Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > S568 > FGC440 > FGC458

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFGC
3B2TN
Manual
Edits
19080222-A-T 16968342-A-T FGC40247 YY+
7687370-G-C 7819329-G-C FGC40244 YY+
5343414-T-A 5475373-T-A FGC40241 +
7367424-T-C 7499383-T-C FGC40242 YY+
7411026-A-T 7542985-A-T FGC40243 YY+
22246419-A-C 20084533-A-C FGC40248 DYZ19 +
15314206-A-G 13202311-A-G FGC40246 YY+
25088440-A-G 22942293-A-G BY2330 A8722 g1 *
13201890-C-A 11046214-C-A **
14736419-A-G 12624487-A-G **
15098435-A-G 12986523-A-G **
19127667-T-TACACAC 17015787-T-TACACAC 18×AC**
24387061-CTATA-C 22240914-CTATA-C **
8278926-G-A 8410885-G-A **
58823348-A-AT 56767520-G-GA **
14100350-T-TGAACGTGCAGCGCGCAGCAGC 11979644-T-TGAACGTGCAGCGCGCAGCAGC **
15807481-A-G 13695601-A-G **
5872259-T-A 6004218-T-A **
13201794-G-A 11046118-G-A **
15962961-C-T 13851081-C-T **
20815408-C-CAT 18653522-C-CAT P4_Gap 22×AT**
16046631-TACAC-T 13934751-TACAC-T 17×AC**
3634112-A-T 3766071-A-T **
14129457-G-A 12008751-G-A **
8176544-G-T 8308503-G-T **
19438446-G-GAAGAAAGAAAGA 17326566-G-GAAGAAAGAAAGA 15×AAGA**
8914172-C-CATT 9046131-C-CATT 13×ATT**
13201836-T-C 11046160-T-C **
26828316-A-T 24682169-A-T P1_g2 **
13201804-A-T 11046128-A-T **
21501074-C-T 19339188-C-T **
22551284-T-C 20389398-T-C **
13445668-GAAA-G 11289992-GAAA-G 9×A**
26828342-G-T 24682195-G-T P1_g2 **
26079676-C-A 23933529-C-A P1_Y1 ***
26992893-C-T 24846746-C-T P1_r4 ***
27035480-C-T 24889333-C-T P1_r4 16×T***
26079798-A-T 23933651-A-T P1_Y1 ***
26043410-C-A 23897263-C-A P1_Y1 ***
26139681-C-G 23993534-C-G P1_Y1 ***
26948651-C-T 24802504-C-T P1_r3 ***
26228738-C-T 24082591-C-T P1_Y1 ***
26699997-A-G 24553850-A-G P1_g2 ***
26041214-C-A 23895067-C-A P1_Y1 ***
27041320-T-G 24895173-T-G P1_r4 ***
26385478-G-T 24239331-G-T P1_Y1 ***
26004394-A-G 23858247-A-G P1_Y1 ***
25996161-T-A 23850014-T-A P1_Y1 ***
25881007-G-A 23734860-G-A P1_Y1 ***
27060177-T-A 24914030-T-A P1_r4 ***
25732195-C-A 23586048-C-A P1_b3 ***
25732078-A-C 23585931-A-C P1_b3 ***
25728715-C-T 23582568-C-T P1_b3 ***
25723870-T-A 23577723-T-A P1_b3 ***
25638704-A-T 23492557-A-T P1_b3 ***
27095966-C-T 24949819-C-T P1_r4 ***
25531565-T-A 23385418-T-A P1_gr1 ***
26229231-G-T 24083084-G-T P1_Y1 ***
26507372-G-A 24361225-G-A P1_Y1 ***
26392241-C-T 24246094-C-T P1_Y1 ***
26538040-G-T 24391893-G-T P1_g2 ***
26699988-T-G 24553841-T-G P1_g2 ***
26699985-G-C 24553838-G-C P1_g2 ***
26675808-A-T 24529661-A-T P1_g2 ***
26776632-A-C 24630485-A-C P1_g2 ***
