Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z272 > BY907 > Y14050

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
266234
BigY2
266234
Manual
Edits
22308806-G-T 20146920-G-T DYZ19 ***A*
26079683-C-T 23933536-C-T P1_Y1 ***A*
24279076-G-C 22132929-G-C P3_t1 ***A*
19612728-C-G 17500848-C-G P5_Prx Y***A*
22910000-G-A 20748114-G-A Y58455 YY++
17685281-G-T 15573401-G-T Y53576 YY++
18628582-G-C 16516702-G-C Y54689 YY++
18748291-G-A 16636411-G-A YY++
18977934-G-A 16866054-G-A Y55150 YY++
19533862-T-A 17421982-T-A Y56030 YY++
21431969-A-G 19270083-A-G Y56679 YY++
21897041-A-C 19735155-A-C Y57361 YY++
22109829-G-T 19947943-G-T Y57641 YY++
22472231-A-C 20310345-A-C DYZ19 +
22271919-G-T 20110033-G-T DYZ19 ++
17336606-G-A 15224726-G-A Y53101 YY++
22484689-C-T 20322803-C-T DYZ19 +**
22686737-C-T 20524851-C-T Y58147 YY++
22827129-C-G 20665243-C-G Y58348 YY++
23112018-T-C 20950132-T-C Y58734 YY++
23982657-G-C 21836510-G-C Y59659 BY34208 Y++
4136809-G-T 4268768-G-T +
24433812-T-A 22287665-T-A Y59810 Y++
28799895-CTGGAATGGAA-C 26653748-CTGGAATGGAA-C 5×TGGAA+*
17365568-C-G 15253688-C-G Y53166 YY++
21558922-G-A 19397036-G-A Y56895 YY++
16968067-G-T 14856187-G-T Y52611 YY++
8743427-C-G 8875386-C-G Y47814 YY++
19000-C-T +
28803735-A-G 26657588-A-G ***+
16289708-G-A 14177828-G-A Y51661 YY++
6766275-T-C 6898234-T-C Y45269 YY++
7691277-G-A 7823236-G-A Y46274 YY++
8000644-T-G 8132603-T-G Y46711 YY++
8661524-G-C 8793483-G-C Y47708 Y**+
8662133-G-A 8794092-G-A Y47709 YY++
6397699-A-G 6529658-A-G ++
15404068-C-T 13292188-C-T Y50600 YY++
9494949-A-G 9657340-A-G ++
13137770-A-T 10627256-A-T **+
13655330-T-C 11499654-T-C ++
14009674-A-T 11888968-A-T Y48865 YY++
14264020-G-C 12143314-G-C Y49261 YY++
22319958-T-C 20158072-T-C DYZ19 ****
22422584-G-T 20260698-G-T DYZ19 ****
14719642-G-T 12607710-G-T **
14347882-C-T 12227177-C-T **
11672425-A-G **
14373771-C-A 12253067-C-A **
14408709-C-A 12288007-C-A **
14540523-T-A 12428724-T-A **
14284019-C-A 12163313-C-A **
14558283-TTC-T 12446484-TTC-T **
14608152-T-G 12496354-T-G **
14716606-A-C 12604674-A-C **
14719634-G-C 12607702-G-C **
14300576-C-A 12179870-C-A **
13943190-C-A 11822484-C-A **
14228608-C-A 12107902-C-A **
14214946-T-C 12094240-T-C **
13803369-A-T 11682663-A-T **
13868790-C-A 11748084-C-A **
13890926-A-C 11770220-A-C **
13919912-C-A 11799206-C-A **
14076075-C-A 11955369-C-A **
13919973-C-T 11799267-C-T **
13920910-GC-G 11800204-GC-G **
14055751-T-C 11935045-T-C **
14025686-G-A 11904980-G-A **
14000448-T-A 11879742-T-A **
13958336-A-G 11837630-A-G **
14719635-G-T 12607703-G-T **
21463581-G-GT 19301695-G-GT 9×T**
14719713-C-T 12607781-C-T **
11660179-A-G **
16688218-C-A 14576338-C-A **
16342249-GA-G 14230369-GA-G **
