Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > A151 > FGC29772 > FGC29779

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
41613
BigY2
41613
FGC
CD2H6
24271286-C-T 22125139-C-T BY2223 P3_b1 ***A*
19303913-A-G 17192033-A-G FGC29775 Y+
14835327-A-T 12723394-A-T FGC29770 YY14×T+
5122666-C-T 5254625-C-T FGC29764 +
18150908-C-T 16039028-C-T FGC29774 YY+++
7774472-G-A 7906431-G-A FGC29765 BY3804 Y+
14242617-G-A 12121911-G-A FGC29769 YY+++
23777883-G-A 21615997-G-A FGC29778 Y+
13256206-G-A 11100530-G-A FGC29766 *
3712811-A-AGTGT 3844770-A-AGTGT ****
13329199-G-T 11173523-G-T **
23397148-C-A 21235262-C-A **
4908220-C-T 5040179-C-T **
17831279-T-A 15719399-T-A **
10693294-C-G **
17028830-C-A 14916950-C-A **
14142047-C-A 12021341-C-A **
18987016-C-A 16875136-C-A A17015 **
17718365-C-A 15606485-C-A **
10766566-G-C **
17158998-A-T 15047118-A-T **
15743978-C-A 13632098-C-A **
11673314-C-A **
10677446-C-A **
28336668-C-CAAAAAAA 26190521-C-CAAAAAAA P1_b4 31×A**
22199316-C-A 20037430-C-A **
2909108-C-A 3041067-C-A **
3576603-G-T 3708562-G-T **
3550654-C-A 3682613-C-A **
3492788-T-C 3624747-T-C **
3261439-T-A 3393398-T-A **
2985999-C-A 3117958-C-A **
2928151-A-T 3060110-A-T **
2915248-T-C 3047207-T-C **
2892566-G-T 3024525-G-T **
2762102-A-C 2894061-A-C **
2885666-G-A 3017625-G-A **
2847293-C-A 2979252-C-A **
2832806-C-G 2964765-C-G **
2817161-C-A 2949120-C-A **
2810390-G-A 2942349-G-A **
2784544-C-T 2916503-C-T **
15364046-C-A 13252166-C-A **
10693289-A-G **
13216475-C-A 11060799-C-A **
8020524-C-A 8152483-C-A **
11019895-C-A **
21482780-TTG-T 19320894-TTG-T **
19398088-C-A 17286208-C-A **
19379430-C-A 17267550-C-A **
9030316-C-A 9192707-C-A **
28801425-G-T 26655278-G-T **
13429982-C-A 11274306-C-A **
28605399-C-A 26459252-C-A **
9943646-C-A 10106037-C-A **
6459921-C-A 6591880-C-A **
16028394-C-A 13916514-C-A **
23723610-C-T 21561724-C-T **
18728880-C-A 16617000-C-A **
16481085-C-A 14369205-C-A **
11033837-A-T **
11025913-C-A **
23364277-C-A 21202391-C-A **
23052365-A-G 20890479-A-G **
11644176-C-A **
16904511-G-GA 14792631-G-GA 9×A**
10912008-C-A **
3728143-G-T 3860102-G-T **
27967238-GTA-G 25821091-GTA-G P1_Y2 **
22537092-C-A 20375206-C-A **
10632524-C-A **
3850058-C-A 3982017-C-A **
22882284-C-A 20720398-C-A **
10759859-C-A **
23052379-G-GA 20890493-G-GA **
5524055-C-A 5656014-C-A **
8735116-C-A 8867075-C-A **
5888274-C-A 6020233-C-A **
7186157-C-A 7318116-C-A **
14554323-C-A 12442524-C-A **
23052398-T-C 20890512-T-C **
23052382-A-G 20890496-A-G **
3624793-T-C 3756752-T-C **
4094548-G-C 4226507-G-C **
3844998-C-A 3976957-C-A **
6516272-C-A 6648231-C-A **
6773879-C-A 6905838-C-A **
6772593-C-A 6904552-C-A **
6752608-C-A 6884567-C-A **
6651391-C-A 6783350-C-A **
6646110-C-A 6778069-C-A **
6541320-C-A 6673279-C-A **
6374215-G-A 6506174-G-A **
6795201-C-A 6927160-C-A **
6355705-G-T 6487664-G-T **
6331149-T-C 6463108-T-C IR3_Dst **
6226129-A-T 6358088-A-T IR3_Dst **
6132535-C-A 6264494-C-A **
5969862-G-T 6101821-G-T **
5829206-C-A 5961165-C-A **
5786191-A-C 5918150-A-C **
6790206-C-A 6922165-C-A **
6881464-C-A 7013423-C-A **
5671675-G-T 5803634-G-T **
7186343-C-G 7318302-C-G **
7240906-C-A 7372865-C-A **
7240380-T-C 7372339-T-C **
7240379-C-G 7372338-C-G **
7209965-A-C 7341924-A-C **
7195259-T-C 7327218-T-C **
7186351-C-T 7318310-C-T **
7172368-G-T 7304327-G-T **
6953388-A-T 7085347-A-T **
7097340-C-A 7229299-C-A **
7086836-C-A 7218795-C-A **
7018041-T-TC 7150000-T-TC **
7014703-C-A 7146662-C-A **
6979665-C-A 7111624-C-A **
6977289-T-G 7109248-T-G **
6954821-C-A 7086780-C-A **
5780952-C-A 5912911-C-A **
5651236-G-T 5783195-G-T **