26657448-C-A 24511301-C-A P1_g2 ***
26828103-T-C 24681956-T-C P1_g2 ***
26564201-G-T 24418054-G-T P1_g2 ***
26544125-A-G 24397978-A-G P1_g2 ***
26544076-C-A 24397929-C-A P1_g2 ***
26828302-C-A 24682155-C-A P1_g2 ***
26463134-G-T 24316987-G-T P1_Y1 ***
25520291-C-T 23374144-C-T P1_gr1 ***
26534747-A-C 24388600-A-C P1_g2 ***
26828331-C-T 24682184-C-T P1_g2 ***
26532508-A-C 24386361-A-C P1_g2 ***
26828353-T-C 24682206-T-C P1_g2 ***
26526016-C-A 24379869-C-A P1_Y1 ***
26525996-G-A 24379849-G-A P1_Y1 ***
26703131-T-G 24556984-T-G P1_g2 ***
26463716-G-T 24317569-G-T P1_Y1 ***
26463359-C-A 24317212-C-A P1_Y1 ***
25520416-A-G 23374269-A-G P1_gr1 ***
25287818-T-C 23141671-T-C P2_r1 ***
25508909-C-A 23362762-C-A P1_gr1 ***
23519130-G-A 21357244-G-A ***
24588443-G-T 22442296-G-T P3_t2 ***
24562596-A-T 22416449-A-T P3_t2 ***
24550853-G-T 22404706-G-T P3_t2 ***
24547762-G-A 22401615-G-A P3_t2 ***
24326322-G-A 22180175-G-A P3_t1 ***
24283245-G-A 22137098-G-A P3_t1 ***
24283236-A-G 22137089-A-G P3_t1 ***
24232072-C-A 22085925-C-A P3_b1 ***
24208523-A-G 22062376-A-G P3_b1 ***
24182579-T-G 22036432-T-G P3_b1 ***
24175319-A-T 22029172-A-T P3_b1 ***
23723041-G-A 21561155-G-A ***
23569690-C-T 21407804-C-T ***
23519129-A-C 21357243-A-C ***
24599692-C-A 22453545-C-A P3_t2 ***
23519108-A-G 21357222-A-G ***
23519101-A-T 21357215-A-T ***
23519097-T-C 21357211-T-C ***
23519096-T-C 21357210-T-C ***
23017757-A-C 20855871-A-C ***
22955004-G-T 20793118-G-T ***
22498752-G-T 20336866-G-T DYZ19 ***
22481801-G-T 20319915-G-T DYZ19 ***
22452166-T-A 20290280-T-A DYZ19 ***
22434432-T-G 20272546-T-G DYZ19 ***
22366118-G-T 20204232-G-T DYZ19 ***
22361299-G-T 20199413-G-T DYZ19 ***
22359925-A-C 20198039-A-C DYZ19 ***
22358759-G-T 20196873-G-T DYZ19 ***
24595420-G-T 22449273-G-T P3_t2 ***
24619648-C-A 22473501-C-A P3_t2 ***
25465870-T-A 23319723-T-A P2_r2 ***
24905835-A-G 22759688-A-G g1 ***
25444461-G-T 23298314-G-T P2_r2 ***
25360877-T-A 23214730-T-A P2_r2 ***
25357064-A-G 23210917-A-G P2_r2 ***
25311592-C-G 23165445-C-G P2_r1 ***
25308112-T-A 23161965-T-A P2_r1 ***
27150816-G-T 25004669-G-T P1_g3 ***
25256652-G-T 23110505-G-T P2_r1 ***
25182148-C-T 23036001-C-T g1 ***
25173059-T-A 23026912-T-A g1 ***
25158308-A-G 23012161-A-G g1 ***
25023571-A-T 22877424-A-T g1 ***
24992277-G-T 22846130-G-T g1 ***
24951625-C-T 22805478-C-T g1 ***
24905837-T-C 22759690-T-C g1 ***
24905602-C-A 22759455-C-A g1 ***
24635633-G-C 22489486-G-C P3_t2 ***
24862237-T-G 22716090-T-G P3_b2 ***
