TTTTTTTTTTTT 17972572-CTTTCTTTC-TTTTTTTTTTTT P5_Dst ***
13809821-TTGGACTT-ATG 11689115-TTGGACTT-ATG ***
20508989-TAGAGAGAGAGAG-AGATGTGTATA 18347103-TAGAGAGAGAGAG-AGATGTGTATA P5_Dst 8×AG***
20087301-CAGACAGTCCATGTGAGT-GATGTGTATAAGAGACA 17975421-CAGACAGTCCATGTGAGT-GATGTGTATAAGAGACA P5_Dst ***
20434280-TA-T 18272394-TA-T P5_Dst 18×A***
13811031-TTCGAATGGAA-CTTGAATGGAT 11690325-TTCGAATGGAA-CTTGAATGGAT ***
16162115-G-AA 14050235-G-AA P8_Dst ***
23435202-C-TT 21273316-C-TT ***
26228681-CTTTCTTTC-TTTTTT 24082534-CTTTCTTTC-TTTTTT P1_Y1 ***
22520812-G-AA 20358926-G-AA ***
58824883-CC-A 56765987-GG-T ***
13810172-AA-TG 11689466-AA-TG ***
20593055-CAA-C 18431169-CAA-C P5_Dst 22×A***
13143656-AC-GG 10633142-AC-GG ***
26060208-GACT-A 23914061-GACT-A P1_Y1 ***
21556943-GTC-TT 19395057-GTC-TT ***
58974437-ATTCGA-T 56828290-ATTCGA-T ***
58976110-TAC-CAT 56829963-TAC-CAT ***
22504956-TG-AGT 20343070-TG-AGT DYZ19 ***
58974458-ATCA-TTCC 56828311-ATCA-TTCC ***
25333827-TAGC-AAAA 23187680-TAGC-AAAA P2_r1 ***
20428562-TG-AA 18266676-TG-AA P5_Dst ***
19829294-ACTTTC-TTT 17717414-ACTTTC-TTT P5_Prx ***
22293342-TT-G 20131456-TT-G DYZ19 ***
26902321-GAAATAG-AAAA 24756174-GAAATAG-AAAA P1_r3 ***
13825036-AAC-CAGA 11704330-AAC-CAGA ***
19979863-GC-T 17867983-GC-T P5_Prx ***
22268536-CTTTAC-ATTGGT 20106650-CTTTAC-ATTGGT DYZ19 ***
9941298-TAA-CAG 10103689-TAA-CAG ***
27971764-CACAAAG-AAAA 25825617-CACAAAG-AAAA P1_Y2 ***
19052443-GAAAG-AAAAA 16940563-GAAAG-AAAAA ***
26914069-ATTAAGTTCTAC-T 24767922-ATTAAGTTCTAC-T P1_r3 ***
22970310-T-AA 20808424-T-AA ***
58823397-ATTTTATTGCATTAGATTCTATTCCATTGGATTACT-GTTTTATTGCATTAGATTCTA 56767439-AGTAATCCAATGGAATAGAATCTAATGCAATAAAAT-TAGAATCTAATGCAATAAAAC ***
58822803-AT-A 56768060-CA-C ***
58910665-ATTCCATTCCATTCCATTCCATTTCATATTG-A 56680162-TGAATGGAATGGAACAATATGAAATGGAATG-T ***
58979661-TTTAC-ATTAT 56833514-TTTAC-ATTAT ***
58979543-ATCAA-GTCAC 56833396-ATCAA-GTCAC ***
58977628-CTCCC-TTCCA 56831481-CTCCC-TTCCA ***
58977617-TCTCCAC-ATTCAAT 56831470-TCTCCAC-ATTCAAT ***
58976766-ACATTCTATAA-CCACAACATTC 56830619-ACATTCTATAA-CCACAACATTC ***
58976492-TTG-CTC 56830345-TTG-CTC ***
58973830-GATTT-TATTC 56827683-GATTT-TATTC ***
58972058-AT-CA 56825911-AT-CA ***
58882846-TC-T 56708023-CG-C ***
58981931-CTGCAT-GTCCAC 56835784-CTGCAT-GTCCAC ***
58873167-TA-AT 56717703-TA-AT ***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
58862488-GCATTC-G 56728358-CAATGG-C 4×CATTC***
58831311-G-GATTCCATTCCTTTCC 56759534-T-TGGAATGGAATGGAAA ***
58829600-GTACGAT-TTTCGAA 56761265-ATCGTAC-TTCGAAA ***
58825903-CCCATT-C 56764945-AGGAAT-A 4×CCATT***
58825521-CTTCCATTCGATTCCA-C 56765327-CAATGGAATGGAATCG-C ***
58823386-TATC-CATT 56767482-GATA-AATG ***
58979908-GT-CA 56833761-GT-CA ***
58982081-AAT-CAC 56835934-AAT-CAC ***
25207874-G-AAA 23061727-G-AAA P2_r1 ***
7387383-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT 7519342-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT ***
14743174-G-AA 12631242-G-AA ***
19892861-ATTTCTTG-TTTTTTT 17780981-ATTTCTTG-TTTTTTT P5_Prx ***
13865775-GAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT-CTATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAGGCGAAA 11745069-GAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT-CTATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAGGCGAAA ***
9591034-G-AA 9753425-G-AA IR3_Prx 12×A***
5785701-C-AA 5917660-C-AA 14×A***
9403543-G-TT 9565934-G-TT ***
9307401-TGTGTGTG-AGTT 9469792-TGTGTGTG-AGTT ***
16107436-GTTTCAG-TTTTTTTTTT 13995556-GTTTCAG-TTTTTTTTTT P8_Prx ***
2795555-ATTTG-TTTT 2927514-ATTTG-TTTT ***
58982115-CCAT-ACAC 56835968-CCAT-ACAC ***
26100508-AGT-A 23954361-AGT-A P1_Y1 ***
20757362-AT-A 18595476-AT-A P4_Prx 32×T***
15882429-G-GTT 13770549-G-GTT 13×T***
58993292-CA-TG 56847145-CA-TG ***
58988582-C-CT 56842435-C-CT ***
58983207-TCA-CCG 56837060-TCA-CCG ***
58982322-GCT-CCA 56836175-GCT-CCA ***
58982279-GT-AC 56836132-GT-AC ***
25300961-GA-G 23154814-GA-G P2_r1 ***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
9725539-CT-C 9887930-CT-C IR3_Prx ***
13731762-TC-GG 11576086-TC-GG ***
13825065-ATGCAATGG-GTATAATTT 11704359-ATGCAATGG-GTATAATTT ***
13819959-T-TGAATGGAATG 11699253-T-TGAATGGAATG 14×GAATG***
13809794-AAGTGGAA-GACTGGGG 11689088-AAGTGGAA-GACTGGGG ***
13809728-ATAAA-CAATT 11689022-ATAAA-CAATT ***
13803166-AA-TG 11682460-AA-TG ***