16319380-A-G 14207500-A-G **
16278461-T-C 14166581-T-C **
16273433-G-T 14161553-G-T **
16079372-C-A 13967492-C-A **
16041119-T-C 13929239-T-C **
16040958-C-A 13929078-C-A **
16034429-C-A 13922549-C-A **
15975657-C-A 13863777-C-A **
15971689-C-A 13859809-C-A **
15906398-T-C 13794518-T-C **
15770477-GGTGAGCA-G 13658597-GGTGAGCA-G **
14879841-C-A 12767911-C-A **
15762052-C-A 13650172-C-A **
15762028-T-A 13650148-T-A **
15741575-G-T 13629695-G-T **
15730508-T-C 13618628-T-C **
15680073-C-A 13568193-C-A **
15632062-C-A 13520182-C-A **
15397891-G-A 13286011-G-A **
15280797-T-A 13168896-T-A **
15276533-C-G 13164622-C-G **
15111498-C-T 12999585-C-T **
15093588-CTTT-C 12981676-CTTT-C 11×T**
14909653-T-C 12797720-T-C **
14908501-T-G 12796568-T-G **
11669618-TGGAATTGAATGGAAA-T **
10969921-T-C **
11660121-G-A **
10769707-C-A **
10826501-A-G **
10809021-T-G **
10808571-C-T **
10807731-A-G **
10807538-T-A **
10807506-GTTCCA-G **
10801637-CATTCCATTCG-C **
10794587-T-A **
10790286-T-A **
10790261-C-A **
10776453-A-T **
10776130-CGCTCCACTCA-C **
10661259-T-G **
10859638-T-C **
10049259-C-G 10211650-C-G **
10031871-C-A 10194262-C-A **
10028441-A-T 10190832-A-T **
9984232-C-A 10146623-C-A **
9937157-A-G 10099548-A-G **
9899538-C-A 10061929-C-A **
9799160-T-C 9961551-T-C **
9736893-C-A 9899284-C-A IR3_Prx **
9730569-G-T 9892960-G-T IR3_Prx **
9501150-AT-A 9663541-AT-A **
8981054-C-T 9143445-C-T **
8793007-C-A 8924966-C-A **
10828893-C-A **
10862435-C-T **
13586196-G-A 11430520-G-A **
13295242-T-C 11139566-T-C **
13571953-C-A 11416277-C-A **
13544367-C-A 11388691-C-A **
13522753-A-C 11367077-A-C **
13522735-A-T 11367059-A-T **
13522727-A-C 11367051-A-C **
13487853-G-A 11332177-G-A **
13468971-T-A 11313295-T-A **
13465429-T-C 11309753-T-C **
13446421-T-C 11290745-T-C **
13429972-A-G 11274296-A-G **
13417134-C-T 11261458-C-T **
13299006-C-A 11143330-C-A **
13289353-A-G 11133677-A-G **
10889851-A-T **
13244767-T-G 11089091-T-G **
13236743-A-G 11081067-A-G **
13226846-T-C 11071170-T-C **
11025692-A-C **
10997485-T-C **
10972157-T-C **
16710330-C-T 14598450-C-T **
10965381-C-G **
10938847-A-G **
10938637-T-C **
10912584-C-T **
10896222-T-A **
16701623-C-A 14589743-C-A **
18060335-T-C 15948455-T-C **
16847651-G-A 14735771-G-A **
22252455-G-A 20090569-G-A DYZ19 **
24353293-T-G 22207146-T-G P3_t1 **
23881822-G-C 21719936-G-C **
23264037-A-G 21102151-A-G **
23262803-C-A 21100917-C-A **
23142329-A-G 20980443-A-G **
22965132-C-A 20803246-C-A **
22836653-C-A 20674767-C-A **
22730575-C-A 20568689-C-A **
22696370-C-A 20534484-C-A **
22683601-A-C 20521715-A-C **
22337440-T-G 20175554-T-G DYZ19 **
22337438-C-A 20175552-C-A DYZ19 **
22203724-T-C 20041838-T-C **