24862185-T-G 22716038-T-G P3_b2 ***
24862151-T-G 22716004-T-G P3_b2 ***
24862094-T-A 22715947-T-A P3_b2 ***
24766306-A-C 22620159-A-C P3_b2 ***
24759956-A-T 22613809-A-T P3_b2 ***
24759872-C-A 22613725-C-A P3_b2 ***
24750639-A-T 22604492-A-T P3_b2 ***
24727216-A-T 22581069-A-T P3_b2 ***
24695878-G-T 22549731-G-T P3_b2 ***
24662080-G-T 22515933-G-T P3_b2 ***
24661305-A-G 22515158-A-G P3_b2 ***
24661250-A-T 22515103-A-T P3_b2 ***
24652530-A-T 22506383-A-T P3_b2 ***
27150801-G-T 25004654-G-T P1_g3 ***
19753403-CT-C 17641523-CT-C P5_Prx 19×T***
27161489-C-A 25015342-C-A P1_g3 ***
13461095-GGGTG-AGGTT 11305419-GGGTG-AGGTT ***
17662050-GTG-T 15550170-GTG-T ***
16344414-T-TTCTTCC 14232534-T-TTCTTCC ***
16046662-ACACG-A 13934782-ACACG-A ***
14639064-CTTTTT-C 12527133-CTTTTT-C 18×T***
14418162-A-ATTTG ***
13936208-G-GAAAA 11815502-G-GAAAA ***
13489074-GCT-ACC 11333398-GCT-ACC ***
13489066-TCCA-ACCC 11333390-TCCA-ACCC ***
13489043-GGATG-AGATT 11333367-GGATG-AGATT ***
13489029-TGC-CAT 11333353-TGC-CAT ***
13470534-GGG-TGC 11314858-GGG-TGC ***
13470462-AGCC-TGCA 11314786-AGCC-TGCA ***
13470444-TCTGCGT-CCTGTGG 11314768-TCTGCGT-CCTGTGG ***
13455956-CTCAAGTTGATTCAAGTCCATTCTATTCCATTCCATTCCATTACATTTCATTACATTCGTGTTGAT-C 11300280-CTCAAGTTGATTCAAGTCCATTCTATTCCATTCCATTCCATTACATTTCATTACATTCGTGTTGAT-C ***
19412008-G-GAAAT 17300128-G-GAAAT ***
13454823-A-ATTCCC 11299147-A-ATTCCC ***
13454818-A-ATTCCC 11299142-A-ATTCCC ***
13454813-A-ATTCCT 11299137-A-ATTCCT ***
13454810-T-TCCATA 11299134-T-TCCATA ***
13201890-CTAAGT-ATATGC 11046214-CTAAGT-ATATGC ***
10032344-G-GT 10194735-G-GT 12×T***
9429040-TTGCA-CTGCG 9591431-TTGCA-CTGCG ***
8631383-CTTTTTTT-C 8763342-CTTTTTTT-C 26×T***
8125021-A-AAAGG 8256980-A-AAAGG ***
6430439-TTA-T 6562398-TTA-T 19×TA***
6091743-TTTTTTG-T 6223702-TTTTTTG-T ***
4636104-AAAATAT-A 4768063-AAAATAT-A ***
2845819-CTCAAAA-C 2977778-CTCAAAA-C ***
6493953-C-CA 6625912-C-CA 19×A***
17662050-GTGTT-G 15550170-GTGTT-G ***
20804857-ATGTG-A 18642971-ATGTG-A P4_Gap 14×TG***
3700107-TA-T 3832066-TA-T 15×A***
23519096-TTAGAA-CCAGAT 21357210-TTAGAA-CCAGAT ***
58903417-CA-TC 56687453-TG-GA ***
58882513-CAGTC-TAGTA 56708354-GACTG-TACTA ***
58823277-CATTCCATCTC-A 56767584-GAGATGGAATG-T ***
28805151-GTGGAATGGAATGGAATGGAAAGGAATGGAATAGAATGGAGTGAAGTGCAGTGCAGTGAAATGGAGTGGAAAGGAATGGAATGGAATGGAATGGAATGGAA-G 26659004-GTGGAATGGAATGGAATGGAAAGGAATGGAATAGAATGGAGTGAAGTGCAGTGCAGTGAAATGGAGTGGAAAGGAATGGAATGGAATGGAATGGAATGGAA-G 4×TGGAA***
28209421-C-CT 26063274-C-CT P1_b4 23×T***