13799165-C-TGAAAGCAATG 11678459-C-TGAAAGCAATG ***
13799151-TAAT-GAAG 11678445-TAAT-GAAG ***
13723359-GTCA-CTCG 11567683-GTCA-CTCG ***
13859477-CTCGAAAG-ATCAAATA 11738771-CTCGAAAG-ATCAAATA ***
13722651-AC-TG 11566975-AC-TG ***
13716685-T-TGGAAA 11561009-T-TGGAAA ***
13714719-AGGAA-TGGAC 11559043-AGGAA-TGGAC ***
13714172-CACTC-TACTG 11558496-CACTC-TACTG ***
13714041-CA-GG 11558365-CA-GG ***
13714019-ATGGACTCGAATGGAGAA-CTCGATCAGAACGGACTG 11558343-ATGGACTCGAATGGAGAA-CTCGATCAGAACGGACTG ***
13714007-C-CAATGA 11558331-C-CAATGA ***
13709578-CA-TT 11553902-CA-TT ***
13847132-ATCAAAA-TCGAATG 11726426-ATCAAAA-TCGAATG ***
13859491-TCT-ACG 11738785-TCT-ACG ***
13702690-CA-C 11547014-CA-C ***
17648009-CAAAAAA-C 15536129-CAAAAAA-C 17×A***
19339964-CGGAA-TTCTT 17228084-CGGAA-TTCTT ***
18490252-CT-C 16378372-CT-C P6_Dst 11×T***
18480043-GA-G 16368163-GA-G P6_Dst 17×A***
18479588-G-GA 16367708-G-GA P6_Dst 11×A***
18462594-C-CAT 16350714-C-CAT P6_Dst ***
18429196-C-CAA 16317316-C-CAA P6_Dst 17×A***
18012134-AT-A 15900254-AT-A P7_Dst 11×T***
17989585-TAC-T 15877705-TAC-T P7_Prx 9×AC***
17128526-TTTCAAAATC-CTTTTAAAAA 15016646-TTTCAAAATC-CTTTTAAAAA ***
13861483-CAAG-TGAA 11740777-CAAG-TGAA ***
16772435-ATTTT-A 14660555-ATTTT-A 17×T***
16340147-G-AA 14228267-G-AA 22×A***
16164521-AC-TA 14052641-AC-TA P8_Dst ***
16157801-ATG-GAA 14045921-ATG-GAA P8_Dst ***
16157793-ACTTTCC-GAAGGAA 14045913-ACTTTCC-GAAGGAA P8_Dst ***
16157672-CAACTTAGTCAATAACTAGCCTTCAAAATAAAT-GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG 14045792-CAACTTAGTCAATAACTAGCCTTCAAAATAAAT-GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG P8_Dst ***
15320664-G-AGAA 13208764-GGAAGAGGAA-G 18×GAA***
13861578-GGATTGGAGTGGA-CGAATGAACTGGG 11740872-GGATTGGAGTGGA-CGAATGAACTGGG ***
13704404-TACTCA-GAATGG 11548728-TACTCA-GAATGG ***
13701778-TGAATC-ACAAGA 11546102-TGAATC-ACAAGA ***
19682363-G-GAAAT 17570483-G-GAAAT P5_Prx ***
10043477-TG-CA 10205868-TG-CA ***
13456016-GTTGAT-G 11300340-GTTGAT-G ***
13455657-GG-TC 11299981-GG-TC ***
13453405-TA-AT 11297729-TA-AT ***
13453123-T-TCATTCCATTC 11297447-T-TCATTCCATTC 14×CATTC***
13447763-TC-CA 11292087-TC-CA ***
13253523-GGAT-AGAC 11097847-GGAT-AGAC ***
13203958-CATTATGGATGACCACCCCGCCTC-TGATAATGGTGATAATGACGGTAT 11048282-CATTATGGATGACCACCCCGCCTC-TGATAATGGTGATAATGACGGTAT ***
10104537-GAACTATGTCGGA-TATCCACTTTCAG 10266928-GAACTATGTCGGA-TATCCACTTTCAG ***
10012701-CTGG-TTGT 10175092-CTGG-TTGT ***
13463768-G-TC 11308092-G-TC ***
9995971-TG-CA 10158362-TG-CA ***
9987528-AGAGCG-GGAACA 10149919-AGAGCG-GGAACA ***
9952535-TGC-CGT 10114926-TGC-CGT ***
9945024-CAGAT-TAGAC 10107415-CAGAT-TAGAC ***
9941347-CC-TT 10103738-CC-TT ***
9936818-AG-CA 10099209-AG-CA ***
9798063-GTTTT-G 9960454-GTTTT-G 17×T***
9732895-CAAA-C 9895286-CAAA-C IR3_Prx 20×A***
13456090-TA-AT 11300414-TA-AT ***
13466461-AAATG-TAAAT 11310785-AAATG-TAAAT ***
13701770-CATT-TATG 11546094-CATT-TATG ***
13484389-CAAT-AAAC 11328713-CAAT-AAAC ***
13701338-GAACTC-CGAACG 11545662-GAACTC-CGAACG ***
13701321-ATGGAAGGGAATA-TTTGAACAGATTG 11545645-ATGGAAGGGAATA-TTTGAACAGATTG ***
13700228-ATG-GTA 11544552-ATG-GTA ***
13697388-C-CTATGGAATGGAATGGAATGGAATGG 11541712-C-CTATGGAATGGAATGGAATGGAATGG ***
13487755-AACCCCCCGGCCA-CACCCCCCAGCCG 11332079-AACCCCCCGGCCA-CACCCCCCAGCCG ***
13485852-CACCG-TACCA 11330176-CACCG-TACCA ***
13485613-AATG-GATT 11329937-AATG-GATT ***
13484967-CTGT-TTGC 11329291-CTGT-TTGC ***
13480942-CTGGGTGATCA-ATAAGAGACAG 11325266-CTGGGTGATCA-ATAAGAGACAG ***
13468192-CTTAT-GTTAC 11312516-CTTAT-GTTAC ***
13480641-TGC-AGA 11324965-TGC-AGA ***
13480632-TTCCT-CTCCC 11324956-TTCCT-CTCCC ***
13479048-AGGCA-CGGCG 11323372-AGGCA-CGGCG ***
13478187-CACCGGGGCGGC-TGCCTGGGCAG 11322511-CACCGGGGCGGC-TGCCTGGGCAG ***
13473684-CT-GA 11318008-CT-GA ***
13473678-AC-A 11318002-AC-A ***
13472204-AGAC-A 11316528-AGAC-A ***
24343478-T-G 22197331-T-G P3_t1 ***
19647571-CT-C 17535691-CT-C P5_Prx 16×T***
19811648-TC-AA 17699768-TC-AA P5_Prx ***
25272972-G-GA 23126825-G-GA P2_r1 19×A***
23666260-AAGTGT-A 21504374-AAGTGT-A ***
24295863-CT-C 22149716-CT-C P3_t1 17×T***
24235386-GG-TT 22089239-GG-TT P3_b1 ***
24096349-CA-C 21950202-CA-C P3_b1 16×A***
24045400-CCCCCC-GAGACA 21899253-CCCCCC-GAGACA ***
24045304-ATT-A 21899157-ATT-A ***
24025717-GA-G 21879570-GA-G ***
23897027-GCCAG-ACCAT 21735141-GCCAG-ACCAT ***
23267044-C-CTT 21105158-C-CTT 13×T***
