Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > Z251/S470 > S11556 > S9294 > BY3231

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
187172
BigY2
187172
20717100-G-GA 18555214-G-GA P4_Prx 10×AA*
13712816-A-ATGTAT 11557140-A-ATGTAT A*
13687201-T-C 11531525-T-C A*
13689794-T-C 11534118-T-C A*
13694947-T-G 11539271-T-G A*
13689850-C-G 11534174-C-G A*
13695107-G-T 11539431-G-T A*
18312920-G-A 16201040-G-A P6_Prx ***A*
6250304-T-G 6382263-T-G IR3_Dst A*
25937661-A-AT 23791514-A-AT P1_Y1 9×TA*
23176797-G-A 21014911-G-A YA*
16101996-C-T 13990116-C-T P8_Prx 19×TA*
13712799-G-T 11557123-G-T A*
22304381-T-C 20142495-T-C DYZ19 A*
23176799-A-G 21014913-A-G Y11×GAAGA*
17107221-C-T 14995341-C-T FGC21183 YY++
14498309-A-G 12386514-A-G FGC21192 YY++
15278413-A-G 13166502-A-G FGC21194 YY++
15501050-GC-G 13389170-GC-G ++
15594216-TATTA-T 13482336-TATTA-T ++
25871767-G-A 23725620-G-A P1_Y1 ***+
15901848-A-G 13789968-A-G FGC21195 YY++
16077845-A-G 13965965-A-G FGC21196 Y++
16876677-C-CCT 14764797-C-CCT ++
22890843-C-T 20728957-C-T FGC21208 YY++
17149441-A-G 15037561-A-G FGC21197 YY++
22678289-T-G 20516403-T-G FGC21207 YY++
18929071-T-TA 16817191-T-TA ++
18951682-C-T 16839802-C-T FGC21199 YY++
23262319-T-A 21100433-T-A FGC21209 YY++
19315225-T-C 17203345-T-C FGC21200 YY++
19986016-C-A 17874136-C-A P5_Prx ***+
21567470-A-AGT 19405584-A-AGT ++
21702820-C-G 19540934-C-G FGC21201 YY++
22261119-A-T 20099233-A-T FGC21204 DYZ19 +
22270664-C-A 20108778-C-A FGC21205 DYZ19 ++
22445257-G-C 20283371-G-C FGC21206 DYZ19 ++
22485717-C-T 20323831-C-T A301A301 DYZ19 +**
22485722-T-C 20323836-T-C A302 DYZ19 +**
17981134-G-T 15869254-G-T FGC21198 Y++
14890647-T-C 12778713-T-C FGC21193 YY++
7763766-T-C 7895725-T-C FGC21189 YY++
2720792-A-G 2852751-A-G FGC21184 YY++
8750210-A-C 8882169-A-C FGC21190 YY++
9398985-A-G 9561376-A-G YY+
7171805-G-A 7303764-G-A FGC21187 YY++
6932602-G-C 7064561-G-C FGC21186 YY++
6851572-A-G 6983531-A-G FGC21185 YY++
7607234-C-T 7739193-C-T FGC21188 YY++
22279222-G-A 20117336-G-A DYZ19 ****
6347750-G-A 6479709-G-A *
6347750-G-GA 6479709-G-GA *
7387444-A-T 7519403-A-T YY*
6347742-GAA-G 6479701-GAA-G *
6226040-CT-C 6357999-CT-C IR3_Dst *
17664771-A-C 15552891-A-C V68 YY*
25885854-AG-A 23739707-AG-A P1_Y1 *
26092050-A-G 23945903-A-G P1_Y1 ****
15041131-A-G 12929221-A-G **
15202329-GA-G 13090415-GA-G **
15176939-C-A 13065025-C-A **
16811109-C-A 14699229-C-A **
15140935-C-T 13029022-C-T **
15049357-T-C 12937448-T-C **
15049353-T-C 12937444-T-C **
14735051-G-A 12623119-G-A **
14988719-C-T 12876785-C-T **
14988710-C-A 12876776-C-A **
14986540-G-C 12874608-G-C **
16789620-T-A 14677740-T-A **
14986538-T-C 12874606-T-C **
14986536-T-G 12874604-T-G **
14986522-G-A 12874590-G-A **
14959769-G-A 12847844-G-A **
14959631-T-C 12847706-T-C **
15205946-T-C 13094032-T-C Y93266 **
16783572-C-CACAAA 14671692-C-CACAAA **
15205947-G-A 13094033-G-A **
15211152-G-T 13099238-G-T **
14630369-G-T 12518438-G-T **
14645116-A-T 12533185-A-T **
14645127-A-G 12533196-A-G **
14651438-C-A 12539503-C-A **
15242547-G-A 13130633-G-A Y93344 **
14653186-C-A 12541251-C-A **
16719430-T-C 14607550-T-C **
15242545-C-T 13130631-C-T **
15209302-T-G 13097388-T-G **
16784404-CAAAAAA-C 14672524-CAAAAAA-C 18×A**
15205960-A-C 13094046-A-C **
15205959-C-T 13094045-C-T **
16757250-C-T 14645370-C-T **
15205958-G-A 13094044-G-A **
14682961-A-C 12571027-A-C **
16765674-C-T 14653794-C-T **
15205954-G-A 13094040-G-A **
14959610-A-T 12847685-A-T **
16783587-A-G 14671707-A-G **
14959619-C-T 12847694-C-T **
14959593-C-T 12847668-C-T **
16813979-T-C 14702099-T-C **
14788843-C-T 12676914-C-T **
14845508-A-G 12733574-A-G **
14845285-A-T 12733351-A-T **
14836308-T-A 12724375-T-A **
14836290-A-G 12724357-A-G **
14836289-A-T 12724356-A-T **
14794937-C-A 12683008-C-A **
16813984-T-C 14702104-T-C **
14789444-C-T 12677515-C-T **
16871365-A-G 14759485-A-G **
14845519-T-A 12733585-T-A **
14786654-G-T 12674724-G-T **
14786647-C-T 12674717-C-T **
14768425-G-TTA 12656494-G-TTA **
16901046-C-A 14789166-C-A **
14768418-G-A 12656487-G-A **
14766651-T-A 12654720-T-A **
14765827-A-G 12653896-A-G **
14765826-C-T 12653895-C-T **
14765336-G-T 12653405-G-T **
14845513-G-A 12733579-G-A **
14848956-C-A 12737022-C-A **
14959601-G-A 12847676-G-A **
14943577-G-A 12831651-G-A **
14959566-C-T 12847641-C-T **
14953589-C-A 12841663-C-A **
14947896-T-A 12835970-T-A **
15242548-T-A 13130634-T-A **
14943604-A-G 12831678-A-G **
14943600-G-A 12831674-G-A **
14943599-T-C 12831673-T-C **
14943598-T-C 12831672-T-C **
14943584-A-T 12831658-A-T **
14943014-T-C 12831088-T-C **
14858944-G-C 12747010-G-C **
14933841-G-A 12821906-G-A **
14932103-T-C 12820168-T-C **
14929117-T-C 12817182-T-C **
14911702-A-G 12799769-A-G **
14888172-T-C 12776238-T-C **
14886304-GC-G 12774370-GC-G **
14884640-T-A 12772706-T-A **
14879821-T-C 12767891-T-C **
14879820-T-C 12767890-T-C **
14943605-A-G 12831679-A-G **
16484235-C-A 14372355-C-A **
15242561-C-T 13130647-C-T **
15756295-A-G 13644415-A-G **
15841856-C-T 13729976-C-T **
16522929-C-A 14411049-C-A **
15840458-C-A 13728578-C-A **
15831528-C-T 13719648-C-T **
15831527-T-C 13719647-T-C **
15831522-T-A 13719642-T-A **
15793503-G-C 13681623-G-C **
15756310-G-T 13644430-G-T **
15756300-A-T 13644420-A-T **
15746942-T-C 13635062-T-C **
15903986-A-T 13792106-A-T **
15740807-C-A 13628927-C-A **
15719621-C-A 13607741-C-A **
15707059-C-A 13595179-C-A **
15696866-T-A 13584986-T-A **
15679669-G-A 13567789-G-A **
15664008-G-A 13552128-G-A Y130346 **
15663997-T-A 13552117-T-A **
15663995-A-C 13552115-A-C **
15652955-G-T 13541075-G-T **
15612331-A-G 13500451-A-G **
15841857-A-C 13729977-A-C **
15944384-C-A 13832504-C-A **
15576829-G-A 13464949-G-A **
16179640-G-A 14067760-G-A **
16424762-G-T 14312882-G-T **
16424232-T-C 14312352-T-C **
16423758-T-G 14311878-T-G **
16363949-T-C 14252069-T-C **
16293720-G-T 14181840-G-T **
16275749-T-G 14163869-T-G **
16247752-C-A 14135872-C-A **
16186624-A-T 14074744-A-T **
16179716-A-G 14067836-A-G **
16119972-T-TTTCG 14008092-T-TTTCG P8_Prx **
15968173-C-A 13856293-C-A **
16095261-T-C 13983381-T-C **
16077509-G-A 13965629-G-A **
16045302-A-G 13933422-A-G **
16039172-A-G 13927292-A-G **
16039163-A-G 13927283-A-G **
16038007-C-A 13926127-C-A **
16016862-T-C 13904982-T-C **
15986705-G-A 13874825-G-A **
15986697-C-G 13874817-C-G **
15986690-C-G 13874810-C-G **