27810273-A-AAAGGAAGGAAGG 25664126-A-AAAGGAAGGAAGG P1_Y2 16×AAGG***
26828328-T-TCC 24682181-T-TCC P1_g2 ***
26828316-ACC-TCT 24682169-ACC-TCT P1_g2 ***
26828281-CTCTG-TTC 24682134-CTCTG-TTC P1_g2 ***
25064913-GA-TC 22918766-GA-TC g1 ***
24595386-CTG-TTT 22449239-CTG-TTT P3_t2 ***
24013847-CTATATATATATATATATATATATATATA-C 21867700-CTATATATATATATATATATATATATATA-C 21×TA***
23519129-AG-CA 21357243-AG-CA ***
22503610-GTGTTTCT-TTGTGTCC 20341724-GTGTTTCT-TTGTGTCC DYZ19 ***
20804883-GTG-A 18642997-GTG-A P4_Gap ***
22488226-CA-TG 20326340-CA-TG DYZ19 ***
22364656-GTGTT-CTGTC 20202770-GTGTT-CTGTC DYZ19 ***
22360108-AC-CT 20198222-AC-CT DYZ19 ***
22360090-ACC-CCT 20198204-ACC-CCT DYZ19 ***
22347238-ATCAA-TTCAG 20185352-ATCAA-TTCAG DYZ19 ***
22344512-ACAA-GCAG 20182626-ACAA-GCAG DYZ19 ***
22297122-ATCTG-TTGTT 20135236-ATCTG-TTGTT DYZ19 ***
21940037-C-CATATAT 19778151-C-CATATAT 22×AT***
21830186-ACAGT-A 19668300-ACAGT-A ***
21386196-TATA-T 19224310-TATA-T ***
21226437-G-GAAAA 19064551-G-GAAAA ***
21226433-G-GAAAA 19064547-G-GAAAA ***
21192061-G-GT 19030175-G-GT ***
20865357-C-CACAT 18703471-C-CACAT P4_Dst ***
19469845-T-TTC 17357965-T-TTC 14×TC***
28357150-CT-C 26211003-CT-C P1_gr2 15×T***
27240814-G-A 25094667-G-A P1_g3 ***
27719299-G-T 25573152-G-T P1_Y2 ***
28213860-C-T 26067713-C-T P1_b4 ***
28183627-A-C 26037480-A-C P1_b4 ***
28156507-G-T 26010360-G-T P1_b4 ***
28118361-C-A 25972214-C-A P1_b4 ***
28118348-G-T 25972201-G-T P1_b4 ***
28091217-C-A 25945070-C-A P1_Y2 ***
28009230-A-C 25863083-A-C P1_Y2 ***
27919143-C-A 25772996-C-A P1_Y2 ***
27902254-C-T 25756107-C-T P1_Y2 ***
27868556-A-G 25722409-A-G P1_Y2 ***
27839929-A-C 25693782-A-C P1_Y2 ***
27823090-A-C 25676943-A-C P1_Y2 ***
27783729-A-C 25637582-A-C P1_Y2 ***
27692550-A-G 25546403-A-G P1_Y2 ***
28253588-T-C 26107441-T-C P1_b4 ***
27680772-C-T 25534625-C-T P1_Y2 ***
27668051-T-G 25521904-T-G P1_Y2 ***
27648580-G-T 25502433-G-T P1_Y2 ***
27571566-A-C 25425419-A-C P1_Y2 ***
27558412-C-A 25412265-C-A P1_Y2 ***
22358299-T-A 20196413-T-A DYZ19 ***
27528909-T-A 25382762-T-A P1_Y2 ***
27528888-T-A 25382741-T-A P1_Y2 ***
27445948-G-A 25299801-G-A P1_Y2 ***
27424439-C-A 25278292-C-A P1_g3 ***
27409232-C-A 25263085-C-A P1_g3 ***
27407821-T-C 25261674-T-C P1_g3 ***
27398496-C-A 25252349-C-A P1_g3 ***
27248234-T-C 25102087-T-C P1_g3 ***
28238059-T-A 26091912-T-A P1_b4 ***
28253609-G-T 26107462-G-T P1_b4 ***
23293596-GTGTA-G 21131710-GTGTA-G ***
58882937-C-G 56707934-G-C ***
58986201-C-A 56840054-C-A ***