24577903-AG-A 22431756-AG-A P3_t2 ***
22503218-TC-T 20341332-TC-T DYZ19 ***
22503151-CAGAA-AAGAG 20341265-CAGAA-AAGAG DYZ19 ***
22490958-AT-GA 20329072-AT-GA DYZ19 ***
22448697-TC-T 20286811-TC-T DYZ19 ***
22427194-CT-AG 20265308-CT-AG DYZ19 ***
22365272-ATGTGTCCAG-A 20203386-ATGTGTCCAG-A DYZ19 ***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
22341580-CA-TG 20179694-CA-TG DYZ19 ***
24336793-C-TT 22190646-C-TT P3_t1 20×T***
24587845-TGCTG-AGACA 22441698-TGCTG-AGACA P3_t2 ***
22284901-CTTCT-C 20123015-CTTCT-C DYZ19 ***
24760630-T-TA 22614483-T-TA P3_b2 15×A***
24966789-GTCAC-CTGAAA 22820642-GTCAC-CTGAAA g1 ***
24895715-GTTG-TTTT 22749568-GTTG-TTTT g1 ***
24895633-GA-G 22749486-GA-G g1 17×A***
24860018-C-AAAA 22713871-C-AAAA P3_b2 27×A***
24830466-CAACAAC-AAAAAAA 22684319-CAACAAC-AAAAAAA P3_b2 ***
24796652-GT-G 22650505-GT-G P3_b2 8×T***
24778646-CAG-TCT 22632499-CAG-TCT P3_b2 ***
24778641-AGAC-CTGT 22632494-AGAC-CTGT P3_b2 ***
24760000-T-TTA 22613853-T-TTA P3_b2 11×TA***
24607321-CT-C 22461174-CT-C P3_t2 12×T***
24754928-TAA-T 22608781-TAA-T P3_b2 15×A***
24739651-CT-C 22593504-CT-C P3_b2 13×T***
24731521-GG-CA 22585374-GG-CA P3_b2 ***
24718255-AGGAGAGAATAT-GTATAAGAGACA 22572108-AGGAGAGAATAT-GTATAAGAGACA P3_b2 ***
24712699-GTAA-G 22566552-GTAA-G P3_b2 ***
24711544-GT-G 22565397-GT-G P3_b2 11×T***
24658480-CTTT-C 22512333-CTTT-C P3_b2 14×T***
24637403-C-CT 22491256-C-CT P3_t2 11×T***
22295980-GGTCC-TGTCT 20134094-GGTCC-TGTCT DYZ19 ***
22247015-GATAAGTC-TATGTCTA 20085129-GATAAGTC-TATGTCTA DYZ19 ***
19868141-GCTTC-TTTTT 17756261-GCTTC-TTTTT P5_Prx ***
20207102-CA-C 18045216-CA-C P5_Dst 10×A***
20318892-TAA-T 18157006-TAA-T P5_Dst 27×A***
20252819-AAG-A 18090933-AAG-A P5_Dst ***
20249702-C-CA 18087816-C-CA P5_Dst 13×A***
20230740-AAT-GAC 18068854-AAT-GAC P5_Dst ***
20230695-GTATG-CTATA 18068809-GTATG-CTATA P5_Dst ***
20230667-TTT-CTG 18068781-TTT-CTG P5_Dst ***
20213749-ATT-A 18051863-ATT-A P5_Dst 14×T***
20210969-AC-A 18049083-AC-A P5_Dst ***
20197205-G-GA 18035319-G-GA P5_Dst 14×A***
20347544-ATTAT-A 18185658-ATTAT-A P5_Dst 5×TTAT***
20195017-CA-C 18033131-CA-C P5_Dst ***
20194878-A-AT 18032992-A-AT P5_Dst 10×T***
20142001-A-AT 18030121-A-AT P5_Dst 9×T***
20130900-G-GT 18019020-G-GT P5_Dst 9×T***
20110561-GA-G 17998681-GA-G P5_Dst 20×A***
20096718-C-CA 17984838-C-CA P5_Dst 10×A***
20084495-CTTTC-TTTTT 17972615-CTTTC-TTTTT P5_Dst ***
20022467-TC-T 17910587-TC-T P5_Prx ***
20345145-GC-G 18183259-GC-G P5_Dst ***
20348015-A-ATT 18186129-A-ATT P5_Dst 11×T***
22241181-TAA-CAT 20079295-TAA-CAT DYZ19 ***
20872423-TCTGA-CCTGG 18710537-TCTGA-CCTGG P4_Dst ***
22237314-CC-AA 20075428-CC-AA DYZ19 ***
21306618-GAAAGAAAG-AAAAAAAAA 19144732-GAAAGAAAG-AAAAAAAAA ***
21011657-G-GT 18849771-G-GT P4_Dst 11×T***
20953988-G-GA 18792102-G-GA P4_Dst 12×A***
20951304-TA-T 18789418-TA-T P4_Dst 12×A***
20920178-CA-C 18758292-CA-C P4_Dst 14×A***
20917254-CAA-C 18755368-CAA-C P4_Dst 14×A***
20902303-G-GA 18740417-G-GA P4_Dst 14×A***
20859789-GAA-G 18697903-GAA-G P4_Dst 13×A***
20404505-CTC-TTT 18242619-CTC-TTT P5_Dst ***
20751042-G-GA 18589156-G-GA P4_Prx 13×A***
20717091-GAACG-AAAAA 18555205-GAACG-AAAAA P4_Prx ***
20717075-CACAACAAC-AAAAAAAAA 18555189-CACAACAAC-AAAAAAAAA P4_Prx ***
20650558-AT-A 18488672-AT-A P4_Prx 17×T***
20588355-G-GA 18426469-G-GA P5_Dst 9×A***
20478953-C-CA 18317067-C-CA P5_Dst 15×A***
20428140-A-AT 18266254-A-AT P5_Dst 17×T***
20420267-GA-G 18258381-GA-G P5_Dst ***
24343480-C-T 22197333-C-T P3_t1 ***
23671752-C-G 21509866-C-G ***
24316851-A-C 22170704-A-C P3_t1 ***
13143900-C-A 10633386-C-A ***
13143911-A-C 10633397-A-C ***
13143910-C-A 10633396-C-A ***
13143909-G-A 10633395-G-A ***
13143908-T-A 10633394-T-A ***
13143905-T-A 10633391-T-A ***
13143903-T-C 10633389-T-C ***
13143901-A-C 10633387-A-C ***
13143896-A-T 10633382-A-T ***
13143913-T-G 10633399-T-G ***
13143895-C-A 10633381-C-A ***
13143894-C-G 10633380-C-G ***
13143893-A-G 10633379-A-G ***
13143892-C-A 10633378-C-A ***
13143891-A-C 10633377-A-C ***
13143890-C-A 10633376-C-A ***
13143889-T-G 10633375-T-G ***
13143885-C-T 10633371-C-T ***
13143912-C-A 10633398-C-A ***
13208090-A-T 11052414-A-T ***
13140563-C-A 10630049-C-A ***
13329338-C-G 11173662-C-G ***
13460490-T-A 11304814-T-A ***
13437261-C-G 11281585-C-G ***
13430985-G-C 11275309-G-C ***
