Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > S568 > FGC440 > FGC458

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFGC
3B2TN
Manual
Edits
22246419-A-C 20084533-A-C FGC40248 DYZ19 +
19080222-A-T 16968342-A-T FGC40247 YY+
7687370-G-C 7819329-G-C FGC40244 YY+
7411026-A-T 7542985-A-T FGC40243 YY+
7367424-T-C 7499383-T-C FGC40242 YY+
15314206-A-G 13202311-A-G FGC40246 YY+
5343414-T-A 5475373-T-A FGC40241 +
25088440-A-G 22942293-A-G BY2330 A8722 g1 *
24387061-CTATA-C 22240914-CTATA-C **
8176544-G-T 8308503-G-T **
13201836-T-C 11046160-T-C **
26828342-G-T 24682195-G-T P1_g2 **
13201804-A-T 11046128-A-T **
22551284-T-C 20389398-T-C **
3634112-A-T 3766071-A-T **
21501074-C-T 19339188-C-T **
13201890-C-A 11046214-C-A **
13201794-G-A 11046118-G-A **
19127667-T-TACACAC 17015787-T-TACACAC 18×AC**
14100350-T-TGAACGTGCAGCGCGCAGCAGC 11979644-T-TGAACGTGCAGCGCGCAGCAGC **
26828316-A-T 24682169-A-T P1_g2 **
8278926-G-A 8410885-G-A **
15962961-C-T 13851081-C-T **
14736419-A-G 12624487-A-G **
15807481-A-G 13695601-A-G **
14129457-G-A 12008751-G-A **
8914172-C-CATT 9046131-C-CATT 13×ATT**
15098435-A-G 12986523-A-G **
16046631-TACAC-T 13934751-TACAC-T 17×AC**
5872259-T-A 6004218-T-A **
13445668-GAAA-G 11289992-GAAA-G 9×A**
26534747-A-C 24388600-A-C P1_g2 ***
26532508-A-C 24386361-A-C P1_g2 ***
25881007-G-A 23734860-G-A P1_Y1 ***
25996161-T-A 23850014-T-A P1_Y1 ***
26526016-C-A 24379869-C-A P1_Y1 ***
26525996-G-A 24379849-G-A P1_Y1 ***
26463716-G-T 24317569-G-T P1_Y1 ***
26004394-A-G 23858247-A-G P1_Y1 ***
26507372-G-A 24361225-G-A P1_Y1 ***
26463359-C-A 24317212-C-A P1_Y1 ***
26392241-C-T 24246094-C-T P1_Y1 ***
26385478-G-T 24239331-G-T P1_Y1 ***
26041214-C-A 23895067-C-A P1_Y1 ***
26043410-C-A 23897263-C-A P1_Y1 ***
26079676-C-A 23933529-C-A P1_Y1 ***
26079798-A-T 23933651-A-T P1_Y1 ***
26139681-C-G 23993534-C-G P1_Y1 ***
26229231-G-T 24083084-G-T P1_Y1 ***
26699988-T-G 24553841-T-G P1_g2 ***
26538040-G-T 24391893-G-T P1_g2 ***
26828353-T-C 24682206-T-C P1_g2 ***
27248234-T-C 25102087-T-C P1_g3 ***
27240814-G-A 25094667-G-A P1_g3 ***
27161489-C-A 25015342-C-A P1_g3 ***
27150816-G-T 25004669-G-T P1_g3 ***
27150801-G-T 25004654-G-T P1_g3 ***
27095966-C-T 24949819-C-T P1_r4 ***
27060177-T-A 24914030-T-A P1_r4 ***
27041320-T-G 24895173-T-G P1_r4 ***
27035480-C-T 24889333-C-T P1_r4 16×T***
26992893-C-T 24846746-C-T P1_r4 ***
26948651-C-T 24802504-C-T P1_r3 ***
26828331-C-T 24682184-C-T P1_g2 ***
26544076-C-A 24397929-C-A P1_g2 ***
26828302-C-A 24682155-C-A P1_g2 ***
26828103-T-C 24681956-T-C P1_g2 ***
26776632-A-C 24630485-A-C P1_g2 ***
26703131-T-G 24556984-T-G P1_g2 ***
26699997-A-G 24553850-A-G P1_g2 ***