58910666-T-C 56680205-A-G ***
58908803-T-A 56682068-A-T ***
58908794-C-G 56682077-G-C ***
58908751-A-T 56682120-T-A ***
58907516-C-T 56683355-G-A ***
58903455-C-A 56687416-G-T ***
58903418-A-C 56687453-T-G ***
58903417-C-T 56687454-G-A ***
58890388-T-C 56700483-A-G ***
58890286-A-C 56700585-T-G ***
58887966-T-A 56702905-A-T ***
58882946-C-T 56707925-G-A 4×CCATT***
58874773-C-T 56716098-G-A ***
28281402-G-A 26135255-G-A P1_b4 ***
58862649-C-A 56728222-G-T ***
58856246-A-T 56734625-T-A ***
58854947-C-G 56735924-G-C ***
58846028-T-G 56744843-A-C ***
58845608-C-T 56745263-G-A ***
58845478-C-A 56745393-G-T ***
58840856-G-A 56750015-C-T ***
58835342-A-T 56755529-T-A ***
58831034-A-T 56759837-T-A ***
58823287-C-A 56767584-G-T ***
58822423-G-A 56768448-C-T ***
28578906-G-A 26432759-G-A ***
28415933-T-A 26269786-T-A P1_gr2 ***
28356083-C-A 26209936-C-A P1_gr2 ***
22358306-T-A 20196420-T-A DYZ19 ***
22085516-A-C 19923630-A-C ***
22358127-A-T 20196241-A-T DYZ19 ***
4683174-A-G 4815133-A-G ***
6107026-C-G 6238985-C-G ***
5837059-C-T 5969018-C-T ***
5130137-A-G 5262096-A-G ***
5009563-T-C 5141522-T-C ***
4909624-C-A 5041583-C-A ***
4842820-A-G 4974779-A-G ***
4822224-G-T 4954183-G-T ***
4699014-C-A 4830973-C-A ***
4683223-T-A 4815182-T-A ***
4683195-C-G 4815154-C-G ***
4683190-T-C 4815149-T-C ***
4683175-C-A 4815134-C-A ***
4683173-C-T 4815132-C-T ***
6326781-A-T 6458740-A-T IR3_Dst ***
4683159-T-A 4815118-T-A ***
4683144-G-A 4815103-G-A ***
4430927-A-G 4562886-A-G ***
4291142-C-A 4423101-C-A ***
4291132-G-A 4423091-G-A ***
4089795-A-T 4221754-A-T ***
3786463-T-A 3918422-T-A ***
3603514-T-G 3735473-T-G ***
3457626-G-T 3589585-G-T ***
2810452-A-T 2942411-A-T 9×T***
22344512-A-G 20182626-A-G DYZ19 ***
22308079-A-G 20146193-A-G DYZ19 ***
25215907-C-T 23069760-C-T P2_r1 ***
6192300-C-T 6324259-C-T IR3_Dst ***
6549843-T-G 6681802-T-G ***
58903424-C-G 56687447-G-C ***
9298936-T-C 9461327-T-C ***
13201893-A-T 11046217-A-T ***
13201880-C-T 11046204-C-T ***
13201829-C-T 11046153-C-T ***
10041584-A-T 10203975-A-T ***
9779302-A-G 9941693-A-G FGC41558 ***
9682905-T-G 9845296-T-G IR3_Prx ***
9586703-C-A 9749094-C-A IR3_Prx ***
9536602-G-T 9698993-G-T IR3_Prx ***
9410446-G-T 9572837-G-T ***
9335659-T-C 9498050-T-C ***
9303175-A-C 9465566-A-C ***
9303164-A-C 9465555-A-C ***
9298968-G-T 9461359-G-T ***
9231197-G-T 9393588-G-T 8×T***
6551017-G-T 6682976-G-T ***
9219552-T-G 9381943-T-G ***
9199529-A-C 9361920-A-C ***
9034252-T-G 9196643-T-G ***
8813765-A-T 8945724-A-T ***