13430973-C-T 11275297-C-T ***
13430952-T-C 11275276-T-C ***
13421156-A-G 11265480-A-G ***
13385691-T-A 11230015-T-A ***
13331215-T-G 11175539-T-G ***
13308920-C-A 11153244-C-A ***
13209900-C-A 11054224-C-A ***
13287471-T-C 11131795-T-C ***
13275983-C-T 11120307-C-T ***
13275918-C-T 11120242-C-T ***
13253414-G-T 11097738-G-T ***
13253412-C-T 11097736-C-T ***
13253410-C-T 11097734-C-T ***
13253409-C-T 11097733-C-T ***
13214821-G-T 11059145-G-T ***
13143020-A-C 10632506-A-C ***
13140112-A-G 10629598-A-G ***
13467999-T-G 11312323-T-G ***
9961489-C-A 10123880-C-A ***
10041429-A-G 10203820-A-G ***
10033816-C-A 10196207-C-A ***
10025204-C-G 10187595-C-G ***
9995980-A-G 10158371-A-G ***
9995964-C-A 10158355-C-A ***
9991965-A-G 10154356-A-G ***
9963199-A-G 10125590-A-G ***
9956771-T-C 10119162-T-C ***
10043449-C-G 10205840-C-G ***
9945190-C-G 10107581-C-G ***
9943729-G-T 10106120-G-T ***
9942959-A-T 10105350-A-T ***
9941049-C-A 10103440-C-A ***
9934990-A-G 10097381-A-G ***
9915664-A-C 10078055-A-C ***
9911317-G-A 10073708-G-A ***
9909155-G-T 10071546-G-T ***
10043444-A-T 10205835-A-T ***
10043454-C-T 10205845-C-T ***
13140111-A-T 10629597-A-T ***
10104592-N-G 10266983-N-G ***
13140110-C-T 10629596-C-T ***
13140109-C-T 10629595-C-T ***
13140108-T-A 10629594-T-A ***
13140105-C-T 10629591-C-T ***
13140103-T-G 10629589-T-G ***
10104598-N-A 10266989-N-A ***
10104595-N-T 10266986-N-T ***
10104594-N-T 10266985-N-T ***
10104585-N-A 10266976-N-A ***
10043505-T-C 10205896-T-C ***
10104573-N-A 10266964-N-A ***
10104572-N-A 10266963-N-A ***
10104571-N-A 10266962-N-A ***
10104568-N-T 10266959-N-T ***
10104566-N-G 10266957-N-G ***
10104560-N-A 10266951-N-A ***
10104547-G-C 10266938-G-C ***
10068756-C-G 10231147-C-G ***
13461125-C-T 11305449-C-T ***
13469119-G-C 11313443-G-C ***
9868176-C-T 10030567-C-T ***
13722953-G-A 11567277-G-A ***
13723001-T-C 11567325-T-C ***
13723000-T-C 11567324-T-C ***
13722987-G-C 11567311-G-C ***
13722981-T-A 11567305-T-A ***
13722968-G-C 11567292-G-C ***
13722966-T-G 11567290-T-G ***
13722956-T-C 11567280-T-C ***
13722952-G-C 11567276-G-C ***
13723005-A-G 11567329-A-G ***
13722951-T-A 11567275-T-A ***
13722948-G-T 11567272-G-T ***
13714290-G-C 11558614-G-C ***
13714092-G-A 11558416-G-A ***
13706971-T-C 11551295-T-C ***
13706968-A-G 11551292-A-G ***
13706967-G-A 11551291-G-A ***
13705377-A-C 11549701-A-C ***
13723002-G-C 11567326-G-C ***
13723009-G-A 11567333-G-A ***
13703889-G-T 11548213-G-T ***
13723038-A-T 11567362-A-T ***
13733869-G-C 11578193-G-C ***
13731782-G-A 11576106-G-A ***
13728534-T-C 11572858-T-C ***
13723306-G-T 11567630-G-T ***
13723305-T-G 11567629-T-G ***
13723303-A-G 11567627-A-G ***
13723302-A-C 11567626-A-C 4×AATGG***
13723041-G-T 11567365-G-T ***
13723037-A-G 11567361-A-G ***
13723014-G-A 11567338-G-A ***
13723033-A-G 11567357-A-G ***
13723032-C-T 11567356-C-T ***
13723029-A-C 11567353-A-C ***
13723026-T-C 11567350-T-C ***
13723023-T-G 11567347-T-G ***
13723022-G-A 11567346-G-A ***
13723019-A-C 11567343-A-C ***
13723016-C-T 11567340-C-T ***
13703891-A-G 11548215-A-G ***
13703888-T-A 11548212-T-A ***
13469124-A-C 11313448-A-C ***
13511453-T-A 11355777-T-A ***
13578348-C-A 11422672-C-A ***
13551208-A-G 11395532-A-G ***
13511464-G-T 11355788-G-T ***
13511463-A-G 11355787-A-G ***
13511461-G-T 11355785-G-T ***
13511456-A-G 11355780-A-G ***
13511455-G-T 11355779-G-T ***
13511454-T-A 11355778-T-A ***
13511448-G-A 11355772-G-A ***
13594264-C-A 11438588-C-A ***
13511446-G-T 11355770-G-T ***
13511443-A-T 11355767-A-T ***
13511441-T-A 11355765-T-A ***
13497691-A-G 11342015-A-G ***
13496454-A-C 11340778-A-C ***
13496355-T-A 11340679-T-A ***
13484939-C-T 11329263-C-T ***
13480941-C-T 11325265-C-T ***
13593879-G-T 11438203-G-T ***
13597907-T-A 11442231-T-A ***
13703886-A-G 11548210-A-G ***
13699761-A-T 11544085-A-T ***
13703884-G-T 11548208-G-T ***
13703883-T-A 11548207-T-A ***
13703881-A-C 11548205-A-C ***
13703880-C-G 11548204-C-G ***
13703879-C-T 11548203-C-T ***
13703878-T-A 11548202-T-A ***
13703877-C-A 11548201-C-A ***
13701727-C-A 11546051-C-A ***
13699760-G-T 11544084-G-T ***
13623888-T-C 11468212-T-C ***
13681031-T-C 11525355-T-C ***
13681030-G-C 11525354-G-C ***
13681027-A-T 11525351-A-T ***
13681025-C-G 11525349-C-G ***
13681017-A-T 11525341-A-T ***
13681016-G-A 11525340-G-A ***
13681015-G-A 11525339-G-A ***