15576863-C-T 13464983-C-T **
15564031-T-C 13452151-T-C **
16474682-A-C 14362802-A-C **
15260146-T-C 13148230-T-C **
16555296-G-T 14443416-G-T **
16559232-C-A 14447352-C-A **
16571976-T-G 14460096-T-G **
14630356-T-C 12518425-T-C **
15315397-C-G 13203502-C-G **
16583364-G-A 14471484-G-A **
16596079-G-A 14484199-G-A **
16602847-C-A 14490967-C-A **
16605480-T-C 14493600-T-C **
15260136-A-T 13148220-A-T **
15322523-C-T 13210641-C-T **
16648354-C-T 14536474-C-T **
16676494-C-T 14564614-C-T **
15253737-C-T 13141823-C-T **
16678745-G-T 14566865-G-T **
16689855-A-G 14577975-A-G **
15250675-C-A 13138761-C-A **
16702221-C-A 14590341-C-A **
16714703-C-A 14602823-C-A **
15250657-TA-T 13138743-TA-T **
16719406-C-A 14607526-C-A **
16555195-C-A 14443315-C-A **
15322545-G-T 13210663-G-T **
15564019-T-C 13452139-T-C **
15421953-A-G 13310073-A-G **
15556659-C-A 13444779-C-A **
15532306-C-A 13420426-C-A **
15527871-T-A 13415991-T-A **
15527870-C-T 13415990-C-T **
15527865-G-T 13415985-G-T **
15527864-T-G 13415984-T-G **
15472017-G-T 13360137-G-T **
15457879-C-A 13345999-C-A **
15450340-A-G 13338460-A-G **
15427334-C-CA 13315454-C-CA **
15406682-T-A 13294802-T-A **
15324152-C-A 13212270-C-A **
15387980-T-TA 13276100-T-TA **
15387973-A-C 13276093-A-C **
15387971-G-T 13276091-G-T **
15386311-T-C 13274431-T-C **
15374558-C-A 13262678-C-A **
15374550-A-T 13262670-A-T **
15374453-T-C 13262573-T-C **
15361946-A-G 13250066-A-G **
15361943-C-T 13250063-C-T **
15357945-T-C 13246064-T-C **
14630360-C-G 12518429-C-G **
14427269-C-T 12306544-C-T **
14614149-C-A 12502347-C-A **
11004324-A-G **
11021835-C-A **
11021142-C-T **
11020817-C-T **
11020815-C-A **
11020814-C-A **
11016149-C-A **
11013487-C-A **
11004332-C-CTCCAA **
11004325-T-C **
11004314-T-G **
11033562-C-G **
10999325-A-G **
10999324-C-T **
10988343-C-A **
10988334-T-A **
10988332-C-T **
10958997-A-G **
10949378-C-A **
10949364-A-T **
10949355-T-A **
10949342-C-A **
11033551-C-G **
11033564-T-A **
10940993-C-T **
13322553-G-C 11166877-G-C **
13484896-A-T 11329220-A-T **
13476019-GT-G 11320343-GT-G **
13475449-A-C 11319773-A-C **
13473699-T-A 11318023-T-A **
13473690-T-G 11318014-T-G **
13473682-G-A 11318006-G-A **
13464727-C-A 11309051-C-A **
13410634-A-C 11254958-A-C **
13322562-C-A 11166886-C-A **
13322550-T-C 11166874-T-C **
11034926-C-T **
13322545-C-T 11166869-C-T **
13322539-C-T 11166863-C-T **
13322536-C-T 11166860-C-T **
13312399-C-A 11156723-C-A **
13303484-C-T 11147808-C-T **
13258048-C-T 11102372-C-T FGC21191 **
13227358-C-A 11071682-C-A **
13220410-A-C 11064734-A-C **
13209997-AT-A 11054321-AT-A **
13209501-G-T 11053825-G-T **
10949339-T-G **
10937680-C-A **
13484933-A-G 11329257-A-G **
10843041-A-T **
10861539-G-A **
10861538-T-C **
10861529-T-A **
10851785-C-T **
10851780-C-T **
10851775-G-T **
10850819-C-G **
10848087-C-A **
10847887-T-C **
10842994-C-T **
10861924-C-T **
10833119-A-C **
10833118-T-A **
10833117-G-A **
10833114-A-G **
10828191-G-C **
10827104-C-T **
10827051-T-C **
10827050-A-T **
10827040-A-C **
10827036-T-A **
10861555-T-C **
10868105-A-C **
10935989-C-T **
10927394-C-T **
10935981-C-A **
10935971-C-T **
10934236-C-G **
10929164-C-T **
10929163-A-C **
10929153-C-CATTCTA **
10928754-C-A **
10927670-C-T **
10927663-C-A **
10921111-C-G **
10877678-C-G **
10898222-C-A **
10892806-A-T **
10892800-C-A **
10892791-A-T **
10888431-C-A **
10887857-T-C **
10887854-C-G **
10884435-T-A **
10883895-C-CCAGTA **
10881919-C-A **
13484913-G-T 11329237-G-T **
13489390-A-G 11333714-A-G **
14592099-G-T 12480299-G-T **
14350250-C-T 12229545-C-T **
14397896-A-G 12277192-A-G **
14397386-C-G 12276682-C-G **
14397370-G-GA 12276666-G-GA **
14397370-G-T 12276666-G-T **
14393050-A-G 12272346-A-G **
14350264-C-G 12229559-C-G **
14350262-A-C 12229557-A-C **
14350255-C-A 12229550-C-A **
14350253-G-A 12229548-G-A **
14350213-A-G 12229508-A-G **
14425027-C-T 12304302-C-T **
14350212-T-C 12229507-T-C **
14349179-A-G 12228474-A-G **
14344197-C-T 12223492-C-T **
14316278-G-A 12195572-G-A **
14301921-C-T 12181215-C-T **
14301916-C-T 12181210-C-T **
14289368-C-T 12168662-C-T **
14250170-G-T 12129464-G-T **
14247527-T-C 12126821-T-C **
14247525-A-G 12126819-A-G **
14416110-CTA-C 12295407-CTA-C **
14425031-T-A 12304306-T-A **
14247514-C-T 12126808-C-T **
14464332-T-A 12343605-T-A **
14592098-T-A 12480298-T-A **
14573944-C-A 12462144-C-A **
14519623-T-C 12407824-T-C **
14514102-C-T 12402307-C-T **
14513916-C-T 12402121-C-T **
14502072-T-G 12390277-T-G **
14501817-T-C 12390022-T-C **
14485014-G-T 12364283-G-T **
14467824-C-G 12347093-C-G **
14462733-A-G 12342006-A-G **
14425038-T-C 12304313-T-C **
14462732-C-T 12342005-C-T **
14458182-C-A 12337455-C-A **
14450485-C-A 12329758-C-A **
14440235-G-T 12319508-G-T **
14433488-C-A 12312761-C-A **
14427291-C-T 12306566-C-T **
14427285-T-TAA 12306560-T-TAA **
14427284-C-G 12306559-C-G **
14427279-T-C 12306554-T-C **
14427270-A-G 12306545-A-G **
14247518-GC-G 12126812-GC-G **
14230665-G-A 12109959-G-A **
13567159-T-A 11411483-T-A **
11658036-T-A **
13900100-C-A 11779394-C-A **
13884258-C-A 11763552-C-A **
13865544-A-T 11744838-A-T **
13838688-A-G 11717982-A-G **
11675021-G-A **
11672166-G-A **
11665198-T-C **
11658048-A-C **
11658046-C-T **
11656663-C-G **
13927273-T-TGGGCGAATG 11806567-T-TGGGCGAATG **
11654642-TGGAGTCGAACGGTATA-T **
13710780-TG-T 11555104-TG-T **
13707375-A-G 11551699-A-G **
13690224-G-C 11534548-G-C **
13620802-G-C 11465126-G-C **
13614075-T-C 11458399-T-C **
13602682-G-T 11447006-G-T **
13577964-G-A 11422288-G-A **
13577942-T-C 11422266-T-C **
13567172-G-A 11411496-G-A **
13919777-C-A 11799071-C-A **
13937470-C-A 11816764-C-A **
14230657-G-C 12109951-G-C **
14159867-T-C 12039161-T-C **
14230645-C-T 12109939-C-T **
14230638-C-T 12109932-C-T **
14222758-T-C 12102052-T-C **
14222746-A-G 12102040-A-G **
14194849-C-A 12074143-C-A **
14168242-A-G 12047536-A-G **
14168239-C-T 12047533-C-T **
14168237-C-A 12047531-C-A **
14168227-C-T 12047521-C-T **
14124994-G-T 12004288-G-T **
14004504-C-A 11883798-C-A **
14115031-C-G 11994325-C-G **
14102552-C-G 11981846-C-G **
14090636-C-A 11969930-C-A **
14080107-G-T 11959401-G-T **
14053918-C-A 11933212-C-A **
14051182-G-T 11930476-G-T **
14033949-T-C 11913243-T-C **
14033907-C-A 11913201-C-A **
14020282-C-T 11899576-C-T **
14020279-A-G 11899573-A-G **
16906857-C-A 14794977-C-A **