25732078-A-C 23585931-A-C P1_b3 ***
26699985-G-C 24553838-G-C P1_g2 ***
26675808-A-T 24529661-A-T P1_g2 ***
26657448-C-A 24511301-C-A P1_g2 ***
26564201-G-T 24418054-G-T P1_g2 ***
26544125-A-G 24397978-A-G P1_g2 ***
25732195-C-A 23586048-C-A P1_b3 ***
25520416-A-G 23374269-A-G P1_gr1 ***
25728715-C-T 23582568-C-T P1_b3 ***
24283236-A-G 22137089-A-G P3_t1 ***
24661305-A-G 22515158-A-G P3_b2 ***
24661250-A-T 22515103-A-T P3_b2 ***
24652530-A-T 22506383-A-T P3_b2 ***
24635633-G-C 22489486-G-C P3_t2 ***
24619648-C-A 22473501-C-A P3_t2 ***
24599692-C-A 22453545-C-A P3_t2 ***
24595420-G-T 22449273-G-T P3_t2 ***
24588443-G-T 22442296-G-T P3_t2 ***
24562596-A-T 22416449-A-T P3_t2 ***
24550853-G-T 22404706-G-T P3_t2 ***
24547762-G-A 22401615-G-A P3_t2 ***
24326322-G-A 22180175-G-A P3_t1 ***
24283245-G-A 22137098-G-A P3_t1 ***
24232072-C-A 22085925-C-A P3_b1 ***
24695878-G-T 22549731-G-T P3_b2 ***
24208523-A-G 22062376-A-G P3_b1 ***
24182579-T-G 22036432-T-G P3_b1 ***
24175319-A-T 22029172-A-T P3_b1 ***
23723041-G-A 21561155-G-A ***
23569690-C-T 21407804-C-T ***
23519130-G-A 21357244-G-A ***
23519129-A-C 21357243-A-C ***
23519108-A-G 21357222-A-G ***
23519101-A-T 21357215-A-T ***
23519097-T-C 21357211-T-C ***
23519096-T-C 21357210-T-C ***
23017757-A-C 20855871-A-C ***
22955004-G-T 20793118-G-T ***
24662080-G-T 22515933-G-T P3_b2 ***
24727216-A-T 22581069-A-T P3_b2 ***
25723870-T-A 23577723-T-A P1_b3 ***
25182148-C-T 23036001-C-T g1 ***
25638704-A-T 23492557-A-T P1_b3 ***
25531565-T-A 23385418-T-A P1_gr1 ***
27409232-C-A 25263085-C-A P1_g3 ***
25520291-C-T 23374144-C-T P1_gr1 ***
25508909-C-A 23362762-C-A P1_gr1 ***
25465870-T-A 23319723-T-A P2_r2 ***
25444461-G-T 23298314-G-T P2_r2 ***
25360877-T-A 23214730-T-A P2_r2 ***
25357064-A-G 23210917-A-G P2_r2 ***
25311592-C-G 23165445-C-G P2_r1 ***
25308112-T-A 23161965-T-A P2_r1 ***
25287818-T-C 23141671-T-C P2_r1 ***
25256652-G-T 23110505-G-T P2_r1 ***
25173059-T-A 23026912-T-A g1 ***
24750639-A-T 22604492-A-T P3_b2 ***
25158308-A-G 23012161-A-G g1 ***
25023571-A-T 22877424-A-T g1 ***
24992277-G-T 22846130-G-T g1 ***
24951625-C-T 22805478-C-T g1 ***
24905837-T-C 22759690-T-C g1 ***
24905835-A-G 22759688-A-G g1 ***
24905602-C-A 22759455-C-A g1 ***
24862237-T-G 22716090-T-G P3_b2 ***
24862185-T-G 22716038-T-G P3_b2 ***
24862151-T-G 22716004-T-G P3_b2 ***
24862094-T-A 22715947-T-A P3_b2 ***
24766306-A-C 22620159-A-C P3_b2 ***
24759956-A-T 22613809-A-T P3_b2 ***
24759872-C-A 22613725-C-A P3_b2 ***
27407821-T-C 25261674-T-C P1_g3 ***
19753403-CT-C 17641523-CT-C P5_Prx 19×T***
27424439-C-A 25278292-C-A P1_g3 ***
13470462-AGCC-TGCA 11314786-AGCC-TGCA ***