13681014-T-C 11525338-T-C ***
9909136-A-C 10071527-A-C ***
9745959-C-T 9908350-C-T ***
13803179-G-T 11682473-G-T ***
26100509-G-T 23954362-G-T P1_Y1 35×T***
13467063-G-T 11311387-G-T ***
19683841-CA-C 17571961-CA-C P5_Prx 14×A***
24654495-C-CT 22508348-C-CT P3_b2 15×T***
13703875-A-G 11548199-A-G ***
58908927-C-G 56681944-G-C ***
26201799-A-T 24055652-A-T P1_Y1 ***
26168157-T-A 24022010-T-A P1_Y1 ***
25321313-G-A 23175166-G-A P2_r1 ***
22368922-G-T 20207036-G-T DYZ19 ***
25302907-C-G 23156760-C-G P2_r1 ***
25207822-C-CAA 23061675-C-CAA P2_r1 51×A***
25169133-G-A 23022986-G-A g1 ***
24966793-C-A 22820646-C-A g1 ***
24966791-C-A 22820644-C-A g1 ***
24966789-G-C 22820642-G-C g1 ***
24218754-A-C 22072607-A-C P3_b1 ***
24097288-A-G 21951141-A-G P3_b1 ***
22368886-TG-T 20207000-TG-T DYZ19 ***
21026423-G-GT 18864537-G-GT P4_Dst 8×T***
22447292-A-G 20285406-A-G DYZ19 ***
13511457-C-A 11355781-C-A ***
2699591-C-A 2831550-C-A ***
2693432-C-A 2825391-C-A ***
22502886-G-T 20341000-G-T DYZ19 ***
3271445-C-T 3403404-C-T 10×T***
22360065-C-G 20198179-C-G DYZ19 ***
14557934-T-C 12446135-T-C Y5030 ***
10041399-C-T 10203790-C-T ***
14989248-G-A 12877333-G-A ***
2718881-C-T 2850840-C-T 21×T***
9956763-T-A 10119154-T-A ***
16205793-A-T 14093913-A-T ***
3148420-C-T 3280379-C-T 18×T***
9075186-A-T 9237577-A-T ***
13484985-G-A 11329309-G-A ***
9075183-C-T 9237574-C-T ***
16855400-T-G 14743520-T-G ***
22520816-G-A 20358930-G-A ***
22505835-C-T 20343949-C-T DYZ19 ******
22439368-C-A 20277482-C-A DYZ19 ***
2740700-C-A 2872659-C-A ***
6167451-AT-A 6299410-AT-A IR3_Dst 10×T***
13838788-A-T 11718082-A-T ***
13821147-T-G 11700441-T-G ***
13811173-GC-G 11690467-GC-G ***
13714019-A-C 11558343-A-C ***
13692132-G-A 11536456-G-A ***
6293558-GAGACTCAATTAAAAAA-G 6425517-GAGACTCAATTAAAAAA-G IR3_Dst ***
6211772-A-G 6343731-A-G IR3_Dst ***
58975376-G-C 56829229-G-C ***
13838840-G-C 11718134-G-C ***
13723327-G-C 11567651-G-C ***
23713748-ATG-A 21551862-ATG-A 19×TG***
13457972-A-G 11302296-A-G ***
20084480-C-T 17972600-C-T P5_Dst ***
20084470-C-T 17972590-C-T P5_Dst ***
58980044-T-C 56833897-T-C ***
13446873-C-T 11291197-C-T ***
16101327-ATC-A 13989447-ATC-A P8_Prx 13×TC***
13838793-A-G 11718087-A-G ***
13859914-G-GTAATC 11739208-G-GTAATC ***
22430023-A-G 20268137-A-G DYZ19 ***
20728589-G-C 18566703-G-C P4_Prx ***
22333652-A-C 20171766-A-C DYZ19 ******
22307079-A-C 20145193-A-C DYZ19 ***
22303353-A-T 20141467-A-T DYZ19 ***
22303349-AC-A 20141463-AC-A DYZ19 ***
22292877-G-T 20130991-G-T DYZ19 ******
22276000-A-T 20114114-A-T DYZ19 ***
22266838-T-G 20104952-T-G DYZ19 ***
22233320-G-A 20071434-G-A DYZ19 ***
20715163-T-C 18553277-T-C P4_Prx ******
13862103-A-G 11741397-A-G ***
19732287-C-T 17620407-C-T P5_Prx ***
19006158-T-A 16894278-T-A ***
18380991-T-C 16269111-T-C P6_Prx ***
16679092-G-T 14567212-G-T ***
13862160-C-A 11741454-C-A ***
13862146-G-T 11741440-G-T ***
13862145-A-T 11741439-A-T ***
13862130-G-T 11741424-G-T ***
2738690-C-A 2870649-C-A ***
3185873-G-T 3317832-G-T ***
9744655-T-G 9907046-T-G ***
8619566-C-T 8751525-C-T br1 ***
9048212-A-G 9210603-A-G ***
8974691-C-A 9137082-C-A ***
8725100-T-C 8857059-T-C ***
8713135-C-A 8845094-C-A ***
8676946-C-A 8808905-C-A ***
8619574-G-C 8751533-G-C br1 ***
8619573-A-G 8751532-A-G br1 ***
8619565-T-G 8751524-T-G br1 ***
9165557-G-T 9327948-G-T ***
8619564-T-A 8751523-T-A br1 ***
8514293-C-A 8646252-C-A ***
8385206-G-T 8517165-G-T ***
8112464-C-T 8244423-C-T ***
7705626-G-T 7837585-G-T ***
7501225-T-G 7633184-T-G IR1_L ***
7445651-C-A 7577610-C-A ***
7445312-A-G 7577271-A-G ***
9088167-T-C 9250558-T-C ***
9172375-A-C 9334766-A-C ***
7336335-C-A 7468294-C-A ***
9304875-A-G 9467266-A-G ***
9716820-G-A 9879211-G-A IR3_Prx ***
9708107-A-T 9870498-A-T IR3_Prx ***
9691307-T-C 9853698-T-C IR3_Prx ***
9602637-C-A 9765028-C-A IR3_Prx ***
9386182-C-A 9548573-C-A ***
9325265-T-C 9487656-T-C ***
9325254-A-C 9487645-A-C ***
9325247-T-C 9487638-T-C ***
9304614-G-T 9467005-G-T ***
9215993-A-G 9378384-A-G ***
9304613-C-A 9467004-C-A ***
9304612-G-T 9467003-G-T ***
9304610-A-C 9467001-A-C ***
9304608-G-C 9466999-G-C ***
9304605-G-A 9466996-G-A ***
9304174-A-T 9466565-A-T ***
9229089-A-C 9391480-A-C ***
9222814-C-T 9385205-C-T ***
7409428-C-A 7541387-C-A ***
7277672-C-T 7409631-C-T ***
3275879-A-G 3407838-A-G ***
5458807-A-G 5590766-A-G ***