24416960-G-T 22270813-G-T **
22175978-T-C 20014092-T-C **
22167210-C-T 20005324-C-T **
22132827-A-C 19970941-A-C **
22032621-A-T 19870735-A-T **
21840024-T-C 19678138-T-C **
21836259-A-T 19674373-A-T **
21473753-C-A 19311867-C-A **
21368350-A-G 19206464-A-G **
21325856-A-G 19163970-A-G **
21323670-A-T 19161784-A-T **
21234837-TC-T 19072951-TC-T **
21207030-C-T 19045144-C-T **
24353303-C-CA 22207156-C-CA P3_t1 **
24459980-T-C 22313833-T-C **
21153887-C-T 18992001-C-T **
28632919-G-C 26486772-G-C **
56839062-C-A **
56834729-A-G **
56834726-T-A **
56834721-A-G **
28771607-C-T 26625460-C-T **
28761435-C-T 26615288-C-T **
28755836-A-C 26609689-A-C **
28732983-C-T 26586836-C-T **
28657488-A-C 26511341-A-C **
28657485-A-C 26511338-A-C **
28657477-G-C 26511330-G-C **
28640194-C-A 26494047-C-A **
28560849-T-C 26414702-T-C **
24511227-T-C 22365080-T-C **
28560746-A-C 26414599-A-C **
28536114-A-G 26389967-A-G **
28510393-C-A 26364246-C-A **
27842127-G-T 25695980-G-T P1_Y2 **
27552565-T-C 25406418-T-C P1_Y2 **
26242576-C-A 24096429-C-A P1_Y1 **
26101703-A-G 23955556-A-G P1_Y1 **
25955816-C-T 23809669-C-T P1_Y1 **
25939849-T-C 23793702-T-C P1_Y1 **
25029911-T-C 22883764-T-C g1 **
24759265-G-T 22613118-G-T P3_b2 **
24564550-G-T 22418403-G-T P3_t2 **
21162488-G-A 19000602-G-A **
21147945-G-A 18986059-G-A **
16860729-C-A 14748849-C-A **
17464820-G-C 15352940-G-C **
18670187-T-C 16558307-T-C **
18653521-T-A 16541641-T-A **
18427794-CT-C 16315914-CT-C P6_Dst **
18427771-G-T 16315891-G-T P6_Dst **
18194162-A-G 16082282-A-G **
8296905-G-C 8428864-G-C **
17978401-C-A 15866521-C-A **
17798966-A-G 15687086-A-G **
17712702-G-T 15600822-G-T Y53619 **
17687946-C-A 15576066-C-A **
17672074-C-A 15560194-C-A **
17597906-T-G 15486026-T-G **
17428395-T-C 15316515-T-C **
18670200-T-G 16558320-T-G **
17428387-A-T 15316507-A-T **
17385388-T-C 15273508-T-C **
17385387-T-C 15273507-T-C **
17385381-C-G 15273501-C-G **
17385332-C-T 15273452-C-T **
17203284-C-A 15091404-C-A **
17193149-T-C 15081269-T-C **
17183317-T-C 15071437-T-C **
17169850-G-A 15057970-G-A **
17142181-A-G 15030301-A-G **
17126035-TATGTGAAAAG-T 15014155-TATGTGAAAAG-T **
17042876-T-C 14930996-T-C **
18670190-G-A 16558310-G-A **
18707819-G-C 16595939-G-C **
21141000-A-G 18979114-A-G **
19379616-T-A 17267736-T-A **
21092244-T-G 18930358-T-G **
21042850-A-G 18880964-A-G **
21029222-T-G 18867336-T-G P4_Dst **
20950537-C-A 18788651-C-A P4_Dst **
20842601-TGGAATA-T 18680715-TGGAATA-T P4_Dst **
20741872-C-T 18579986-C-T P4_Prx **
20741799-G-T 18579913-G-T P4_Prx **
19547505-A-G 17435625-A-G **
19505442-T-A 17393562-T-A **
19465906-C-A 17354026-C-A **
19463760-G-T 17351880-G-T **
19407575-C-G 17295695-C-G **
19338256-A-G 17226376-A-G **