19412008-G-GAAAT 17300128-G-GAAAT ***
17662050-GTGTT-G 15550170-GTGTT-G ***
17662050-GTG-T 15550170-GTG-T ***
16344414-T-TTCTTCC 14232534-T-TTCTTCC ***
16046662-ACACG-A 13934782-ACACG-A ***
14418162-A-ATTTG ***
13936208-G-GAAAA 11815502-G-GAAAA ***
13489074-GCT-ACC 11333398-GCT-ACC ***
13489066-TCCA-ACCC 11333390-TCCA-ACCC ***
13489043-GGATG-AGATT 11333367-GGATG-AGATT ***
13489029-TGC-CAT 11333353-TGC-CAT ***
13470534-GGG-TGC 11314858-GGG-TGC ***
13470444-TCTGCGT-CCTGTGG 11314768-TCTGCGT-CCTGTGG ***
20804883-GTG-A 18642997-GTG-A P4_Gap ***
13461095-GGGTG-AGGTT 11305419-GGGTG-AGGTT ***
13455956-CTCAAGTTGATTCAAGTCCATTCTATTCCATTCCATTCCATTACATTTCATTACATTCGTGTTGAT-C 11300280-CTCAAGTTGATTCAAGTCCATTCTATTCCATTCCATTCCATTACATTTCATTACATTCGTGTTGAT-C ***
13454823-A-ATTCCC 11299147-A-ATTCCC ***
13454818-A-ATTCCC 11299142-A-ATTCCC ***
13454813-A-ATTCCT 11299137-A-ATTCCT ***
13454810-T-TCCATA 11299134-T-TCCATA ***
13201890-CTAAGT-ATATGC 11046214-CTAAGT-ATATGC ***
10032344-G-GT 10194735-G-GT 12×T***
9429040-TTGCA-CTGCG 9591431-TTGCA-CTGCG ***
8631383-CTTTTTTT-C 8763342-CTTTTTTT-C 26×T***
8125021-A-AAAGG 8256980-A-AAAGG ***
6430439-TTA-T 6562398-TTA-T 19×TA***
6091743-TTTTTTG-T 6223702-TTTTTTG-T ***
20804857-ATGTG-A 18642971-ATGTG-A P4_Gap 14×TG***
20865357-C-CACAT 18703471-C-CACAT P4_Dst ***
2845819-CTCAAAA-C 2977778-CTCAAAA-C ***
23519129-AG-CA 21357243-AG-CA ***
58903417-CA-TC 56687453-TG-GA ***
58882513-CAGTC-TAGTA 56708354-GACTG-TACTA ***
58823277-CATTCCATCTC-A 56767584-GAGATGGAATG-T ***
28805151-GTGGAATGGAATGGAATGGAAAGGAATGGAATAGAATGGAGTGAAGTGCAGTGCAGTGAAATGGAGTGGAAAGGAATGGAATGGAATGGAATGGAATGGAA-G 26659004-GTGGAATGGAATGGAATGGAAAGGAATGGAATAGAATGGAGTGAAGTGCAGTGCAGTGAAATGGAGTGGAAAGGAATGGAATGGAATGGAATGGAATGGAA-G 4×TGGAA***
28209421-C-CT 26063274-C-CT P1_b4 23×T***
27810273-A-AAAGGAAGGAAGG 25664126-A-AAAGGAAGGAAGG P1_Y2 16×AAGG***
26828328-T-TCC 24682181-T-TCC P1_g2 ***
26828316-ACC-TCT 24682169-ACC-TCT P1_g2 ***
26828281-CTCTG-TTC 24682134-CTCTG-TTC P1_g2 ***
25064913-GA-TC 22918766-GA-TC g1 ***
24595386-CTG-TTT 22449239-CTG-TTT P3_t2 ***
24013847-CTATATATATATATATATATATATATATA-C 21867700-CTATATATATATATATATATATATATATA-C 21×TA***
23519096-TTAGAA-CCAGAT 21357210-TTAGAA-CCAGAT ***
21192061-G-GT 19030175-G-GT ***
22503610-GTGTTTCT-TTGTGTCC 20341724-GTGTTTCT-TTGTGTCC DYZ19 ***
22488226-CA-TG 20326340-CA-TG DYZ19 ***
22364656-GTGTT-CTGTC 20202770-GTGTT-CTGTC DYZ19 ***
22360108-AC-CT 20198222-AC-CT DYZ19 ***
22360090-ACC-CCT 20198204-ACC-CCT DYZ19 ***
22347238-ATCAA-TTCAG 20185352-ATCAA-TTCAG DYZ19 ***
22344512-ACAA-GCAG 20182626-ACAA-GCAG DYZ19 ***
22297122-ATCTG-TTGTT 20135236-ATCTG-TTGTT DYZ19 ***