6133844-C-T 6265803-C-T ***
6103075-C-G 6235034-C-G ***
6093821-A-C 6225780-A-C ***
6085612-C-A 6217571-C-A ***
5851893-C-A 5983852-C-A ***
5851537-G-A 5983496-G-A ***
5690225-C-A 5822184-C-A ***
5650526-C-A 5782485-C-A ***
5267041-A-T 5399000-A-T ***
6133848-A-G 6265807-A-G ***
5240867-C-A 5372826-C-A ***
5191205-T-C 5323164-T-C ***
4382439-G-A 4514398-G-A ***
3790900-A-C 3922859-A-C ***
3712262-T-C 3844221-T-C ***
3592578-C-A 3724537-C-A ***
3409414-A-C 3541373-A-C ***
3366669-C-A 3498628-C-A ***
6133847-G-A 6265806-G-A ***
6145919-G-T 6277878-G-T IR3_Dst ***
7248753-C-A 7380712-C-A ***
7000286-G-T 7132245-G-T ***
7182973-G-T 7314932-G-T ***
7170125-C-A 7302084-C-A ***
7162854-C-A 7294813-C-A ***
7160865-G-A 7292824-G-A ***
7105046-C-A 7237005-C-A ***
7099139-C-A 7231098-C-A ***
7034474-C-A 7166433-C-A 17×A***
7034473-T-A 7166432-T-A ***
6996824-C-A 7128783-C-A ***
6145984-A-C 6277943-A-C IR3_Dst ***
6971774-C-A 7103733-C-A ***
6807415-C-A 6939374-C-A ***
6774128-C-A 6906087-C-A ***
6772056-C-A 6904015-C-A ***
6644810-C-A 6776769-C-A ***
6459966-T-C 6591925-T-C ***
6360591-G-A 6492550-G-A ***
6356858-G-T 6488817-G-T ***
13745839-G-A 11590163-G-A ***
13809631-A-G 11688925-A-G ***
24157146-A-G 22010999-A-G P3_b1 ***
20886818-T-A 18724932-T-A P4_Dst ***
20898381-T-G 18736495-T-G P4_Dst ***
20886855-A-C 18724969-A-C P4_Dst ***
20886850-G-A 18724964-G-A P4_Dst ***
20886839-C-G 18724953-C-G P4_Dst ***
20886836-A-G 18724950-A-G P4_Dst ***
20886825-C-G 18724939-C-G P4_Dst ***
20886819-C-A 18724933-C-A P4_Dst ***
20886814-T-A 18724928-T-A P4_Dst ***
20946773-T-C 18784887-T-C P4_Dst ***
20886813-G-A 18724927-G-A P4_Dst ***
20886812-T-A 18724926-T-A P4_Dst ***
20872409-G-T 18710523-G-T P4_Dst ***
20872405-G-A 18710519-G-A P4_Dst ***
20872202-C-T 18710316-C-T P4_Dst ***
20863681-A-T 18701795-A-T P4_Dst ***
20861250-G-T 18699364-G-T P4_Dst ***
20856347-G-A 18694461-G-A P4_Dst ***
20913656-T-A 18751770-T-A P4_Dst ***
20948130-A-C 18786244-A-C P4_Dst ***
20849609-T-C 18687723-T-C P4_Dst ***
21379430-G-C 19217544-G-C ***
22244779-A-T 20082893-A-T DYZ19 ***
22236450-G-T 20074564-G-T DYZ19 ***
22234039-G-C 20072153-G-C DYZ19 ***
22228037-G-T 20066151-G-T DYZ19 ***
22227975-A-G 20066089-A-G DYZ19 ***
22168024-C-A 20006138-C-A ***
21775154-C-A 19613268-C-A ***
21746379-C-A 19584493-C-A ***
21269439-A-G 19107553-A-G FGC64578 ***
20989893-C-A 18828007-C-A P4_Dst ***
21269170-C-A 19107284-C-A ***
21268938-C-A 19107052-C-A ***
21263601-C-A 19101715-C-A ***
21241713-T-C 19079827-T-C ***
21153836-G-T 18991950-G-T ***
21022808-C-A 18860922-C-A P4_Dst ***
21021613-G-T 18859727-G-T P4_Dst ***
21021604-C-T 18859718-C-T P4_Dst ***
20854398-C-A 18692512-C-A P4_Dst ***
20843517-G-T 18681631-G-T P4_Dst ***
22244781-G-T 20082895-G-T DYZ19 ***
20215591-T-C 18053705-T-C P5_Dst ***
20318873-C-T 18156987-C-T P5_Dst ***
20314506-G-C 18152620-G-C P5_Dst ***
20314504-G-C 18152618-G-C P5_Dst ***
20253323-C-T 18091437-C-T P5_Dst ***
20241262-A-T 18079376-A-T P5_Dst ***
20230681-A-G 18068795-A-G P5_Dst ***
20218031-A-C 18056145-A-C P5_Dst ***
20214452-G-A 18052566-G-A P5_Dst ***
20340133-T-G 18178247-T-G P5_Dst ***
20210575-G-C 18048689-G-C P5_Dst ***
20210574-T-A 18048688-T-A P5_Dst ***
20210573-A-T 18048687-A-T P5_Dst ***
20210571-C-T 18048685-C-T P5_Dst ***
20141018-C-A 18029138-C-A P5_Dst ***
20111784-G-C 17999904-G-C P5_Dst ***
20096588-G-T 17984708-G-T P5_Dst ***
20091730-A-G 17979850-A-G P5_Dst ***
20318875-A-T 18156989-A-T P5_Dst ***
20368757-G-T 18206871-G-T P5_Dst ***
20774158-C-A 18612272-C-A P4_Prx ***
20494988-T-C 18333102-T-C P5_Dst ***
20747972-G-T 18586086-G-T P4_Prx ***
20703689-A-C 18541803-A-C P4_Prx ***
20631449-A-C 18469563-A-C P4_Prx ***
20593053-T-C 18431167-T-C P5_Dst ***
20588327-G-T 18426441-G-T P5_Dst ***
20510476-C-A 18348590-C-A P5_Dst ***
20507918-G-T 18346032-G-T P5_Dst ***
20497560-A-T 18335674-A-T P5_Dst ***
20479705-A-G 18317819-A-G P5_Dst ***
20386692-C-A 18224806-C-A P5_Dst ***
20458753-G-T 18296867-G-T P5_Dst ***
20442337-G-T 18280451-G-T P5_Dst ***
20432781-C-A 18270895-C-A P5_Dst ***
20428558-T-A 18266672-T-A P5_Dst ***
20420271-G-A 18258385-G-A P5_Dst ***
20420240-A-G 18258354-A-G P5_Dst ***
20420239-G-C 18258353-G-C P5_Dst ***
20420237-C-G 18258351-C-G P5_Dst ***
22244780-A-G 20082894-A-G DYZ19 ***
22244782-A-C 20082896-A-C DYZ19 ***