10887847-T-G **
16941450-A-G 14829570-A-G **
22703436-T-A 20541550-T-A **
22896083-T-G 20734197-T-G **
22868746-A-C 20706860-A-C **
22864421-A-C 20702535-A-C **
22864387-A-C 20702501-A-C **
22856486-C-T 20694600-C-T **
22849567-C-A 20687681-C-A **
22820331-G-T 20658445-G-T **
22804064-A-G 20642178-A-G **
22755647-C-G 20593761-C-G Y128889 **
22682605-T-G 20520719-T-G **
22910541-T-A 20748655-T-A **
22682603-G-A 20520717-G-A **
22611997-T-C 20450111-T-C **
22611204-T-C 20449318-T-C **
22602464-G-C 20440578-G-C **
22580101-G-A 20418215-G-A **
22550094-G-A 20388208-G-A **
22541163-A-G 20379277-A-G **
22352469-T-C 20190583-T-C DYZ19 **
22337693-G-A 20175807-G-A DYZ19 **
22897981-T-A 20736095-T-A **
22914565-C-T 20752679-C-T **
22337421-C-A 20175535-C-A DYZ19 **
23267095-A-G 21105209-A-G **
23439063-T-TG 21277177-T-TG **
23435811-T-TG 21273925-T-TG **
23425457-C-G 21263571-C-G **
23391683-A-G 21229797-A-G **
23376859-C-A 21214973-C-A **
23309405-C-T 21147519-C-T **
23294263-A-G 21132377-A-G **
23274801-A-G 21112915-A-G **
23267103-A-G 21105217-A-G **
23253300-G-T 21091414-G-T **
23004148-G-C 20842262-G-C **
23235919-A-G 21074033-A-G **
23198192-G-A 21036306-G-A **
23190721-C-A 21028835-C-A **
23176944-C-A 21015058-C-A **
23152659-A-T 20990773-A-T **
23120134-T-C 20958248-T-C **
23119924-A-G 20958038-A-G **
23079153-G-T 20917267-G-T **
23029651-A-T 20867765-A-T **
23019976-T-A 20858090-T-A **
22337425-G-A 20175539-G-A DYZ19 **
22337416-C-A 20175530-C-A DYZ19 **
23467447-T-C 21305561-T-C **
21414610-T-G 19252724-T-G **
21588382-C-A 19426496-C-A **
21565908-C-A 19404022-C-A **
21526964-T-A 19365078-T-A **
21500210-C-G 19338324-C-G **
21483386-TC-T 19321500-TC-T **
21468099-C-T 19306213-C-T **
21456160-G-T 19294274-G-T **
21456154-G-T 19294268-G-T **
21455427-C-A 19293541-C-A **
21384946-C-A 19223060-C-A **
21677132-C-T 19515246-C-T **
21372502-C-A 19210616-C-A **
21355380-A-G 19193494-A-G **
21334154-C-T 19172268-C-T **
21321339-T-G 19159453-T-G **
21281775-C-A 19119889-C-A **
21240500-C-A 19078614-C-A **
21225053-T-A 19063167-T-A **
21225050-A-G 19063164-A-G **
21223285-A-T 19061399-A-T **
21212405-A-G 19050519-A-G **
21596879-C-A 19434993-C-A **
21678158-A-C 19516272-A-C **
22153591-C-A 19991705-C-A **
21984121-T-G 19822235-T-G **
22122097-C-T 19960211-C-T **
22092844-C-A 19930958-C-A **
22088806-T-C 19926920-T-C **
22088706-A-C 19926820-A-C **
22080966-A-G 19919080-A-G **
22080942-C-T 19919056-C-T **
22080933-A-G 19919047-A-G **
21993780-A-G 19831894-A-G **
21990366-A-T 19828480-A-T **
21952011-TA-T 19790125-TA-T **
21692086-C-A 19530200-C-A **
21951930-A-G 19790044-A-G **
21932687-G-A 19770801-G-A **
21909911-A-C 19748025-A-C **
21909907-A-G 19748021-A-G **
21899835-G-T 19737949-G-T **
21890407-G-T 19728521-G-T **
21852804-A-G 19690918-A-G **
21775373-C-T 19613487-C-T **
21738561-T-C 19576675-T-C **
21737748-G-A 19575862-G-A **
23467440-T-G 21305554-T-G **
23467455-C-A 21305569-C-A **
21200736-C-T 19038850-C-T **
28534940-C-CT 26388793-C-CT 18×T**
28744982-A-G 26598835-A-G **
28732017-C-T 26585870-C-T **
28732012-A-G 26585865-A-G **
28732011-C-T 26585864-C-T **
28719852-T-A 26573705-T-A **
28711936-G-A 26565789-G-A **
28681879-G-T 26535732-G-T **
28570575-A-G 26424428-A-G **
28536080-C-A 26389933-C-A **
28534565-T-A 26388418-T-A **
28766266-T-C 26620119-T-C **
28534554-CTT-C 26388407-CTT-C 9×T**
28514325-T-C 26368178-T-C **
28499925-G-C 26353778-G-C **
28484281-T-G 26338134-T-G **
28006399-C-T 25860252-C-T P1_Y2 **
28006376-A-ACGCGCG 25860229-A-ACGCGCG P1_Y2 **
27906727-G-T 25760580-G-T P1_Y2 **
27873326-T-TA 25727179-T-TA P1_Y2 **
27617980-C-CAAA 25471833-C-CAAA P1_Y2 29×A**
28764456-G-T 26618309-G-T **
28766267-G-A 26620120-G-A **
27584476-G-T 25438329-G-T P1_Y2 **
56827245-A-C **
6245-G-T **
56867529-A-G **
56860210-C-A **
56842675-G-C **
56842666-G-C **
56828404-C-G **
56828400-A-T **
56827252-C-A **
56827250-T-C **
56827194-T-TTCCAG **
28766274-CT-G 26620127-CT-G **
56827190-A-T **
56827188-A-C **
56827184-A-T **
56827171-A-C **
56827166-G-C **
56734494-C-A **
56734489-T-A **
56705910-G-A **
28773636-C-A 26627489-C-A **
28766283-C-T 26620136-C-T **
27596021-A-G 25449874-A-G P1_Y2 **
27435996-C-A 25289849-C-A P1_Y2 **
23468628-C-T 21306742-C-T **
23773904-T-G 21612018-T-G **
24052429-G-T 21906282-G-T P3_b1 **
24003767-C-A 21857620-C-A **
23993984-CA-C 21847837-CA-C **
23982608-G-A 21836461-G-A BY34082 **
23834776-A-C 21672890-A-C **
23831496-T-G 21669610-T-G **
23831488-C-G 21669602-C-G **
23813951-C-A 21652065-C-A **
23774865-A-G 21612979-A-G **
23633454-G-A 21471568-G-A **
24389894-CTTTT-C 22243747-CTTTT-C 26×T**
23623561-G-A 21461675-G-A **
23552646-G-A 21390760-G-A **
23522669-C-G 21360783-C-G **
23509007-G-T 21347121-G-T **
23493443-A-C 21331557-A-C **
23483447-G-A 21321561-G-A **
23483446-T-G 21321560-T-G **
23480540-G-A 21318654-G-A **
23480533-T-C 21318647-T-C **
23480528-G-A 21318642-G-A **
24221415-A-T 22075268-A-T P3_b1 **
24405797-C-A 22259650-C-A **
27396989-G-T 25250842-G-T P1_g3 **
25395683-G-T 23249536-G-T P2_r2 **
26453075-T-TG 24306928-T-TG P1_Y1 **
26409091-C-A 24262944-C-A P1_Y1 **
26334856-A-G 24188709-A-G P1_Y1 **
26325154-C-A 24179007-C-A P1_Y1 **
26120171-T-C 23974024-T-C P1_Y1 **
26120153-C-GTAT 23974006-C-GTAT P1_Y1 **
26120150-T-A 23974003-T-A P1_Y1 12×TTCC**
26120149-C-T 23974002-C-T P1_Y1 **
26100830-C-A 23954683-C-A P1_Y1 **
25102277-C-A 22956130-C-A g1 **
24424181-C-T 22278034-C-T **
24875536-T-C 22729389-T-C g1 **
24875533-G-A 22729386-G-A g1 **
24875532-T-C 22729385-T-C g1 **
24875524-T-A 22729377-T-A g1 **
24875519-T-G 22729372-T-G g1 **
24458607-CA-C 22312460-CA-C **
24458605-C-AT 22312458-C-AT **
24458600-T-A 22312453-T-A **
24445361-A-T 22299214-A-T **
24445350-A-CTG 22299203-A-CTG **
21200807-C-A 19038921-C-A **
21187270-C-A 19025384-C-A **
16944608-C-T 14832728-C-T **
17739993-T-C 15628113-T-C **
17934135-A-C 15822255-A-C **
17934132-C-T 15822252-C-T **
17918615-A-C 15806735-A-C **
17907831-C-A 15795951-C-A **
17885825-T-C 15773945-T-C **
17832395-T-C 15720515-T-C **
17832391-C-T 15720511-C-T **
17789732-C-T 15677852-C-T **
17760450-A-T 15648570-A-T **
17731528-G-T 15619648-G-T **
17981966-C-A 15870086-C-A Y100867 **
17707181-T-G 15595301-T-G **
17707165-GCA-G 15595285-GCA-G **
17676281-T-C 15564401-T-C **
17604425-G-A 15492545-G-A **