21940037-C-CATATAT 19778151-C-CATATAT 22×AT***
21830186-ACAGT-A 19668300-ACAGT-A ***
21386196-TATA-T 19224310-TATA-T ***
21226437-G-GAAAA 19064551-G-GAAAA ***
21226433-G-GAAAA 19064547-G-GAAAA ***
4636104-AAAATAT-A 4768063-AAAATAT-A ***
6493953-C-CA 6625912-C-CA 19×A***
27445948-G-A 25299801-G-A P1_Y2 ***
27919143-C-A 25772996-C-A P1_Y2 ***
28356083-C-A 26209936-C-A P1_gr2 ***
28281402-G-A 26135255-G-A P1_b4 ***
28253609-G-T 26107462-G-T P1_b4 ***
28253588-T-C 26107441-T-C P1_b4 ***
28238059-T-A 26091912-T-A P1_b4 ***
28213860-C-T 26067713-C-T P1_b4 ***
28183627-A-C 26037480-A-C P1_b4 ***
28156507-G-T 26010360-G-T P1_b4 ***
28118361-C-A 25972214-C-A P1_b4 ***
28118348-G-T 25972201-G-T P1_b4 ***
28091217-C-A 25945070-C-A P1_Y2 ***
28009230-A-C 25863083-A-C P1_Y2 ***
27902254-C-T 25756107-C-T P1_Y2 ***
28578906-G-A 26432759-G-A ***
27868556-A-G 25722409-A-G P1_Y2 ***
27839929-A-C 25693782-A-C P1_Y2 ***
27823090-A-C 25676943-A-C P1_Y2 ***
27783729-A-C 25637582-A-C P1_Y2 ***
27719299-G-T 25573152-G-T P1_Y2 ***
22498752-G-T 20336866-G-T DYZ19 ***
27680772-C-T 25534625-C-T P1_Y2 ***
27668051-T-G 25521904-T-G P1_Y2 ***
27648580-G-T 25502433-G-T P1_Y2 ***
27571566-A-C 25425419-A-C P1_Y2 ***
27558412-C-A 25412265-C-A P1_Y2 ***
27528909-T-A 25382762-T-A P1_Y2 ***
27528888-T-A 25382741-T-A P1_Y2 ***
28415933-T-A 26269786-T-A P1_gr2 ***
58822423-G-A 56768448-C-T ***
19469845-T-TTC 17357965-T-TTC 14×TC***
58890388-T-C 56700483-A-G ***
3700107-TA-T 3832066-TA-T 15×A***
28357150-CT-C 26211003-CT-C P1_gr2 15×T***
23293596-GTGTA-G 21131710-GTGTA-G ***
58986201-C-A 56840054-C-A ***
58910666-T-C 56680205-A-G ***
58908803-T-A 56682068-A-T ***
58908794-C-G 56682077-G-C ***
58908751-A-T 56682120-T-A ***
58907516-C-T 56683355-G-A ***
58903455-C-A 56687416-G-T ***
58903418-A-C 56687453-T-G ***
58903417-C-T 56687454-G-A ***
58890286-A-C 56700585-T-G ***
58823287-C-A 56767584-G-T ***
58887966-T-A 56702905-A-T ***
58882946-C-T 56707925-G-A 4×CCATT***
58882937-C-G 56707934-G-C ***
58874773-C-T 56716098-G-A ***
58862649-C-A 56728222-G-T ***
58856246-A-T 56734625-T-A ***
58854947-C-G 56735924-G-C ***
58846028-T-G 56744843-A-C ***
58845608-C-T 56745263-G-A ***
58845478-C-A 56745393-G-T ***
58840856-G-A 56750015-C-T ***
58835342-A-T 56755529-T-A ***
58831034-A-T 56759837-T-A ***
27692550-A-G 25546403-A-G P1_Y2 ***
22324456-A-G 20162570-A-G DYZ19 ***
22481801-G-T 20319915-G-T DYZ19 ***
5837059-C-T 5969018-C-T ***
7631307-C-T 7763266-C-T ***
7490106-C-T 7622065-C-T IR1_L ***
7195265-G-A 7327224-G-A ***
6902877-A-T 7034836-A-T ***
6686828-G-T 6818787-G-T ***
6637799-T-G 6769758-T-G ***
6591261-C-A 6723220-C-A ***