8167358-G-A 8299317-G-A ***
7964937-C-T 8096896-C-T ***
7631307-C-T 7763266-C-T ***
7490106-C-T 7622065-C-T IR1_L ***
7195265-G-A 7327224-G-A ***
6902877-A-T 7034836-A-T ***
6686828-G-T 6818787-G-T ***
6637799-T-G 6769758-T-G ***
6591261-C-A 6723220-C-A ***
22344515-A-G 20182629-A-G DYZ19 ***
13201868-A-G 11046192-A-G ***
13336873-G-T 11181197-G-T ***
17951299-AT-A 15839419-AT-A 25×T***
13267570-T-C 11111894-T-C ***
13267546-T-A 11111870-T-A ***
13267530-T-C 11111854-T-C ***
13261558-T-C 11105882-T-C ***
13258092-T-C 11102416-T-C ***
13254020-C-T 11098344-C-T ***
21133556-CAA-C 18971670-CAA-C 23×A***
59007959-CAAAAAAAAAA-C 56861812-CAAAAAAAAAA-C 26×A***
22356815-A-C 20194929-A-C DYZ19 ***
17932405-CA-C 15820525-CA-C 13×A***
13736896-C-T 11581220-C-T ***
13114806-A-G 10604292-A-G ***
58823276-CCATTCCATCT-C 56767576-AATGGAATGAG-A ***
58891295-C-A 56699576-G-T ***
13472496-C-T 11316820-C-T ***
13489066-T-A 11333390-T-A ***
20124960-A-T 18013080-A-T P5_Dst ***
22364734-G-T 20202848-G-T DYZ19 ***
58823338-TTC-ATT 56767531-GAA-AAT ***
5178062-CA-C 5310021-CA-C 20×A***
58916206-C-T 56674665-G-A ***
13390106-G-A 11234430-G-A ***
13306292-C-T 11150616-C-T ***
58908822-A-G 56682049-T-C ***
13453454-TATTCC-T 11297778-TATTCC-T 11×ATTCC***
22289810-T-A 20127924-T-A DYZ19 ***
22502932-G-A 20341046-G-A DYZ19 ***
13489031-C-T 11333355-C-T ***
13472495-C-G 11316819-C-G ***
21363107-G-A 19201221-G-A ***
58890716-T-C 56700155-A-G ***
22364715-T-A 20202829-T-A DYZ19 ***
58854623-C-CATTCT 56736243-G-GGAATA ***
13733865-ACGAGCGCAA-TGGAGCGCAT 11578189-ACGAGCGCAA-TGGAGCGCAT ***
27528910-C-A 25382763-C-A P1_Y2 ***
24862222-G-A 22716075-G-A P3_b2 ***
7166601-CAT-C 7298560-CAT-C 20×AT***
22311274-G-T 20149388-G-T DYZ19 ***
58908850-C-A 56682021-G-T ***
58854627-C-CCATTG 56736239-G-GAATGC ***
19927008-A-T 17815128-A-T P5_Prx ***
28678123-TGGAGGCTTCAGTATGACAGAAACTTCCTGAAGACTTCTCCTACTGAAGCCTCCTGTGTTGGAGGCTTCTCCTCCTGAAGAGCCTCCAACACA-T 26531976-TGGAGGCTTCAGTATGACAGAAACTTCCTGAAGACTTCTCCTACTGAAGCCTCCTGTGTTGGAGGCTTCTCCTCCTGAAGAGCCTCCAACACA-T ***
24283316-C-A 22137169-C-A P3_t1 ***
20326065-G-T 18164179-G-T P5_Dst ***
9301608-C-T 9463999-C-T ***
22358162-T-C 20196276-T-C DYZ19 ***
23518998-C-A 21357112-C-A ***
22358161-G-T 20196275-G-T DYZ19 ***
22358154-G-A 20196268-G-A DYZ19 ***
14080035-G-GATAT 11959329-G-GATAT 29×AT***
13611863-G-T 11456187-G-T ***
9502520-TGGGGGGAGGGGGGAG-T 9664911-TGGGGGGAGGGGGGAG-T ***
15491941-GTA-G 13380061-GTA-G 19×TA***