17596510-T-C 15484630-T-C **
17555768-C-A 15443888-C-A **
17519338-C-A 15407458-C-A **
17515330-G-A 15403450-G-A **
17515326-A-G 15403446-A-G **
17944297-C-A 15832417-C-A **
18079241-A-G 15967361-A-G **
17448254-T-C 15336374-T-C **
18212518-C-CA 16100638-C-CA **
18565347-G-A 16453467-G-A **
18565344-C-T 16453464-C-T **
18546299-CT-C 16434419-CT-C **
18546295-G-A 16434415-G-A **
18395933-G-T 16284053-G-T P6_Gap **
18390162-G-T 16278282-G-T P6_Gap **
18389323-G-C 16277443-G-C P6_Gap **
18270078-C-A 16158198-C-A **
18249884-C-A 16138004-C-A **
18206672-T-C 16094792-T-C **
18079249-C-G 15967369-C-G **
18195348-A-T 16083468-A-T **
18190424-C-A 16078544-C-A **
18185103-C-A 16073223-C-A **
18143873-C-T 16031993-C-T **
18138070-A-C 16026190-A-C **
18129221-C-A 16017341-C-A **
18125501-G-T 16013621-G-T **
18121779-T-C 16009899-T-C **
18079273-C-T 15967393-C-T **
18079256-AG-A 15967376-AG-A **
17490233-C-A 15378353-C-A **
17448251-A-G 15336371-A-G **
18565358-A-C 16453478-A-C **
17002904-A-G 14891024-A-G **
17093884-C-A 14982004-C-A **
17056036-G-C 14944156-G-C **
17052111-G-T 14940231-G-T **
17041849-A-T 14929969-A-T **
17041848-A-G 14929968-A-G **
17041833-T-C 14929953-T-C **
17041831-C-G 14929951-C-G **
17038452-C-A 14926572-C-A **
17002907-G-C 14891027-G-C **
17002883-G-A 14891003-G-A **
17130175-C-A 15018295-C-A **
17002878-T-G 14890998-T-G **
17002875-A-G 14890995-A-G **
16987871-A-G 14875991-A-G **
16987835-T-G 14875955-T-G **
16980208-C-T 14868328-C-T **
16980202-A-T 14868322-A-T **
16980197-T-C 14868317-T-C **
16979977-C-A 14868097-C-A **
16964082-G-C 14852202-G-C **
16944609-A-G 14832729-A-G **
17128709-A-G 15016829-A-G **
10819105-C-T **
17448246-T-C 15336366-T-C **
17297431-A-T 15185551-A-T **
17414822-A-G 15302942-A-G **
17413237-G-C 15301357-G-C **
17406858-A-C 15294978-A-C **
17360901-A-G 15249021-A-G **
17332607-G-A 15220727-G-A **
17326896-C-A 15215016-C-A **
17302142-G-T 15190262-G-T **
17300751-C-T 15188871-C-T **
17300709-A-G 15188829-A-G **
17296319-C-A 15184439-C-A **
17151227-G-C 15039347-G-C **
17284570-G-A 15172690-G-A **
17270761-G-T 15158881-G-T **
17225848-C-T 15113968-C-T **
17225844-C-G 15113964-C-G **
17225843-A-G 15113963-A-G **
17225842-C-A 15113962-C-A **
17216028-T-C 15104148-T-C **
17204206-T-C 15092326-T-C **
17176403-G-T 15064523-G-T **
17151282-C-T 15039402-C-T **
18565355-C-T 16453475-C-T **
18585650-C-T 16473770-C-T **
21175636-G-A 19013750-G-A **
19668813-A-G 17556933-A-G P5_Prx **
20025474-T-G 17913594-T-G P5_Prx **
20025432-C-GTG 17913552-C-GTG P5_Prx 25×CT**
20025430-C-T 17913550-C-T P5_Prx **
20025427-T-A 17913547-T-A P5_Prx **
20025425-T-C 17913545-T-C P5_Prx **
20001951-C-A 17890071-C-A P5_Prx **
19721372-G-T 17609492-G-T P5_Prx **
19682363-GAAAGA-G 17570483-GAAAGA-G P5_Prx **
19682359-G-T 17570479-G-T P5_Prx **
19663280-AAT-A 17551400-AAT-A P5_Prx **
20132699-TA-T 18020819-TA-T P5_Dst 9×A**
19609590-A-G 17497710-A-G P5_Prx **
19558776-T-C 17446896-T-C **
19558766-A-G 17446886-A-G **
19539546-G-C 17427666-G-C **
19530539-G-T 17418659-G-T **
19447461-C-T 17335581-C-T FGC72486 **
19340568-A-T 17228688-A-T **
19340555-C-CA 17228675-C-CA **
19337752-C-T 17225872-C-T **
20084144-G-GAT 17972264-G-GAT P5_Dst **
20376069-C-G 18214183-C-G P5_Dst **
19333399-AT-A 17221519-AT-A **
21115494-C-A 18953608-C-A **
21175630-A-G 19013744-A-G **
21175622-C-A 19013736-C-A **
21175611-A-G 19013725-A-G **
21155343-C-A 18993457-C-A **
21153937-T-G 18992051-T-G **
21140159-T-G 18978273-T-G **
21136625-A-T 18974739-A-T **
21115855-A-G 18953969-A-G **
21115848-A-G 18953962-A-G **
21113079-A-T 18951193-A-T **
20579265-CAT-C 18417379-CAT-C P5_Dst **
21113065-G-A 18951179-G-A **
21113043-T-C 18951157-T-C **
21113040-A-T 18951154-A-T **
21109418-A-G 18947532-A-G **
21108145-G-T 18946259-G-T **
21100479-T-G 18938593-T-G **
21073402-A-G 18911516-A-G **
20948617-T-C 18786731-T-C P4_Dst **
20693680-G-T 18531794-G-T P4_Prx **
20635018-A-AGATATAT 18473132-A-AGATATAT P4_Prx **
19335137-C-A 17223257-C-A **
19331481-G-C 17219601-G-C **
18585652-G-C 16473772-G-C **
18769553-A-G 16657673-A-G **
18848576-G-T 16736696-G-T **
18838482-A-T 16726602-A-T **
18805099-A-C 16693219-A-C **
18805093-G-A 16693213-G-A **
18805092-T-C 16693212-T-C **
18805088-G-C 16693208-G-C **
18805083-G-A 16693203-G-A **
18792819-A-G 16680939-A-G **
18769558-T-C 16657678-T-C **
18758922-TC-T 16647042-TC-T **
18853506-G-C 16741626-G-C **
18758915-C-CTT 16647035-C-CTT **
18755026-T-G 16643146-T-G **
18749024-C-A 16637144-C-A **
18723061-C-A 16611181-C-A **
18701645-A-C 16589765-A-C **
18687565-C-A 16575685-C-A **
18682574-G-A 16570694-G-A **
18634937-C-A 16523057-C-A **
18632369-A-G 16520489-A-G **
18632366-T-C 16520486-T-C **
18853504-G-A 16741624-G-A FGC6121 **
18857036-T-G 16745156-T-G **
19310050-A-C 17198170-A-C **
19007655-T-C 16895775-T-C **
19290928-C-A 17179048-C-A **
19285246-A-G 17173366-A-G **
19262761-C-A 17150881-C-A **
19201763-C-T 17089883-C-T Y74871 **
19189258-T-C 17077378-T-C **
19189256-C-G 17077376-C-G **
19135521-C-A 17023641-C-A Y103766 **
19123716-G-T 17011836-G-T **
19107394-TACTAACTATA-T 16995514-TACTAACTATA-T **
19001198-T-G 16889318-T-G **
18883412-G-T 16771532-G-T **
18980702-T-C 16868822-T-C **
18972872-G-T 16860992-G-T **
18972866-T-G 16860986-T-G **
18965023-A-G 16853143-A-G **
18965021-C-T 16853141-C-T **
18937241-C-T 16825361-C-T **
18937230-A-G 16825350-A-G **
18924955-G-T 16813075-G-T **
18891355-A-AT 16779475-A-AT **
18883416-G-T 16771536-G-T **
10819108-T-C **
17041850-A-G 14929970-A-G **
10819088-T-TCCAC **
9444882-C-G 9607273-C-G **
2693366-C-A 2825325-C-A **
2685815-AT-A 2817774-AT-A **
2683478-C-A 2815437-C-A **
9444889-T-C 9607280-T-C **
9444883-T-G 9607274-T-G **
21692109-C-A 19530223-C-A **
2725654-G-T 2857613-G-T **
15365920-G-T 13254040-G-T **
22023289-C-A 19861403-C-A **
22541102-T-C 20379216-T-C **
21682265-A-G 19520379-A-G **
14180993-C-A 12060287-C-A **
18853508-G-T 16741628-G-T **
14501825-A-T 12390030-A-T **
2721945-T-C 2853904-T-C **
2746752-C-CTCT 2878711-C-CTCT **
8153611-A-T 8285570-A-T **
2855515-G-A 2987474-G-A **
2905908-G-A 3037867-G-A **
2901598-T-G 3033557-T-G **
2899595-C-A 3031554-C-A **
2899319-C-A 3031278-C-A **
2899305-T-C 3031264-T-C **
2882588-C-G 3014547-C-G **
2860180-A-G 2992139-A-G **
2853468-TTTG-T 2985427-TTTG-T **
2762085-C-T 2894044-C-T **
2845637-G-A 2977596-G-A **