20087400-G-T 17975520-G-T P5_Dst ***
23656178-G-T 21494292-G-T ***
23736652-C-A 21574766-C-A ***
22363261-TG-T 20201375-TG-T DYZ19 ***
23671751-G-A 21509865-G-A ***
23671749-T-A 21509863-T-A ***
23666270-A-C 21504384-A-C ***
23658852-A-G 21496966-A-G ***
23658846-A-T 21496960-A-T ***
23602393-C-A 21440507-C-A ***
23743686-A-T 21581800-A-T ***
23574316-G-T 21412430-G-T ***
23465740-G-T 21303854-G-T ***
23401656-G-T 21239770-G-T ***
23401647-G-A 21239761-G-A ***
23368672-C-A 21206786-C-A ***
23286109-A-T 21124223-A-T ***
23255184-C-A 21093298-C-A ***
23098137-C-A 20936251-C-A ***
23737262-T-G 21575376-T-G ***
23750420-A-C 21588534-A-C ***
22836544-C-A 20674658-C-A ***
24045394-T-G 21899247-T-G ***
24112750-G-C 21966603-G-C P3_b1 ***
24096549-G-T 21950402-G-T P3_b1 ***
24050818-G-C 21904671-G-C P3_b1 ***
24047018-C-T 21900871-C-T ***
24046956-G-A 21900809-G-A ***
24046818-G-T 21900671-G-T ***
24046637-C-A 21900490-C-A ***
24045399-T-A 21899252-T-A ***
24044685-A-T 21898538-A-T ***
23836853-G-T 21674967-G-T ***
24035028-A-G 21888881-A-G ***
24032843-A-G 21886696-A-G ***
24032693-C-A 21886546-C-A ***
24028713-G-T 21882566-G-T ***
24026090-G-T 21879943-G-T ***
24009487-C-A 21863340-C-A ***
23872366-T-C 21710480-T-C ***
23850285-G-T 21688399-G-T ***
22892556-C-A 20730670-C-A ***
22690885-C-T 20528999-C-T ***
22244783-A-C 20082897-A-C DYZ19 ***
22250226-T-G 20088340-T-G DYZ19 ***
22341619-T-A 20179733-T-A DYZ19 ***
22341618-G-T 20179732-G-T DYZ19 ***
22336106-C-T 20174220-C-T DYZ19 ***
22300096-T-C 20138210-T-C DYZ19 ***
22283318-G-A 20121432-G-A DYZ19 ***
22275697-T-C 20113811-T-C DYZ19 ***
22269588-T-G 20107702-T-G DYZ19 ***
22256210-C-A 20094324-C-A DYZ19 ***
22250224-G-T 20088338-G-T DYZ19 ***
22352944-C-G 20191058-C-G DYZ19 ***
22245682-C-T 20083796-C-T DYZ19 ***
22245681-A-G 20083795-A-G DYZ19 ***
22244793-A-T 20082907-A-T DYZ19 ***
22244792-C-T 20082906-C-T DYZ19 ***
22244791-A-C 20082905-A-C DYZ19 ***
22244789-G-T 20082903-G-T DYZ19 ***
22244787-C-G 20082901-C-G DYZ19 ***
22244786-T-A 20082900-T-A DYZ19 ***
22345697-T-A 20183811-T-A DYZ19 ***
22352945-C-T 20191059-C-T DYZ19 ***
22682611-C-A 20520725-C-A ***
22365324-G-T 20203438-G-T DYZ19 ***
22649484-A-G 20487598-A-G ***
22491006-A-G 20329120-A-G DYZ19 ***
22453361-T-A 20291475-T-A DYZ19 ***
22453358-G-C 20291472-G-C DYZ19 ***
22452046-T-A 20290160-T-A DYZ19 ***
22452044-A-T 20290158-A-T DYZ19 ***
22427191-A-G 20265305-A-G DYZ19 ***
22427189-T-G 20265303-T-G DYZ19 ***
22362125-T-A 20200239-T-A DYZ19 ***
22358195-A-T 20196309-A-T DYZ19 ***
22362124-A-C 20200238-A-C DYZ19 ***
22362119-T-C 20200233-T-C DYZ19 ***
22362112-T-C 20200226-T-C DYZ19 ***
22361100-G-T 20199214-G-T DYZ19 ***
22360070-T-A 20198184-T-A DYZ19 ***
22360068-C-T 20198182-C-T DYZ19 ***
22360067-T-A 20198181-T-A DYZ19 ***
22360064-A-T 20198178-A-T DYZ19 ***
20087807-T-G 17975927-T-G P5_Dst ***
20084797-C-A 17972917-C-A P5_Dst ***
13809633-G-C 11688927-G-C ***
16148183-C-T 14036303-C-T P8_Dst 27×T***
16157813-G-A 14045933-G-A P8_Dst ***
16157811-T-A 14045931-T-A P8_Dst ***
16157810-T-A 14045930-T-A P8_Dst ***
16157808-T-A 14045928-T-A P8_Dst ***
16157807-T-A 14045927-T-A P8_Dst ***
16157806-G-A 14045926-G-A P8_Dst ***
16157805-C-G 14045925-C-G P8_Dst ***
16118320-T-A 14006440-T-A P8_Prx ***
16157816-C-G 14045936-C-G P8_Dst ***
16095443-A-G 13983563-A-G ***
16072983-G-A 13961103-G-A ***
16041772-C-A 13929892-C-A ***
16023083-C-A 13911203-C-A ***
15995099-C-A 13883219-C-A ***
15975023-C-A 13863143-C-A ***
15944350-C-A 13832470-C-A ***
15941458-T-C 13829578-T-C ***
16157814-A-G 14045934-A-G P8_Dst ***
16180412-A-G 14068532-A-G ***
15912054-T-C 13800174-T-C ***
16868573-C-A 14756693-C-A ***
17313300-G-C 15201420-G-C ***
17151294-T-C 15039414-T-C ***
17092690-C-A 14980810-C-A ***
17004446-C-A 14892566-C-A ***
16978332-C-T 14866452-C-T ***
16930587-G-T 14818707-G-T ***
16929527-A-G 14817647-A-G ***
16881521-C-A 14769641-C-A ***
16828775-C-A 14716895-C-A ***
16232163-A-G 14120283-A-G ***
16720510-G-T 14608630-G-T ***
16710338-C-A 14598458-C-A ***
16612351-C-A 14500471-C-A ***
16571852-C-A 14459972-C-A ***
16506924-A-T 14395044-A-T ***
16503810-C-A 14391930-C-A ***
16412837-C-A 14300957-C-A ***
16243066-T-C 14131186-T-C ***
15922309-G-T 13810429-G-T ***
15912052-T-C 13800172-T-C ***