27161532-T-A 25015385-T-A P1_g3 ***
22329797-G-T 20167911-G-T DYZ19 ***
13115283-C-T 10604769-C-T ***
25466379-T-G 23320232-T-G P2_r2 ***
22234333-T-A 20072447-T-A DYZ19 ***
28787059-AC-A 26640912-AC-A ***
23519079-A-G 21357193-A-G ***
13201895-T-C 11046219-T-C ***
13383684-G-A 11228008-G-A ***
22348822-G-T 20186936-G-T DYZ19 ***
19646962-C-T 17535082-C-T P5_Prx ***
20084888-C-T 17973008-C-T P5_Dst ***
20084849-G-T 17972969-G-T P5_Dst ***
20084748-C-T 17972868-C-T P5_Dst ***
20084640-G-T 17972760-G-T P5_Dst ***
20084638-G-T 17972758-G-T P5_Dst ***
20084593-A-T 17972713-A-T P5_Dst ***
20005039-A-T 17893159-A-T P5_Prx ***
19927035-G-T 17815155-G-T P5_Prx ***
19853713-T-A 17741833-T-A P5_Prx ***
19830187-G-T 17718307-G-T P5_Prx ***
19803131-T-C 17691251-T-C P5_Prx ***
19754356-C-A 17642476-C-A P5_Prx ***
19705846-G-A 17593966-G-A P5_Prx ***
19625942-A-G 17514062-A-G P5_Prx ***
20124971-T-C 18013091-T-C P5_Dst ***
19540893-G-T 17429013-G-T ***
19487491-G-T 17375611-G-T ***
19426761-C-T 17314881-C-T ***
19340026-G-T 17228146-G-T ***
19330760-G-A 17218880-G-A ***
19040318-T-C 16928438-T-C ***
19029823-C-A 16917943-C-A ***
18975181-T-C 16863301-T-C ***
18877933-T-A 16766053-T-A ***
18877882-C-A 16766002-C-A ***
18877734-A-C 16765854-A-C ***
18846008-T-C 16734128-T-C ***
18845993-C-A 16734113-C-A ***
20084906-C-T 17973026-C-T P5_Dst ***
20124972-G-A 18013092-G-A P5_Dst ***
18544200-C-T 16432320-C-T ***
21537782-C-A 19375896-C-A ***
22346947-A-T 20185061-A-T DYZ19 ***
22346944-G-T 20185058-G-T DYZ19 ***
22324456-A-G 20162570-A-G DYZ19 ***
22311134-C-T 20149248-C-T DYZ19 ***
22297126-G-T 20135240-G-T DYZ19 ***
22297124-C-G 20135238-C-G DYZ19 ***
22292641-T-C 20130755-T-C DYZ19 ***
22292563-A-G 20130677-A-G DYZ19 ***
22289805-G-T 20127919-G-T DYZ19 ***
22248014-A-G 20086128-A-G DYZ19 ***
22153687-G-A 19991801-G-A ***
21829861-G-A 19667975-G-A ***
21829853-T-A 19667967-T-A ***
21056558-G-T 18894672-G-T ***
20326430-C-T 18164544-C-T P5_Dst ***
21030683-G-A 18868797-G-A P4_Dst ***
20980831-A-G 18818945-A-G P4_Dst ***
20942891-T-G 18781005-T-G P4_Dst ***
20932612-G-A 18770726-G-A P4_Dst 17×A***
20896063-T-C 18734177-T-C P4_Dst ***
20872423-T-C 18710537-T-C P4_Dst ***
20736761-A-C 18574875-A-C P4_Prx ***
20682919-C-A 18521033-C-A P4_Prx ***
20534065-T-A 18372179-T-A P5_Dst ***
20532799-C-A 18370913-C-A P5_Dst ***
20500806-A-G 18338920-A-G P5_Dst ***
20353076-G-A 18191190-G-A P5_Dst ***
20331294-A-G 18169408-A-G P5_Dst ***
18626611-A-C 16514731-A-C ***