6551017-G-T 6682976-G-T ***
6549843-T-G 6681802-T-G ***
6326781-A-T 6458740-A-T IR3_Dst ***
6192300-C-T 6324259-C-T IR3_Dst ***
6107026-C-G 6238985-C-G ***
5130137-A-G 5262096-A-G ***
8167358-G-A 8299317-G-A ***
5009563-T-C 5141522-T-C ***
4909624-C-A 5041583-C-A ***
4842820-A-G 4974779-A-G ***
4822224-G-T 4954183-G-T ***
4699014-C-A 4830973-C-A ***
4683223-T-A 4815182-T-A ***
4683195-C-G 4815154-C-G ***
4683190-T-C 4815149-T-C ***
4683175-C-A 4815134-C-A ***
4683174-A-G 4815133-A-G ***
4683173-C-T 4815132-C-T ***
4683159-T-A 4815118-T-A ***
7964937-C-T 8096896-C-T ***
8813765-A-T 8945724-A-T ***
4430927-A-G 4562886-A-G ***
13201829-C-T 11046153-C-T ***
13470494-G-A 11314818-G-A ***
13470482-G-T 11314806-G-T ***
13470465-C-A 11314789-C-A ***
13470462-A-T 11314786-A-T ***
13464307-T-C 11308631-T-C ***
13461108-A-G 11305432-A-G ***
13393258-T-C 11237582-T-C ***
13383684-G-A 11228008-G-A ***
13336873-G-T 11181197-G-T ***
13201895-T-C 11046219-T-C ***
13201893-A-T 11046217-A-T ***
13201880-C-T 11046204-C-T ***
10041584-A-T 10203975-A-T ***
9034252-T-G 9196643-T-G ***
9779302-A-G 9941693-A-G FGC41558 ***
9682905-T-G 9845296-T-G IR3_Prx ***
9586703-C-A 9749094-C-A IR3_Prx ***
9536602-G-T 9698993-G-T IR3_Prx ***
9410446-G-T 9572837-G-T ***
9335659-T-C 9498050-T-C ***
9303164-A-C 9465555-A-C ***
9298968-G-T 9461359-G-T ***
9298936-T-C 9461327-T-C ***
9231197-G-T 9393588-G-T 8×T***
9219552-T-G 9381943-T-G ***
9199529-A-C 9361920-A-C A19876 ***
4683144-G-A 4815103-G-A ***
4291142-C-A 4423101-C-A ***
13470534-G-T 11314858-G-T ***
17932405-CA-C 15820525-CA-C 13×A***
25466379-T-G 23320232-T-G P2_r2 ***
22234333-T-A 20072447-T-A DYZ19 ***
28787059-AC-A 26640912-AC-A ***
23519079-A-G 21357193-A-G ***
23518998-C-A 21357112-C-A ***
13267570-T-C 11111894-T-C ***
13267546-T-A 11111870-T-A ***
13267530-T-C 11111854-T-C ***
13261558-T-C 11105882-T-C ***
13258092-T-C 11102416-T-C ***
59007959-CAAAAAAAAAA-C 56861812-CAAAAAAAAAA-C 26×A***
22356815-A-C 20194929-A-C DYZ19 ***
13736896-C-T 11581220-C-T ***
22329797-G-T 20167911-G-T DYZ19 ***
13114806-A-G 10604292-A-G ***
58823276-CCATTCCATCT-C 56767576-AATGGAATGAG-A ***
58891295-C-A 56699576-G-T ***
20124960-A-T 18013080-A-T P5_Dst ***
22364734-G-T 20202848-G-T DYZ19 ***
58823338-TTC-ATT 56767531-GAA-AAT ***
5178062-CA-C 5310021-CA-C 20×A***
58916206-C-T 56674665-G-A ***
13390106-G-A 11234430-G-A ***
13306292-C-T 11150616-C-T ***
58908822-A-G 56682049-T-C ***
22289810-T-A 20127924-T-A DYZ19 ***
13115283-C-T 10604769-C-T ***
27161532-T-A 25015385-T-A P1_g3 ***
4291132-G-A 4423091-G-A ***
13733865-ACGAGCGCAA-TGGAGCGCAT 11578189-ACGAGCGCAA-TGGAGCGCAT ***
4089795-A-T 4221754-A-T ***