18707850-A-C 16595970-A-C **
19299352-T-C 17187472-T-C **
19280758-C-G 17168878-C-G **
19161927-C-T 17050047-C-T Y55472 **
19081368-T-C 16969488-T-C **
19075192-C-A 16963312-C-A **
19075181-A-T 16963301-A-T **
19075178-A-G 16963298-A-G **
19075177-C-A 16963297-C-A **
18901129-C-T 16789249-C-T **
18864665-G-A 16752785-G-A **
18848745-T-C 16736865-T-C **
18711417-A-T 16599537-A-T **
8321710-C-A 8453669-C-A **
7723693-G-A 7855652-G-A **
8160169-A-C 8292128-A-C **
3987199-T-C 4119158-T-C **
17385369-A-C 15273489-A-C **
17385368-G-C 15273488-G-C **
17385358-A-ATC 15273478-A-ATC **
17385348-TG-T 15273468-TG-T **
28715015-C-A 26568868-C-A **
21464536-C-CAA 19302650-C-CAA 19×A**
7645507-C-A 7777466-C-A **
17038393-C-A 14926513-C-A **
18780365-C-A 16668485-C-A **
14328329-C-A 12207623-C-A **
10686614-T-C **
10882076-A-C **
18915389-C-A 16803509-C-A **
8842367-C-A 8974326-C-A **
15899023-C-A 13787143-C-A **
15793434-C-A 13681554-C-A **
16319343-C-A 14207463-C-A **
28375930-T-G 26229783-T-G P1_gr2 **
10892668-G-T **
17951735-C-A 15839855-C-A **
28632914-C-T 26486767-C-T **
13254531-A-G 11098855-A-G **
16278476-C-A 14166596-C-A **
17385382-T-C 15273502-T-C **
10781615-C-A **
28726645-A-G 26580498-A-G **
8269796-G-C 8401755-G-C **
4634558-C-CAA 4766517-C-CAA 28×A**
22173473-C-A 20011587-C-A **
21905312-C-A 19743426-C-A **
10990981-T-A **
7141826-C-A 7273785-C-A **
15379965-G-T 13268085-G-T **
15798272-C-A 13686392-C-A **
6732585-C-A 6864544-C-A **
11645303-C-A **
17382459-C-A 15270579-C-A **
23449124-C-A 21287238-C-A **
18730453-C-A 16618573-C-A **
10790276-T-C **
24513604-C-A 22367457-C-A **
13447202-C-A 11291526-C-A **
8138120-T-C 8270079-T-C **
13226892-C-A 11071216-C-A **
18768600-C-A 16656720-C-A **
17372102-C-A 15260222-C-A **
5172319-C-A 5304278-C-A **
22198874-C-A 20036988-C-A **
10672133-C-CCAGTA **
13477812-C-A 11322136-C-A **
24363706-C-A 22217559-C-A **
19505229-C-A 17393349-C-A **
10840928-G-T **
4665844-C-A 4797803-C-A **
16245278-C-A 14133398-C-A **
14059312-C-A 11938606-C-A **
16640346-C-A 14528466-C-A **
18756206-C-A 16644326-C-A **
7364367-GTTTTT-G 7496326-GTTTTT-G 27×T**
56850816-C-A **
14284688-C-A 12163982-C-A **
7169893-C-A 7301852-C-A **
17277286-C-A 15165406-C-A **
3651351-G-T 3783310-G-T **
13460983-C-A 11305307-C-A **
13480403-T-A 11324727-T-A **
7664257-C-A 7796216-C-A **
5409678-C-A 5541637-C-A **
17028963-T-A 14917083-T-A **
10969951-T-C **
14778837-C-A 12666907-C-A **
10926660-T-TCCCAC **
13829207-T-A 11708501-T-A **
28761382-CAA-C 26615235-CAA-C 31×A**
9956364-TAAAA-T 10118755-TAAAA-T 16×A**
27035179-C-G 24889032-C-G P1_r4 **
22468216-A-C 20306330-A-C DYZ19 ****
24013790-G-T 21867643-G-T **
14721585-C-A 12609653-C-A **