18531631-C-T 16419751-C-T P6_Dst ***
13393258-T-C 11237582-T-C ***
13489076-T-C 11333400-T-C ***
15117243-G-A 13005330-G-A ***
15103252-C-T 12991340-C-T ***
14959959-A-T 12848034-A-T ***
14634355-G-C 12522424-G-C ***
14515290-G-T 12403495-G-T ***
14515188-T-A 12403393-T-A ***
14122509-G-T 12001803-G-T ***
13748572-G-A 11592896-G-A ***
13744476-C-A 11588800-C-A ***
13730829-C-A 11575153-C-A ***
13730826-C-T 11575150-C-T ***
13726823-G-A 11571147-G-A ***
13580730-C-T 11425054-C-T ***
13489047-G-T 11333371-G-T ***
15214441-C-T 13102527-C-T ***
13489030-G-A 11333354-G-A ***
13486866-C-A 11331190-C-A ***
13471075-C-T 11315399-C-T ***
13470536-G-C 11314860-G-C ***
13470534-G-T 11314858-G-T ***
13470501-C-G 11314825-C-G ***
13470494-G-A 11314818-G-A ***
13470482-G-T 11314806-G-T ***
13470465-C-A 11314789-C-A ***
13470462-A-T 11314786-A-T ***
13464307-T-C 11308631-T-C ***
13461114-A-T 11305438-A-T ***
13461108-A-G 11305432-A-G ***
15121436-C-A 13009523-C-A ***
15444910-T-A 13333030-T-A ***
18527337-T-G 16415457-T-G P6_Dst ***
17648559-A-G 15536679-A-G ***
18380887-G-T 16269007-G-T P6_Prx ***
18361567-G-A 16249687-G-A P6_Prx ***
18361560-T-A 16249680-T-A P6_Prx ***
18361556-T-A 16249676-T-A P6_Prx ***
18361514-G-A 16249634-G-A P6_Prx ***
18361419-C-A 16249539-C-A P6_Prx ***
18360920-T-G 16249040-T-G P6_Prx ***
18280659-C-A 16168779-C-A P6_Prx ***
18255888-T-A 16144008-T-A 22×A***
18255882-T-A 16144002-T-A ***
18140295-T-C 16028415-T-C ***
18130877-A-T 16018997-A-T ***
17784750-A-G 15672870-A-G ***
17643892-G-A 15532012-G-A ***
15839196-C-T 13727316-C-T ***
17162294-G-T 15050414-G-T ***
17122867-G-T 15010987-G-T ***
17060977-T-C 14949097-T-C ***
16996974-A-G 14885094-A-G ***
16827132-T-G 14715252-T-G ***
16658399-A-C 14546519-A-C ***
16297361-A-T 14185481-A-T ***
16267062-C-A 14155182-C-A ***
16210722-G-T 14098842-G-T ***
16081738-A-T 13969858-A-T ***
16067818-A-T 13955938-A-T ***
16065912-T-C 13954032-T-C ***
15963224-G-T 13851344-G-T ***
58907479-GCAG-CCAT 56683389-CTGC-ATGG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Byrnes1325141011-12121212131429169-1011112515183216-16-17-17111119-231516201737-40121211915-1681010810101221-231610121217813252013131114111112123515916112426191311121211912121011113012132413101022151913241713152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 3B2TN*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs55
Variant counts last updated 2017-09-19 23:23:37.

* BED data not available. Using default values.


Big Tree Main Page