3786463-T-A 3918422-T-A ***
3603514-T-G 3735473-T-G ***
3457626-G-T 3589585-G-T ***
22344512-A-G 20182626-A-G DYZ19 ***
22308079-A-G 20146193-A-G DYZ19 ***
25215907-C-T 23069760-C-T P2_r1 ***
22344515-A-G 20182629-A-G DYZ19 ***
58903424-C-G 56687447-G-C ***
13201868-A-G 11046192-A-G ***
58890716-T-C 56700155-A-G ***
58854623-C-CATTCT 56736243-G-GGAATA ***
27528910-C-A 25382763-C-A P1_Y2 ***
15491941-GTA-G 13380061-GTA-G 19×TA***
24862222-G-A 22716075-G-A P3_b2 ***
22311274-G-T 20149388-G-T DYZ19 ***
58908850-C-A 56682021-G-T ***
58854627-C-CCATTG 56736239-G-GAATGC ***
28678123-TGGAGGCTTCAGTATGACAGAAACTTCCTGAAGACTTCTCCTACTGAAGCCTCCTGTGTTGGAGGCTTCTCCTCCTGAAGAGCCTCCAACACA-T 26531976-TGGAGGCTTCAGTATGACAGAAACTTCCTGAAGACTTCTCCTACTGAAGCCTCCTGTGTTGGAGGCTTCTCCTCCTGAAGAGCCTCCAACACA-T ***
24283316-C-A 22137169-C-A P3_t1 ***
9301608-C-T 9463999-C-T ***
22364715-T-A 20202829-T-A DYZ19 ***
22358162-T-C 20196276-T-C DYZ19 ***
22358161-G-T 20196275-G-T DYZ19 ***
22358154-G-A 20196268-G-A DYZ19 ***
13611863-G-T 11456187-G-T ***
9502520-TGGGGGGAGGGGGGAG-T 9664911-TGGGGGGAGGGGGGAG-T ***
13470501-C-G 11314825-C-G ***
13470536-G-C 11314860-G-C ***
22452166-T-A 20290280-T-A DYZ19 ***
20084849-G-T 17972969-G-T P5_Dst ***
20736761-A-C 18574875-A-C P4_Prx ***
20682919-C-A 18521033-C-A P4_Prx ***
20534065-T-A 18372179-T-A P5_Dst ***
20532799-C-A 18370913-C-A P5_Dst ***
20500806-A-G 18338920-A-G P5_Dst ***
20353076-G-A 18191190-G-A P5_Dst ***
20331294-A-G 18169408-A-G P5_Dst ***
20326430-C-T 18164544-C-T P5_Dst ***
20124972-G-A 18013092-G-A P5_Dst ***
20124971-T-C 18013091-T-C P5_Dst ***
20084906-C-T 17973026-C-T P5_Dst ***
20084888-C-T 17973008-C-T P5_Dst ***
20084748-C-T 17972868-C-T P5_Dst ***
20896063-T-C 18734177-T-C P4_Dst ***
20084640-G-T 17972760-G-T P5_Dst ***
20084638-G-T 17972758-G-T P5_Dst ***
20084593-A-T 17972713-A-T P5_Dst ***
20005039-A-T 17893159-A-T P5_Prx ***
19927035-G-T 17815155-G-T P5_Prx ***
19853713-T-A 17741833-T-A P5_Prx ***
19830187-G-T 17718307-G-T P5_Prx ***
19803131-T-C 17691251-T-C P5_Prx ***
19754356-C-A 17642476-C-A P5_Prx ***
19705846-G-A 17593966-G-A P5_Prx ***
19646962-C-T 17535082-C-T P5_Prx ***
19625942-A-G 17514062-A-G P5_Prx ***
20872423-T-C 18710537-T-C P4_Dst ***
20932612-G-A 18770726-G-A P4_Dst 17×A***
19487491-G-T 17375611-G-T ***
22311134-C-T 20149248-C-T DYZ19 ***
22434432-T-G 20272546-T-G DYZ19 ***
22366118-G-T 20204232-G-T DYZ19 ***
22361299-G-T 20199413-G-T DYZ19 ***
22359925-A-C 20198039-A-C DYZ19 ***
22358759-G-T 20196873-G-T DYZ19 ***
22358306-T-A 20196420-T-A DYZ19 ***
22358299-T-A 20196413-T-A DYZ19 ***
22358127-A-T 20196241-A-T DYZ19 ***