19417451-C-A 17305571-C-A **
6012850-C-A 6144809-C-A **
17367715-C-A 15255835-C-A **
13611231-C-T 11455555-C-T **
4930554-C-A 5062513-C-A **
14502615-C-A 12390820-C-A **
9730517-G-T 9892908-G-T IR3_Prx **
22592064-T-C 20430178-T-C **
10783606-C-A **
10672141-C-T **
22325285-C-A 20163399-C-A DYZ19 **
19112435-C-A 17000555-C-A **
13224745-C-A 11069069-C-A **
15496914-C-A 13385034-C-A **
19231369-A-C 17119489-A-C **
28714373-C-A 26568226-C-A **
15355249-C-A 13243368-C-A **
17369271-C-A 15257391-C-A **
14880307-C-A 12768377-C-A **
19138730-C-A 17026850-C-A **
3011665-C-A 3143624-C-A **
16688240-G-T 14576360-G-T **
10972062-C-A **
15178320-C-A 13066406-C-A **
17673020-C-A 15561140-C-A **
14007383-C-A 11886677-C-A **
8901058-C-A 9033017-C-A **
22965861-C-A 20803975-C-A **
10967509-A-T **
4928832-C-A 5060791-C-A **
15758565-C-A 13646685-C-A **
22876465-C-A 20714579-C-A **
22965163-C-A 20803277-C-A **
10988544-C-A **
6401420-A-T 6533379-A-T **
7063792-G-C 7195751-G-C **
6818954-G-T 6950913-G-T **
6791838-G-A 6923797-G-A **
6767777-A-G 6899736-A-G Z28230 **
6755970-C-A 6887929-C-A **
6730268-G-GT 6862227-G-GT **
6651529-C-A 6783488-C-A **
6516799-A-T 6648758-A-T **
6312795-T-C 6444754-T-C IR3_Dst **
7099125-T-C 7231084-T-C **
6205699-A-G 6337658-A-G IR3_Dst **
6133110-C-T 6265069-C-T **
5992460-C-A 6124419-C-A **
5911139-C-T 6043098-C-T **
5842583-T-C 5974542-T-C **
5829613-A-G 5961572-A-G **
5742794-G-GTC 5874753-G-GTC **
5620608-T-C 5752567-T-C **
5613746-G-T 5745705-G-T **
7094439-G-A 7226398-G-A **
7104862-C-A 7236821-C-A **
5500207-T-G 5632166-T-G **
7470603-T-C 7602562-T-C IR1_L **
8078848-GC-G 8210807-GC-G **
8007976-C-G 8139935-C-G **
7990155-T-C 8122114-T-C **
7939429-C-A 8071388-C-A **
7864183-C-A 7996142-C-A **
7861176-G-A 7993135-G-A **
7712202-A-G 7844161-A-G **
7708937-C-A 7840896-C-A **
7670770-C-A 7802729-C-A **
7437360-C-G 7569319-C-G **
7128330-G-A 7260289-G-A **
7390689-T-G 7522648-T-G **
7383985-C-T 7515944-C-T **
7374152-T-G 7506111-T-G **
7340987-A-T 7472946-A-T **
7340976-A-C 7472935-A-C **
7340971-T-C 7472930-T-C **
7282377-T-C 7414336-T-C **
7188385-G-A 7320344-G-A **
7185414-C-A 7317373-C-A **
5586077-A-G 5718036-A-G **
6772203-TC-T 6904162-TC-T **
5363651-C-A 5495610-C-A **
5242853-C-A 5374812-C-A **
3600921-G-T 3732880-G-T **
3561173-G-T 3693132-G-T **
3545939-C-A 3677898-C-A **
3033157-A-C 3165116-A-C **
2970798-C-A 3102757-C-A **
2832899-C-A 2964858-C-A **
2814952-C-A 2946911-C-A **
2773973-A-G 2905932-A-G **
2729827-G-A 2861786-G-A **
3951385-G-A 4083344-G-A **
2708310-C-A 2840269-C-A **
2649782-G-T 2781741-G-T **
10661257-C-A **
22056416-C-A 19894530-C-A **
5368291-G-T 5500250-G-T **
5606843-G-A 5738802-G-A **