2845634-T-C 2977593-T-C **
2839944-C-A 2971903-C-A **
2835753-CTG-A 2967712-CTG-A **
2812860-C-T 2944819-C-T **
2762112-G-C 2894071-G-C **
2762109-C-T 2894068-C-T **
11020822-C-T **
2797217-C-A 2929176-C-A **
2905933-A-C 3037892-A-C **
6855397-T-G 6987356-T-G **
14768427-T-G 12656496-T-G **
18630092-C-A 16518212-C-A **
6357744-G-T 6489703-G-T **
7705155-C-A 7837114-C-A **
13209942-C-A 11054266-C-A **
16871370-T-C 14759490-T-C **
23720448-A-G 21558562-A-G **
5249002-C-A 5380961-C-A **
22804071-C-G 20642185-C-G **
22804065-T-C 20642179-T-C **
16538963-T-A 14427083-T-A **
14149115-C-A 12028409-C-A **
17128700-C-A 15016820-C-A **
6298495-AC-A 6430454-AC-A IR3_Dst **
11022820-G-T **
7214498-C-A 7346457-C-A **
17217422-A-G 15105542-A-G **
8170394-C-T 8302353-C-T **
17276156-C-A 15164276-C-A **
4926197-G-T 5058156-G-T **
10819081-CTCTT-C **
21068176-G-T 18906290-G-T **
7721325-C-T 7853284-C-T **
23468615-C-CAA 21306729-C-CAA **
21824950-C-A 19663064-C-A **
14836271-G-T 12724338-G-T **
15612323-T-G 13500443-T-G **
21692014-C-A 19530128-C-A **
14425040-C-A 12304315-C-A **
3847216-C-A 3979175-C-A **
7866980-C-A 7998939-C-A **
22914570-T-A 20752684-T-A **
10935978-T-C **
22804079-A-G 20642193-A-G **
15841847-G-A 13729967-G-A **
2905918-A-G 3037877-A-G **
3092107-C-A 3224066-C-A **
16428535-C-A 14316655-C-A **
5293899-A-G 5425858-A-G **
5688547-A-C 5820506-A-C **
5644734-GATAAT-G 5776693-GATAAT-G **
5560022-C-CG 5691981-C-CG **
5560007-T-C 5691966-T-C **
5560004-G-A 5691963-G-A **
5412317-T-C 5544276-T-C **
5204502-CG-C 5336461-CG-C **
5690979-A-T 5822938-A-T **
5204437-G-C 5336396-G-C **
5199785-T-C 5331744-T-C **
5189047-TTGTGTGTGTGTA-T 5321006-TTGTGTGTGTGTA-T **
5096515-A-C 5228474-A-C **
5084196-T-A 5216155-T-A **
5036319-A-G 5168278-A-G **
4995210-T-A 5127169-T-A **
5690546-A-C 5822505-A-C **
5755743-T-A 5887702-T-A **
4995152-G-A 5127111-G-A **
6491231-C-A 6623190-C-A **
6700743-G-A 6832702-G-A **
6674718-C-T 6806677-C-T **
6642837-G-A 6774796-G-A **
6633047-C-A 6765006-C-A **
6625052-G-A 6757011-G-A **
6577121-A-G 6709080-A-G **
6513430-C-A 6645389-C-A **
6435122-C-A 6567081-C-A **
5755777-G-T 5887736-G-T **
6354078-G-T 6486037-G-T **
6347552-G-T 6479511-G-T **
6242658-G-T 6374617-G-T IR3_Dst **
6171629-C-A 6303588-C-A IR3_Dst **
6148749-CAA-C 6280708-CAA-C IR3_Dst 8×A**
5990513-G-T 6122472-G-T **
5786153-CATGTAA-C 5918112-CATGTAA-C **
4995199-G-T 5127158-G-T **
4959458-T-G 5091417-T-G **
3114581-G-T 3246540-G-T **
3716231-G-A 3848190-G-A **
3961502-C-A 4093461-C-A **
3879905-A-C 4011864-A-C **
3834286-GA-G 3966245-GA-G 10×A**
3830882-G-A 3962841-G-A **
3804728-G-A 3936687-G-A **
3780781-G-GA 3912740-G-GA 9×A**
3716229-C-T 3848188-C-T **
4066488-T-C 4198447-T-C **
3622223-T-C 3754182-T-C **
3577936-A-G 3709895-A-G **
3346425-A-C 3478384-A-C **
3343957-A-C 3475916-A-C **
3174374-C-CTT 3306333-C-CTT 18×T**
3114593-A-G 3246552-A-G **
3114585-A-G 3246544-A-G **
4050125-C-A 4182084-C-A **
4101438-A-C 4233397-A-C **
4929356-C-A 5061315-C-A **
4416070-G-A 4548029-G-A **
4918454-T-G 5050413-T-G **
4547839-A-G 4679798-A-G **
4443584-T-G 4575543-T-G **
4438037-G-T 4569996-G-T **
4438033-C-T 4569992-C-T **
4438027-C-A 4569986-C-A **
4438018-A-T 4569977-A-T **
4416060-T-G 4548019-T-G **
4103692-G-A 4235651-G-A **
4412220-G-T 4544179-G-T **
4392280-GACAA-G 4524239-GACAA-G **
4389510-A-C 4521469-A-C **
4240412-A-G 4372371-A-G **
4236057-C-A 4368016-C-A **
4235659-C-A 4367618-C-A **
4114668-T-C 4246627-T-C **
10816718-T-A **
28730100-C-A 26583953-C-A **
6700755-A-G 6832714-A-G **
28468791-C-A 26322644-C-A **
13577937-T-A 11422261-T-A **
7115539-T-C 7247498-T-C **
28017637-G-T 25871490-G-T P1_Y2 **
16308941-A-T 14197061-A-T **
10892125-C-G **
19663333-A-G 17551453-A-G P5_Prx **
14982038-C-A 12870106-C-A **
13577960-A-G 11422284-A-G **
18389321-A-G 16277441-A-G P6_Gap **
10949373-A-C **
17352383-T-G 15240503-T-G **
23284121-CA-C 21122235-CA-C **
8109860-T-C 8241819-T-C **
21435248-C-T 19273362-C-T **
10892121-T-C **
13577959-C-T 11422283-C-T **
21984127-T-C 19822241-T-C **
14518313-CA-C 12406514-CA-C 9×A**
10833029-T-A **
2762100-C-T 2894059-C-T **
10777433-G-A **
10833103-C-T **
10833069-C-G **
10833055-C-T **
10833039-ACCCCT-A **
10833030-T-A **
23825279-G-T 21663393-G-T **
10877919-T-A **
10842984-T-C **
23523645-A-G 21361759-A-G **
6239-T-C **
2759960-G-C 2891919-G-C **
10877961-T-A **
10877943-A-C **
10877941-G-A **
16036211-C-A 13924331-C-A **
2860191-A-G 2992150-A-G **
9456630-A-C 9619021-A-C **
14888196-T-C 12776262-T-C **
8094607-G-A 8226566-G-A FGC53148 **
3841183-C-A 3973142-C-A **
18937557-T-C 16825677-T-C **
7277048-G-GA 7409007-G-GA 12×A**
17641995-A-T 15530115-A-T **
8280042-C-T 8412001-C-T Y39418 **
19431505-C-A 17319625-C-A **
16079322-A-C 13967442-A-C Z3328 **
18174445-A-C 16062565-A-C ****
17130465-T-C 15018585-T-C **
15687709-G-A 13575829-G-A CTS4511 **
15669776-G-C 13557896-G-C **
14959629-A-T 12847704-A-T ****
13808067-A-G 11687361-A-G *****
2762077-C-T 2894036-C-T CTS144 M4710 ****
15576774-C-T 13464894-C-T **
18758927-C-CTT 16647047-C-CTT 5×TCTT**
19544101-C-A 17432221-C-A **
13854453-C-A 11733747-C-A **
14515131-A-G 12403336-A-G **
18195331-ATTT-A 16083451-ATTT-A 8×T**
14054932-C-T 11934226-C-T **
9980405-C-A 10142796-C-A **
17375142-G-T 15263262-G-T **
10983292-T-A **
14764411-C-A 12652480-C-A **
14963658-C-A 12851733-C-A **
22055366-C-T 19893480-C-T Y4158 FGC20040 **
17642006-C-T 15530126-C-T **
16968416-G-T 14856536-G-T Y23536 **
15665771-C-T 13553891-C-T A11848 **
26344423-CT-C 24198276-CT-C P1_Y1 28×T**
18805112-T-C 16693232-T-C **
18805102-T-G 16693222-T-G **
18805100-A-C 16693220-A-C **
14884607-G-A 12772673-G-A **
9456634-T-G 9619025-T-G **
18986399-AT-A 16874519-AT-A 8×T**
17920835-G-A 15808955-G-A MF1880 **
10949353-T-C **
16568026-T-C 14456146-T-C **
16760186-CT-C 14648306-CT-C **
24415733-TA-T 22269586-TA-T **
10958215-T-A **
9926635-C-A 10089026-C-A **
14888200-C-T 12776266-C-T **
5560021-C-T 5691980-C-T **
8100477-AG-A 8232436-AG-A **
14784754-A-G 12672824-A-G **
26991318-T-G 24845171-T-G P1_r4 **
14293620-T-C 12172914-T-C **
18716611-G-A 16604731-G-A **
8092038-A-C 8223997-A-C **
6700776-T-C 6832735-T-C **
5560014-A-G 5691973-A-G **
10848086-C-A **
21488650-C-A 19326764-C-A **
19117472-C-A 17005592-C-A **
28776852-C-A 26630705-C-A **
22804072-A-G 20642186-A-G **