22348822-G-T 20186936-G-T DYZ19 ***
22346947-A-T 20185061-A-T DYZ19 ***
22346944-G-T 20185058-G-T DYZ19 ***
22502932-G-A 20341046-G-A DYZ19 ***
22297126-G-T 20135240-G-T DYZ19 ***
20942891-T-G 18781005-T-G P4_Dst ***
22297124-C-G 20135238-C-G DYZ19 ***
22292641-T-C 20130755-T-C DYZ19 ***
22292563-A-G 20130677-A-G DYZ19 ***
22289805-G-T 20127919-G-T DYZ19 ***
22248014-A-G 20086128-A-G DYZ19 ***
22153687-G-A 19991801-G-A ***
22085516-A-C 19923630-A-C ***
21829861-G-A 19667975-G-A ***
21829853-T-A 19667967-T-A ***
21537782-C-A 19375896-C-A ***
21056558-G-T 18894672-G-T ***
21030683-G-A 18868797-G-A P4_Dst ***
20980831-A-G 18818945-A-G P4_Dst ***
19540893-G-T 17429013-G-T ***
19426761-C-T 17314881-C-T ***
13471075-C-T 11315399-C-T ***
15121436-C-A 13009523-C-A ***
16827132-T-G 14715252-T-G ***
16658399-A-C 14546519-A-C ***
16297361-A-T 14185481-A-T ***
16267062-C-A 14155182-C-A ***
16210722-G-T 14098842-G-T ***
16081738-A-T 13969858-A-T ***
16067818-A-T 13955938-A-T ***
16065912-T-C 13954032-T-C ***
15963224-G-T 13851344-G-T ***
15839196-C-T 13727316-C-T ***
15444910-T-A 13333030-T-A ***
15214441-C-T 13102527-C-T ***
15117243-G-A 13005330-G-A ***
17060977-T-C 14949097-T-C ***
15103252-C-T 12991340-C-T ***
14959959-A-T 12848034-A-T ***
14634355-G-C 12522424-G-C ***
14515290-G-T 12403495-G-T ***
14515188-T-A 12403393-T-A ***
14122509-G-T 12001803-G-T ***
13748572-G-A 11592896-G-A ***
13744476-C-A 11588800-C-A ***
13730829-C-A 11575153-C-A ***
13730826-C-T 11575150-C-T ***
13726823-G-A 11571147-G-A ***
13580730-C-T 11425054-C-T ***
16996974-A-G 14885094-A-G ***
17122867-G-T 15010987-G-T ***
19340026-G-T 17228146-G-T ***
18527337-T-G 16415457-T-G P6_Dst ***
19330760-G-A 17218880-G-A ***
19040318-T-C 16928438-T-C ***
19029823-C-A 16917943-C-A ***
18975181-T-C 16863301-T-C ***
18877933-T-A 16766053-T-A ***
18877882-C-A 16766002-C-A ***
18877734-A-C 16765854-A-C ***
18846008-T-C 16734128-T-C ***
18845993-C-A 16734113-C-A ***
18626611-A-C 16514731-A-C ***
18544200-C-T 16432320-C-T ***
18531631-C-T 16419751-C-T P6_Dst ***
18380887-G-T 16269007-G-T P6_Prx ***
17162294-G-T 15050414-G-T ***
18361567-G-A 16249687-G-A P6_Prx ***
18361560-T-A 16249680-T-A P6_Prx ***
18361556-T-A 16249676-T-A P6_Prx ***
18361514-G-A 16249634-G-A P6_Prx ***
18361419-C-A 16249539-C-A P6_Prx ***
18360920-T-G 16249040-T-G P6_Prx ***
18280659-C-A 16168779-C-A P6_Prx ***
18255882-T-A 16144002-T-A ***
18140295-T-C 16028415-T-C ***
18130877-A-T 16018997-A-T ***
17784750-A-G 15672870-A-G ***
17648559-A-G 15536679-A-G ***
17643892-G-A 15532012-G-A ***
58907479-GCAG-CCAT 56683389-CTGC-ATGG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page