28582029-C-A 26435882-C-A **
2701337-G-A 2833296-G-A **
20741878-C-T 18579992-C-T P4_Prx **
3889946-A-T 4021905-A-T **
2758347-A-G 2890306-A-G **
4138454-C-G 4270413-C-G **
4256973-G-T 4388932-G-T **
5219766-A-G 5351725-A-G **
4970034-C-A 5101993-C-A **
4930925-G-A 5062884-G-A **
4794331-A-G 4926290-A-G **
4779996-G-T 4911955-G-T **
4561565-G-C 4693524-G-C **
4540895-G-A 4672854-G-A **
4434131-AT-A 4566090-AT-A **
4325752-C-T 4457711-C-T **
4320624-A-G 4452583-A-G **
26634-T-A **
4171724-T-G 4303683-T-G **
4174635-C-A 4306594-C-A **
4229380-C-A 4361339-C-A **
25013628-T-C 22867481-T-C g1 ***
13521121-C-A 11365445-C-A ***
10831542-A-G ***
10911719-C-A ***
17840477-C-A 15728597-C-A ***
16813808-C-A 14701928-C-A ***
13836814-A-G 11716108-A-G ***
58978019-CCATTG-C,CCATTC 56831872-CCATTG-C,CCATTC ***
15619632-A-G 13507752-A-G ***
26945094-A-G 24798947-A-G P1_r3 ***
25266772-G-A 23120625-G-A P2_r1 ***
25030910-T-C 22884763-T-C g1 ***
25027103-G-A 22880956-G-A g1 ***
24817045-G-T 22670898-G-T P3_b2 ***
14379598-G-GATAC 12258894-G-GATAC ***
10999864-C-CATGGA ***
22258816-T-A 20096930-T-A FGC38552 DYZ19 ***
22237155-T-A 20075269-T-A DYZ19 ***
8589565-AACAC-A 8721524-AACAC-A 11×AC***
8344063-T-C 8476022-T-C ***
8774453-C-A 8906412-C-A ***
28783676-C-A 26637529-C-A ***
8906886-G-A 9038845-G-A ***
24204953-A-C 22058806-A-C P3_b1 ***
13710896-G-T 11555220-G-T ***
14379598-G-C,GATAC 12258894-G-C,GATAC ***
22237205-G-A 20075319-G-A DYZ19 ***
22248139-A-G 20086253-A-G DYZ19 ***
22339485-C-T 20177599-C-T DYZ19 ***
6765565-C-A 6897524-C-A ***
7816427-G-GAA 7948386-G-GAA 9×A***
7097015-G-T 7228974-G-T ***
3152292-T-A 3284251-T-A ***
16581423-C-A 14469543-C-A ***
3152225-C-G 3284184-C-G ***
10831539-T-C ***
14409073-T-C 12288370-T-C ***
7143582-C-A 7275541-C-A ***
4604862-C-A 4736821-C-A ***
56837008-CTGCACTCCACTCAAT-C,CTCCACTCCACTACACTCAAT ***
21389691-C-A 19227805-C-A ***
10892613-C-A ***
7246174-CA-C,CAAA 7378133-CA-C,CAAA 15×A***
28801673-A-G 26655526-A-G ***
21138606-G-T 18976720-G-T ***
16519303-CA-C 14407423-CA-C ***
13313078-C-A 11157402-C-A ***
2840099-CAAAA-C,CAAA 2972058-CAAAA-C,CAAA 20×A***
10789341-A-ATTTCC ***
6582514-A-T 6714473-A-T ***
22303497-T-A 20141611-T-A DYZ19 ***
21105514-A-ATT 18943628-A-ATT 13×T***
22425337-A-T 20263451-A-T DYZ19 ***
22489793-A-C 20327907-A-C DYZ19 ***
18914972-C-A 16803092-C-A ***
10770552-C-A ***
14753567-T-A 12641636-T-A ***
10666995-G-A,T ***
19505318-A-G 17393438-A-G ***
10050971-T-C 10213362-T-C ***
7504935-G-T 7636894-G-T IR1_L ***
6829005-C-A 6960964-C-A ***
23555010-C-A 21393124-C-A ***
23792042-TTTC-T 21630156-TTTC-T ***
7471542-C-A 7603501-C-A IR1_L ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page