17355523-T-A 15243643-T-A FGC56736 ***
14241732-C-A 12121026-C-A ***
14420305-C-A 12299580-C-A ***
14402534-C-A 12281831-C-A ***
14401942-C-A 12281239-C-A ***
14397841-G-A 12277137-G-A ***
14380027-G-C 12259323-G-C ***
14373449-G-A 12252745-G-A ***
14264431-C-A 12143725-C-A ***
14025468-C-T 11904762-C-T ***
14464316-C-A 12343589-C-A ***
13858777-A-T 11738071-A-T ***
13857633-A-G 11736927-A-G ***
13847133-T-C 11726427-T-C ***
13846740-G-A 11726034-G-A ***
13809687-T-G 11688981-T-G ***
13809683-G-A 11688977-G-A ***
13809636-A-C 11688930-A-C ***
13809635-A-G 11688929-A-G ***
14462786-C-A 12342059-C-A ***
14537077-C-A 12425278-C-A ***
15912051-A-T 13800171-A-T ***
15305613-T-C 13193712-T-C ***
15801633-C-A 13689753-C-A ***
15733746-G-A 13621866-G-A ***
15699936-C-A 13588056-C-A ***
15546232-C-A 13434352-C-A ***
15412926-C-T 13301046-C-T ***
15406720-C-A 13294840-C-A ***
15379806-C-A 13267926-C-A ***
15365221-C-T 13253341-C-T ***
15302485-G-T 13190584-G-T ***
14598945-G-T 12487145-G-T ***
15068898-C-A 12956989-C-A ***
15036358-G-A 12924446-G-A ***
14779753-C-A 12667823-C-A ***
14743491-C-A 12631560-C-A ***
14721848-C-A 12609916-C-A ***
14652296-G-T 12540361-G-T ***
14649778-G-A 12537843-G-A ***
14620062-C-A 12508260-C-A ***
17333959-C-A 15222079-C-A ***
17372022-C-A 15260142-C-A ***
20084465-C-T 17972585-C-T P5_Dst ***
18491585-T-G 16379705-T-G P6_Dst ***
18856928-G-A 16745048-G-A ***
18853218-C-A 16741338-C-A ***
18753379-G-T 16641499-G-T ***
18697996-G-A 16586116-G-A ***
18630756-C-A 16518876-C-A ***
18604937-C-A 16493057-C-A ***
18511241-T-A 16399361-T-A P6_Dst ***
18467557-A-T 16355677-A-T P6_Dst ***
19020310-C-A 16908430-C-A ***
18467553-T-C 16355673-T-C P6_Dst ***
18467550-G-T 16355670-G-T P6_Dst ***
18467549-A-C 16355669-A-C P6_Dst ***
18465450-T-C 16353570-T-C P6_Dst ***
18443296-G-T 16331416-G-T P6_Dst ***
18439561-C-A 16327681-C-A P6_Dst ***
18429240-G-C 16317360-G-C P6_Dst ***
18401619-C-A 16289739-C-A P6_Gap ***
18955769-T-A 16843889-T-A ***
19031537-C-A 16919657-C-A ***
18370708-C-A 16258828-C-A P6_Prx ***
19749293-C-A 17637413-C-A P5_Prx ***
20013309-A-G 17901429-A-G P5_Prx ***
19924531-T-C 17812651-T-C P5_Prx ***
19924529-T-G 17812649-T-G P5_Prx ***
19924524-C-T 17812644-C-T P5_Prx ***
19924522-G-T 17812642-G-T P5_Prx ***
19924521-T-G 17812641-T-G P5_Prx ***
19924520-G-T 17812640-G-T P5_Prx ***
19775296-G-A 17663416-G-A P5_Prx ***
19706469-G-A 17594589-G-A P5_Prx ***
19035907-A-T 16924027-A-T ***
19684076-A-C 17572196-A-C P5_Prx ***
19684001-G-T 17572121-G-T P5_Prx ***
19605756-G-T 17493876-G-T P5_Prx ***
19391329-C-A 17279449-C-A ***
19346658-C-A 17234778-C-A ***
19271463-G-C 17159583-G-C ***
19122233-C-A 17010353-C-A ***
19112666-C-A 17000786-C-A ***
18388354-C-A 16276474-C-A P6_Gap ***
18329827-C-A 16217947-C-A P6_Prx ***
17440872-C-A 15328992-C-A F21778 ***
17923112-G-A 15811232-G-A ***
18305509-G-C 16193629-G-C P6_Prx ***
18305507-A-G 16193627-A-G P6_Prx ***
18253160-A-C 16141280-A-C ***
18194202-C-A 16082322-C-A ***
18108700-C-A 15996820-C-A ***
18050097-A-G 15938217-A-G ***
18050093-T-A 15938213-T-A ***
17950773-G-A 15838893-G-A ***
17915952-C-T 15804072-C-T ***
18305512-G-C 16193632-G-C P6_Prx ***
17886409-C-A 15774529-C-A ***
17692106-C-A 15580226-C-A ***
17691936-C-A 15580056-C-A ***
17633191-C-A 15521311-C-A ***
17597953-C-A 15486073-C-A ***
17515291-C-A 15403411-C-A ***
17505738-C-A 15393858-C-A ***
17461861-C-A 15349981-C-A ***
18305511-A-T 16193631-A-T P6_Prx ***
18305513-T-G 16193633-T-G P6_Prx ***
18316558-G-A 16204678-G-A P6_Prx ***
18305525-G-T 16193645-G-T P6_Prx ***
18305538-G-C 16193658-G-C P6_Prx ***
18305536-T-G 16193656-T-G P6_Prx ***
18305534-T-G 16193654-T-G P6_Prx ***
18305533-G-A 16193653-G-A P6_Prx ***
18305532-T-A 16193652-T-A P6_Prx ***
18305531-A-T 16193651-A-T P6_Prx ***
18305530-C-A 16193650-C-A P6_Prx ***
18305528-T-G 16193648-T-G P6_Prx ***
18305523-A-G 16193643-A-G P6_Prx ***
18305514-A-G 16193634-A-G P6_Prx ***
18305522-T-A 16193642-T-A P6_Prx ***
18305521-T-C 16193641-T-C P6_Prx ***
18305520-G-T 16193640-G-T P6_Prx ***
18305519-A-G 16193639-A-G P6_Prx ***
18305518-A-C 16193638-A-C P6_Prx ***
18305517-A-G 16193637-A-G P6_Prx ***
18305516-G-A 16193636-G-A P6_Prx ***
18305515-G-C 16193635-G-C P6_Prx ***
25964919-GTA-TT 23818772-GTA-TT P1_Y1 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page