7582005-C-A 7713964-C-A **
14391805-C-A 12271101-C-A **
14630377-G-A 12518446-G-A **
4937435-G-T 5069394-G-T **
7228251-C-A 7360210-C-A **
23203754-G-T 21041868-G-T **
20865479-G-T 18703593-G-T P4_Dst **
14501798-A-G 12390003-A-G **
21435268-A-AC 19273382-A-AC **
21435251-A-G 19273365-A-G **
10934955-G-T **
15841846-T-C 13729966-T-C **
14888161-C-T 12776227-C-T Y3239 **
17300744-C-T 15188864-C-T **
22703438-C-A 20541552-C-A 8×A**
15288165-C-T 13176264-C-T **
9456640-G-C 9619031-G-C **
23120123-A-G 20958237-A-G **
27540975-C-A 25394828-C-A P1_Y2 **
20948675-GT-G 18786789-GT-G P4_Dst **
21738574-A-G 19576688-A-G **
17920822-G-A 15808942-G-A **
4534006-C-A 4665965-C-A **
10996098-G-T **
10656355-C-A **
10792216-C-A **
21149610-G-T 18987724-G-T **
6375585-G-T 6507544-G-T **
19566997-C-A 17455117-C-A **
18179640-A-C 16067760-A-C **
15632129-C-A 13520249-C-A **
10892118-A-T **
9456642-A-G 9619033-A-G **
16442544-C-A 14330664-C-A **
17876502-C-A 15764622-C-A **
15288136-C-T 13176235-C-T **
22734601-C-A 20572715-C-A **
18546294-T-C 16434414-T-C **
15579978-A-C 13468098-A-C **
18195329-C-CT 16083449-C-CT **
15260143-T-C 13148227-T-C **
15260140-C-T 13148224-C-T **
14293611-C-G 12172905-C-G **
14293608-T-A 12172902-T-A **
10747783-C-A **
10686914-T-A **
18755036-C-A 16643156-C-A **
10660362-G-T **
6244486-CA-C 6376445-CA-C IR3_Dst **
7776512-G-T 7908471-G-T **
56749994-T-G **
26321001-G-T 24174854-G-T P1_Y1 **
2795006-C-A 2926965-C-A **
6700753-T-C 6832712-T-C **
21151664-T-A 18989778-T-A **
6700756-C-T 6832715-C-T **
8774665-T-C 8906624-T-C **
8235487-T-C 8367446-T-C **
8255972-C-A 8387931-C-A **
8285435-C-A 8417394-C-A **
8314350-C-A 8446309-C-A **
8353357-C-A 8485316-C-A **
8376265-C-T 8508224-C-T **
8479549-C-T 8611508-C-T FGC12898 Y4291 **
8479555-C-T 8611514-C-T **
8525318-A-G 8657277-A-G **
8637472-C-A 8769431-C-A **
8713153-G-T 8845112-G-T **
8718294-T-C 8850253-T-C **
8746520-A-T 8878479-A-T **
8810744-A-C 8942703-A-C **
8190017-C-A 8321976-C-A **
8842392-C-A 8974351-C-A **
8913520-C-G 9045479-C-G **
9124247-T-C **
9028336-C-G 9190727-C-G **
9028337-T-TG 9190728-T-TG **
9028346-G-C 9190737-G-C **
9028347-G-A 9190738-G-A **
9028348-T-C 9190739-T-C **
9028349-G-A 9190740-G-A **
9028350-T-C 9190741-T-C **
9088783-G-T 9251174-G-T **
9166342-T-C 9328733-T-C **
9166352-G-A 9328743-G-A **
9240737-G-T 9403128-G-T **
8235473-G-A 8367432-G-A **
8181470-C-T 8313429-C-T **
9402585-C-A 9564976-C-A **
8035958-A-G 8167917-A-G **
7427881-G-A 7559840-G-A **
7529650-T-TG 7661609-T-TG **
7557986-G-A 7689945-G-A **
7568002-G-A 7699961-G-A **
7588850-C-A 7720809-C-A **
7645331-C-A 7777290-C-A **
7657079-T-G 7789038-T-G **
7690089-C-A 7822048-C-A **
7699917-C-A 7831876-C-A **
7708749-A-C 7840708-A-C **
7723990-C-T 7855949-C-T **
7733920-G-T 7865879-G-T **
7869179-C-A 8001138-C-A **
7923617-T-C 8055576-T-C **
8061741-T-G 8193700-T-G **
8181462-T-A 8313421-T-A **
8061761-A-G 8193720-A-G **
8061764-T-C 8193723-T-C **
8061764-TG-T 8193723-TG-T **
8061769-T-C 8193728-T-C **
8061792-C-A 8193751-C-A **
8061795-T-G 8193754-T-G **
8067573-G-A 8199532-G-A **
8109879-G-C 8241838-G-C **
8109892-G-A 8241851-G-A **
8110556-G-A 8242515-G-A **
8110559-A-C 8242518-A-C **
8110568-C-T 8242527-C-T **
8153597-C-A 8285556-C-A **
8171781-T-C 8303740-T-C **
9371569-T-C 9533960-T-C **
9416805-T-C 9579196-T-C **
7363704-A-ACT 7495663-A-ACT **
10763936-A-C **
10668625-C-A **
10668626-C-A **
10668631-C-T **
10668632-A-G **
10669416-TTCATC-T **
10671315-G-T **
10686799-C-A **
10747749-C-A **
10747766-C-T **
10747786-T-C **
10757570-C-A **
10763911-G-C **
10763928-A-G **
10763938-G-A **
10668613-T-C **
10777675-G-C **
10777680-G-C **
10792231-C-G **
10798311-A-G **
10798523-C-T **
10801819-TG-T **
10802948-A-T **
10810580-C-T **
10816622-C-G **
10816704-C-T **
10816723-C-A **
10817720-A-C **
10817727-C-T **
10817752-C-T **
10668615-C-G **
10656334-C-T **
9416809-A-T 9579200-A-T **
9926606-C-A 10088997-C-A **
9421360-T-G 9583751-T-G **
9434462-G-C 9596853-G-C **
9444874-G-C 9607265-G-C **
9444885-G-A 9607276-G-A **
9444902-A-G 9607293-A-G **
6700790-C-CAA 6832749-C-CAA **
9508416-C-A 9670807-C-A **
9515709-G-A 9678100-G-A **
9618170-G-T 9780561-G-T IR3_Prx **
9730385-G-T 9892776-G-T IR3_Prx **
9764173-G-T 9926564-G-T **
9807834-A-T 9970225-A-T **
9807841-T-C 9970232-T-C **
9892523-C-A 10054914-C-A **
9937665-T-C 10100056-T-C **
10656275-C-T **
9945544-G-T 10107935-G-T **
9955833-G-T 10118224-G-T **
9963296-T-G 10125687-T-G **
9983082-C-A 10145473-C-A **
9986798-C-T 10149189-C-T **
9988103-C-A 10150494-C-A **
9991865-C-G 10154256-C-G **
9991895-A-T 10154286-A-T **
9991897-C-T 10154288-C-T **
9991899-CA-C 10154290-CA-C **
10018402-G-C 10180793-G-C **
10018408-G-T 10180799-G-T **
10037992-C-A 10200383-C-A ZS7988 **
10653838-C-A **
7422140-C-A 7554099-C-A **
9461858-T-G 9624249-T-G **
7285180-GGAGGCTGAGATGAGAGAATCAACTGAGGCCCCAGAGGTT-G 7417139-GGAGGCTGAGATGAGAGAATCAACTGAGGCCCCAGAGGTT-G **
7135523-C-A 7267482-C-A **
6730359-T-C 6862318-T-C **
7105126-T-C 7237085-T-C **
7107685-G-T 7239644-G-T **
6869521-A-G 7001480-A-G **
6869516-T-C 7001475-T-C **
6869488-A-G 7001447-A-G **
7115527-G-T 7247486-G-T **
6865337-A-G 6997296-A-G **
7115538-A-G 7247497-A-G **
6835638-C-A 6967597-C-A **
7135119-C-T 7267078-C-T **
6807828-C-CCAA 6939787-C-CCAA **
6730364-A-C 6862323-A-C **
7105121-G-A 7237080-G-A Y61547 **
7139762-C-A 7271721-C-A **
7146840-G-T 7278799-G-T **
6807824-CTTG-C 6939783-CTTG-C **
6807801-A-G 6939760-A-G **
6798791-G-C 6930750-G-C **
7149341-C-T 7281300-C-T **
7149442-C-T 7281401-C-T **
6795460-T-C 6927419-T-C **
6793658-T-C 6925617-T-C **
7035187-C-A 7167146-C-A **
6793649-G-T 6925608-G-T **
6793647-T-C 6925606-T-C **
6869522-T-C 7001481-T-C **
7105118-T-C 7237077-T-C **
6784420-G-C 6916379-G-C **
6981047-A-G 7113006-A-G **
7044966-G-T 7176925-G-T **
7062573-T-C 7194532-T-C **
7062882-A-C 7194841-A-C **
7065278-C-A 7197237-C-A **
7073394-C-A 7205353-C-A **
7028050-C-A 7160009-C-A **
7011562-A-G 7143521-A-G Y83136 **
7076130-T-C 7208089-T-C **
7079188-T-C 7211147-T-C **
7079197-G-A 7211156-G-A **
6983779-G-A 7115738-G-A **
6981062-G-A 7113021-G-A **
6955241-G-T 7087200-G-T **
6869529-A-G 7001488-A-G **
6945949-T-A 7077908-T-A **
7091417-AT-A 7223376-AT-A **
6923247-C-G 7055206-C-G **
6915926-G-A 7047885-G-A **
6915260-T-A 7047219-T-A **
6913735-G-T 7045694-G-T **
6700798-G-T 6832757-G-T **
7094282-TC-T 7226241-TC-T **
6730350-T-C 6862309-T-C **
6892613-A-G 7024572-A-G **
7094290-C-T 7226249-C-T **
6869537-G-A 7001496-G-A **
7094301-A-T 7226260-A-T **
6784594-C-G 6916553-C-G **
7035796-T-C 7167755-T-C **
7163106-C-A 7295065-C-A **
7220546-C-A 7352505-C-A **
7199347-T-G 7331306-T-G **
6770936-T-G 6902895-T-G **
6757135-CA-C 6889094-CA-C **
6755725-T-C 6887684-T-C **
7199352-T-G 7331311-T-G **
7199357-T-G 7331316-T-G **
7199362-T-G 7331321-T-G **
7206786-C-A 7338745-C-A **
7214506-C-T 7346465-C-T **
6748029-C-A 6879988-C-A **
6741461-AT-A 6873420-AT-A **
7190504-C-A 7322463-C-A **
6741439-T-C 6873398-T-C **
7222019-C-CTACAAG 7353978-C-CTACAAG **
7222024-CATGTAT-C 7353983-CATGTAT-C **
7222043-A-G 7354002-A-G **
7222053-T-TGTA 7354012-T-TGTA **
7229056-C-A 7361015-C-A **
7248711-C-A 7380670-C-A **
7249332-G-A 7381291-G-A **
7258601-CAA-C 7390560-CAA-C **
7281668-C-A 7413627-C-A **
6775870-C-A 6907829-C-A **
7206758-G-A 7338717-G-A **
7171873-C-A 7303832-C-A **
7183526-C-A 7315485-C-A **
7170833-G-A 7302792-G-A **
7177000-T-G 7308959-T-G **
58832268-A-C 56758603-T-G ***
24297176-ACT-A 22151029-ACT-A P3_t1 ***
22255340-T-A 20093454-T-A DYZ19 ***
13865852-A-T 11745146-A-T ***
23280330-C-A 21118444-C-A ***
28793163-T-G 26647016-T-G ***
13867285-A-C 11746579-A-C ***
22122380-C-A 19960494-C-A ***
13936102-G-A 11815396-G-A ***
24214037-C-T 22067890-C-T P3_b1 ***
22491076-G-T 20329190-G-T DYZ19 ***
22286917-T-C 20125031-T-C DYZ19 ***
22298424-A-T 20136538-A-T DYZ19 ***
22450814-G-T 20288928-G-T DYZ19 ***
13870050-G-C 11749344-G-C ***
58842178-T-C 56748693-A-G ***
13865767-A-G 11745061-A-G ***
13865296-C-G 11744590-C-G ***
13864696-C-G 11743990-C-G ***
58974250-C-T 56828103-C-T ***
58974000-C-G 56827853-C-G ***
25931592-G-GAAGAAAGA,GAAGGAAGA 23785445-G-GAAGAAAGA,GAAGGAAGA P1_Y1 14×AAGA***
58908852-T-A 56682019-A-T ***
23380417-A-AGG 21218531-A-AGG ***
25159147-C-T 23013000-C-T g1 ***
24822774-TG-T 22676627-TG-T P3_b2 ***
58908850-C-G 56682021-G-C ***
58908836-A-T 56682035-T-A ***
58908834-C-G 56682037-G-C ***
23350800-C-T 21188914-C-T ***
58856688-A-T 56734183-T-A ***
24974237-C-T 22828090-C-T g1 ***
58827238-G-T 56763633-C-A ***
22325221-A-T 20163335-A-T DYZ19 ***
22430742-A-C 20268856-A-C DYZ19 ***
23067500-CT-C 20905614-CT-C ***
19979897-C-G 17868017-C-G P5_Prx ***
58821223-G-T 56769648-C-A ***
15001557-G-T 12889642-G-T ***
58820112-A-C 56770759-T-G ***
19036743-TAA-T 16924863-TAA-T ***
23067475-C-T 20905589-C-T ***
23067496-G-A 20905610-G-A ***
58821238-G-T 56769633-C-A ***
28789523-G-A 26643376-G-A ***
23067488-AT-A 20905602-AT-A ***
23067480-T-C 20905594-T-C ***
22580235-AT-A 20418349-AT-A ***
22587661-C-A 20425775-C-A ***
58820086-G-T 56770785-C-A ***
22619231-T-C 20457345-T-C ***
15208075-A-G 13096161-A-G ***
23067476-A-T 20905590-A-T ***
58821972-G-C 56768899-C-G ***
58827234-T-C 56763637-A-G ***
58827219-T-C 56763652-A-G ***
22325220-A-G 20163334-A-G DYZ19 ***
58825641-G-A 56765230-C-T ***
23234068-AT-A 21072182-AT-A ***
58823115-G-T 56767756-C-A ***
15831559-C-T 13719679-C-T ***
28784660-G-GATTGT 26638513-G-GATTGT ***
22295445-C-A 20133559-C-A DYZ19 ***
23189379-T-C 21027493-T-C ***
28160822-CTTT-C 26014675-CTTT-C P1_b4 22×T***
16107442-G-GT 13995562-G-GT P8_Prx 30×T***
26136779-G-C 23990632-G-C P1_Y1 ***
22295425-AGAAT-A 20133539-AGAAT-A DYZ19 ***
22259302-C-T 20097416-C-T DYZ19 ***
13846528-T-C 11725822-T-C ***
13864689-G-T 11743983-G-T ***
13658690-G-T 11503014-G-T ***
13647481-G-T 11491805-G-T ***
13647522-G-A 11491846-G-A ***
13647530-T-A 11491854-T-A ***
13647531-C-T 11491855-C-T ***
13647535-T-G 11491859-T-G ***
13649711-T-G 11494035-T-G ***
13653861-T-G 11498185-T-G ***
28701439-G-A 26555292-G-A ***
13653891-G-C 11498215-G-C ***
13658655-A-T 11502979-A-T ***
13658667-C-G 11502991-C-G Y136414 ***
13659361-C-CGAGTG 11503685-C-CGAGTG ***
13647467-A-G 11491791-A-G ***
13659384-A-T 11503708-A-T ***
13659471-C-T 11503795-C-T ***
13661130-G-T 11505454-G-T ***
13661134-A-T 11505458-A-T ***
13661280-C-G 11505604-C-G ***
13664393-G-C 11508717-G-C ***
13668011-T-G 11512335-T-G ***
13682477-T-G 11526801-T-G ***
13682483-G-A 11526807-G-A ***
13682504-G-A 11526828-G-A ***
13684854-ATGGAG-A 11529178-ATGGAG-A ***
13647470-A-T 11491794-A-T ***
13463767-G-T 11308091-G-T ***
13685707-C-T 11530031-C-T ***
13813450-T-A 11692744-T-A ***
16047-G-T ***
13832997-G-A 11712291-G-A ***
56887133-GTTGTTGT-G,GTTGTTGTTG ***
56881186-C-A ***
13833002-G-A 11712296-G-A ***
56861089-G-A,GGACAAGTTCAAAAATTAACCATATAGACG ***
13857545-G-T 11736839-G-T ***
13653039-T-A 11497363-T-A ***
13839376-G-C 11718670-G-C ***
13839378-G-C 11718672-G-C ***
13838111-C-G 11717405-C-G ***
13813451-C-A 11692745-C-A ***
13459680-C-G 11304004-C-G ***
13142043-C-T 10631529-C-T ***
15138232-A-G 13026319-A-G ***
6753291-G-C 6885250-G-C L669 ***
10019452-GA-G 10181843-GA-G ***
10060306-A-G 10222697-A-G ***
13137702-C-T 10627188-C-T ***
13137712-G-C 10627198-G-C ***
13137779-A-T 10627265-A-T ***
13141190-T-TTCCAA 10630676-T-TTCCAA ***
13454172-G-T 11298496-G-T ***
13455701-G-A 11300025-G-A ***
28773215-TC-T 26627068-TC-T ***
13685691-C-A 11530015-C-A ***
13686131-T-A 11530455-T-A ***
13864680-A-G 11743974-A-G BY19019 ***
58974256-C-T 56828109-C-T ***
23986481-G-T 21840334-G-T ***
13830033-A-T 11709327-A-T ***
13832033-C-A 11711327-C-A ***
13833166-G-C 11712460-G-C ***
13833832-G-C 11713126-G-C ***
13833899-A-G 11713193-A-G ***
13838745-A-C,G 11718039-A-C,G ***
13839875-A-G,T 11719169-A-G,T ***
13841480-G-C 11720774-G-C ***
13846518-C-CGAAAT 11725812-C-CGAAAT ***
13846519-A-C 11725813-A-C ***
13846534-G-A 11725828-G-A ***
13829997-T-A 11709291-T-A ***
13848935-TAGAAAGGAAC-T 11728229-TAGAAAGGAAC-T ***
13849027-C-A 11728321-C-A ***
13849036-A-G 11728330-A-G ***
13849302-C-G 11728596-C-G ***
13856653-G-A 11735947-G-A ***
13856763-T-A 11736057-T-A ***
13856773-T-A,C 11736067-T-A,C ***
13857537-AATCAG-C,CATCAG 11736831-AATCAG-C,CATCAG ***
13857550-G-A 11736844-G-A ***
13863242-A-T 11742536-A-T ***
13864675-C-G 11743969-C-G ***
13830018-C-T 11709312-C-T ***
13823219-A-AATGGG 11702513-A-AATGGG 9×ATGGG***
13686137-T-C 11530461-T-C ***
13806632-C-G 11685926-C-G ***
13686155-A-T 11530479-A-T ***
13686163-A-G 11530487-A-G F18218 ***
13686193-C-A 11530517-C-A ***
13734783-T-A,C 11579107-T-A,C ***
13799180-A-G 11678474-A-G ***
13799184-T-A 11678478-T-A ***
13801128-G-A 11680422-G-A ***
13801201-A-T 11680495-A-T ***
13805314-A-G 11684608-A-G ***
13805332-A-G,T 11684626-A-G,T ***
13805365-A-C,T 11684659-A-C,T ***
15111752-C-A 12999839-C-A ***
13823151-T-G 11702445-T-G ***
13808155-C-G 11687449-C-G ***
13808650-C-G 11687944-C-G ***
13813407-A-C 11692701-A-C ***
13813412-C-T 11692706-C-T ***
13813487-G-T 11692781-G-T ***
13816872-C-T 11696166-C-T ***
13816885-T-A 11696179-T-A ***
13817191-T-C 11696485-T-C ***
13817992-GGCAATGAATA-G,GGACTGGAATG 11697286-GGCAATGAATA-G,GGACTGGAATG ***
13823138-AAAAGG-C 11702432-AAAAGG-C ***
24394534-C-A 22248387-C-A ***
13823146-T-A 11702440-T-A ***
58974251-C-G 56828104-C-G ***
6780866-G-T 6912825-G-T ***
58977202-T-G 56831055-T-G ***
11663331-C-G ***
8342801-C-T 8474760-C-T ***
8337254-G-T 8469213-G-T ***
11657732-C-A ***
18100656-C-A 15988776-C-A ***
18093258-C-A 15981378-C-A ***
8258179-G-A 8390138-G-A ***
11663330-T-C ***
10764491-ATCCATTCCAT-A ***
7000380-C-A 7132339-C-A ***
8382102-C-A 8514061-C-A ***
11663337-G-C ***
11663341-A-G ***
11663344-ATCAAG-A ***
11663358-C-A ***
10686925-T-C ***
11663361-C-G ***
8254982-T-C 8386941-T-C ***
8250835-C-A 8382794-C-A ***
16761307-C-A 14649427-C-A ***
2970336-GGTGTGT-G,GGT 3102295-GGTGTGT-G,GGT 18×GT***
18195182-TTG-T 16083302-TTG-T ***
8246461-C-T 8378420-C-T ***
8768395-A-C 8900354-A-C ***
13474372-A-G 11318696-A-G ***
11011462-A-G ***
10850823-A-T ***
9123546-T-C ***
14688834-C-A 12576900-C-A ***
18650447-T-A 16538567-T-A ***
13489514-C-A 11333838-C-A ***
18627864-C-T 16515984-C-T ***
13504984-C-A 11349308-C-A ***
8735112-C-A 8867071-C-A ***
6716407-C-A 6848366-C-A ***
15288156-C-T 13176255-C-T ***
15288157-A-G 13176256-A-G ***
15288161-T-C 13176260-T-C ***
18423026-C-A 16311146-C-A P6_Gap ***
15288162-G-A 13176261-G-A ***
8663599-C-T 8795558-C-T ***
18258832-C-A 16146952-C-A ***
18256112-G-A 16144232-G-A ***
14515530-CAAA-C 12403731-CAAA-C 13×A***
17736453-T-G 15624573-T-G ***
2901464-C-A 3033423-C-A ***
9126627-A-C ***
16776951-C-A 14665071-C-A ***
14190305-C-A 12069599-C-A ***
7927223-C-A 8059182-C-A ***
2687009-C-A 2818968-C-A ***
7772197-T-C 7904156-T-C ***
13926835-C-A 11806129-C-A ***
13817952-C-T 11697246-C-T ***
16720569-CT-C 14608689-CT-C ***
8146212-C-A 8278171-C-A ***
7633694-G-A 7765653-G-A ***
7218655-C-T 7350614-C-T ***
14281814-G-A 12161108-G-A ***
14301782-CAAAG-C 12181076-CAAAG-C ***
14390445-C-A 12269741-C-A ***
14302932-G-A 12182226-G-A ***
7531193-C-A 7663152-C-A ***
14356121-C-A 12235416-C-A ***
7270086-G-T 7402045-G-T ***
16927892-T-C 14816012-T-C ***
16909427-A-C 14797547-A-C ***
7928099-G-T 8060058-G-T ***
17203265-A-G 15091385-A-G ***
13856388-G-T 11735682-G-T ***
14029886-A-G 11909180-A-G ***
17701498-G-C 15589618-G-C ***
17685601-C-T 15573721-C-T ***
13856522-G-A 11735816-G-A ***
17633348-C-A 15521468-C-A ***
14476040-C-A 12355309-C-A ***
16369237-T-C 14257357-T-C ***
7172274-C-T 7304233-C-T ***
8122470-T-C 8254429-T-C ***
14005750-T-C 11885044-T-C ***
14443531-C-A 12322804-C-A ***
14103873-C-A 11983167-C-A ***
14435929-C-A 12315202-C-A ***
17341481-C-A 15229601-C-A ***
8078693-G-A 8210652-G-A ***
18256114-T-C 16144234-T-C ***
14432470-C-A 12311743-C-A ***
13194623-A-T 11038947-A-T ***
14090764-A-G 11970058-A-G ***
19475030-C-A 17363150-C-A ***
21717785-C-A 19555899-C-A ***
9126059-C-A ***
18771239-A-C 16659359-A-C ***
58977228-C-G 56831081-C-G ***
21224881-C-A 19062995-C-A ***
13801084-G-A,T 11680378-G-A,T ***
21305862-C-A 19143976-C-A ***
13813542-T-A,G 11692836-T-A,G ***
13854432-T-A,G 11733726-T-A,G ***
21238883-C-A 19076997-C-A ***
19948181-C-CCCTCCCTCCTTTCTTT,T 17836301-C-CCCTCCCTCCTTTCTTT,T P5_Prx 21×CTTT***
58829425-C-A,G 56761446-G-C,T ***
21224884-C-G 19062998-C-G ***
21224862-G-C 19062976-G-C ***
6133794-C-A 6265753-C-A ***
7324790-C-A 7456749-C-A ***
15278704-C-A 13166793-C-A ***
14322135-A-G 12201429-A-G ***
9906481-C-T 10068872-C-T ***
18549264-C-T 16437384-C-T ***
6784734-C-A 6916693-C-A ***
10677473-TC-T ***
10677474-C-T ***
13832994-A-T 11712288-A-T ***
13463768-G-C,T 11308092-G-C,T ***
28784604-C-T 26638457-C-T FGC471 Z6899 ***
10669402-T-TC ***
21713345-A-G 19551459-A-G ***
58977236-C-A 56831089-C-A ***
58977239-C-T 56831092-C-T ***
58977249-C-A 56831102-C-A ***
58978136-T-A 56831989-T-A ***
58980455-T-C 56834308-T-C ***
58980557-C-T 56834410-C-T ***
27150720-AT-A,ATT 25004573-AT-A,ATT P1_g3 12×T***
8398840-CAAAAAAA-C 8530799-CAAAAAAA-C 17×A***
13817945-G-GTGGACACGAATGGAATGGACTGGAGTGGAA 11697239-G-GTGGACACGAATGGAATGGACTGGAGTGGAA ***
21703793-C-T 19541907-C-T ***
15248952-A-G 13137038-A-G ***
15242462-C-T 13130548-C-T ***
10800491-A-C ***
10800485-T-G ***
5059739-G-C 5191698-G-C ***
21532755-C-A 19370869-C-A ***
10781729-T-A ***
21483485-C-A 19321599-C-A ***
10850820-C-T ***
10850822-C-T ***
21138735-AAAAC-A 18976849-AAAAC-A ***
10669397-T-C ***
18771241-G-T 16659361-G-T ***
17170214-A-C 15058334-A-C ***
14811152-T-C 12699223-T-C ***
7033240-CAA-C,CAAA 7165199-CAA-C,CAAA 15×A***
19123690-T-C 17011810-T-C ***
15739150-T-C 13627270-T-C ***
7036198-C-A 7168157-C-A ***
4069720-T-C 4201679-T-C ***
13236424-T-C 11080748-T-C ***
7075983-C-A 7207942-C-A ***
9096057-T-C 9258448-T-C ***
15863331-A-G 13751451-A-G ***
6994500-C-A 7126459-C-A ***
15865918-C-A 13754038-C-A ***
15881839-C-A 13769959-C-A ***
7087819-A-G 7219778-A-G ***
13462245-C-A 11306569-C-A ***
13194631-C-A 11038955-C-A ***
13473580-T-C 11317904-T-C ***
9028333-C-T 9190724-C-T ***
18775087-C-A 16663207-C-A ***
18771243-G-A 16659363-G-A ***
6177481-TTGTG-T,TTG 6309440-TTGTG-T,TTG IR3_Dst 23×TG***
9778830-T-A 9941221-T-A ***
15248954-T-G 13137040-T-G ***
5180610-A-G 5312569-A-G ***
15248968-G-A 13137054-G-A ***
5449803-A-G 5581762-A-G ***
10668357-T-A,C ***
21069660-C-T 18907774-C-T ***
21069656-T-C 18907770-T-C ***
21069654-A-G 18907768-A-G ***
20809989-G-A 18648103-G-A P4_Gap ***
5367946-G-T 5499905-G-T ***
10023791-TTCTCTCCATCTCTGTCTCTGTC-T 10186182-TTCTCTCCATCTCTGTCTCTGTC-T ***
16308952-A-G 14197072-A-G ***
14849100-G-T 12737166-G-T ***
16308955-A-C 14197075-A-C ***
10938618-C-A ***
15489427-G-A 13377547-G-A ***
10877901-C-G ***
10877904-A-T ***
19516436-A-G 17404556-A-G ***
19505767-C-A 17393887-C-A ***
9927207-A-T 10089598-A-T ***
10988566-A-CTTCCG ***
16048-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page