3845064-A-T 3977023-A-T **
4433629-T-C 4565588-T-C **
4700905-C-A 4832864-C-A **
4661044-C-A 4793003-C-A **
4582435-C-A 4714394-C-A **
4561562-T-C 4693521-T-C **
4542582-C-A 4674541-C-A **
4513759-A-G 4645718-A-G **
4417473-C-A 4549432-C-A **
4770487-G-T 4902446-G-T **
4292815-T-A 4424774-T-A **
4115108-C-A 4247067-C-A **
4107769-G-C 4239728-G-C **
4095043-C-T 4227002-C-T **
13962083-A-C 11841377-A-C **
4016536-A-G 4148495-A-G **
3992653-AT-A 4124612-AT-A **
4700939-A-G 4832898-A-G **
4899184-G-T 5031143-G-T **
5411992-A-G 5543951-A-G **
5193513-G-T 5325472-G-T **
5320496-G-T 5452455-G-T **
5320472-AT-A 5452431-AT-A **
5318207-A-G 5450166-A-G **
5264339-G-T 5396298-G-T **
5230927-C-A 5362886-C-A **
5230879-G-A 5362838-G-A **
5190825-C-A 5322784-C-A **
4925098-C-A 5057057-C-A **
5189698-A-G 5321657-A-G **
5011090-C-A 5143049-C-A **
4970275-T-G 5102234-T-G **
4958328-G-T 5090287-G-T **
4957118-C-A 5089077-C-A **
4951664-C-A 5083623-C-A **
4931991-A-C 5063950-A-C **
26991326-C-A 24845179-C-A P1_r4 **
5781829-C-A 5913788-C-A **
28649236-C-A 26503089-C-A **
17440754-C-A 15328874-C-A **
15423949-G-T 13312069-G-T **
15816587-C-A 13704707-C-A **
15952694-A-T 13840814-A-T **
6948334-C-T 7080293-C-T **
10980356-T-A **
23723607-G-T 21561721-G-T **
11025954-ATTCCC-A **
11025963-C-T **
10683661-A-ACCCCC **
10683632-T-C **
10683631-T-A **
10683627-T-C **
17158997-G-T 15047117-G-T **
11025977-T-C **
10980302-C-G **
11025951-T-A **
11025980-C-A **
10980272-C-T **
10980354-A-C **
10982326-C-A **
6992581-C-T 7124540-C-T **
10980384-C-G **
10980380-C-T **
10980363-TCAA-T **
10980362-T-TCTG **
10980344-C-G **
11025981-T-G **
10980337-A-C **
10980332-C-A **
10980329-A-C **
10980322-T-A **
10980320-C-A **
13394826-T-G 11239150-T-G **
26991332-G-T 24845185-G-T P1_r4 **
10980276-T-A **
5084121-C-A 5216080-C-A **
11022964-TTC-T **
15157860-CAAA-C 13045947-CAA-C 21×A**
21261826-TAA-T 19099940-TAA-T 26×A**
17420929-C-A 15309049-C-A **
24485750-A-T 22339603-A-T **
15235480-A-T 13123566-A-T 13×T**
9950933-A-AG 10113324-A-AG **
28614844-CTT-C 26468697-CTT-C 13×T**
18188853-G-T 16076973-G-T **
9509699-C-A 9672090-C-A **
13354883-G-A 11199207-G-A **
9371553-C-T 9533944-C-T **
19309422-CAT-C 17197542-CAT-C 19×AT**
24290840-T-A 22144693-T-A P3_t1 **
28671978-A-AT 26525831-A-AT 9×T**
25200987-G-GCAGTGAGGC 23054840-G-GCAGTGAGGC g1 14×AAGA**
7671307-TAC-T 7803266-TAC-T 17×AC********
21323597-G-T 19161711-G-T **
16612550-C-A 14500670-C-A **
10759189-T-TCCAAC **
10667010-A-T **
15404310-C-A 13292430-C-A **
7100988-A-T 7232947-A-T **
10755327-C-A **
10755323-A-T **
10888024-C-T **
10808593-C-T **
4408904-G-GA 4540863-G-GA 13×A**
10666993-C-G **
9953233-CTT-C 10115624-CTT-C 11×T**
10666980-A-C **
10666975-G-T **
10666956-T-C **
10666928-C-G **
18728870-C-A 16616990-C-A **
13394821-A-G 11239145-A-G **
19261128-CTTTT-C 17149248-CTTTT-C 21×T**
56742708-A-G **
11000442-C-A **
9416963-C-A 9579354-C-A **
15866171-T-A 13754291-T-A **
21409458-G-A 19247572-G-A **
8389596-A-T 8521555-A-T **
7100991-C-G 7232950-C-G **
14017511-C-A 11896805-C-A **
16297357-A-T 14185477-A-T **
22829644-C-A 20667758-C-A 18×A**
7180136-A-G 7312095-A-G **
4908207-C-A 5040166-C-A **
13255798-A-C 11100122-A-C **
15262428-C-A 13150512-C-A **
10995347-C-A **
15070614-CAAAA-C 12958705-CAAAA-C 20×A**
10845743-T-C **
10845713-T-C **
20888436-G-T 18726550-G-T P4_Dst **
4996064-C-A 5128023-C-A **
56830290-TTCCAC-T **
21911996-C-A 19750110-C-A **
10845718-T-C **
10759874-A-C **
56847982-T-G **
7309389-C-A 7441348-C-A **
3991766-C-A 4123725-C-A **
13564880-C-A 11409204-C-A **
3045938-C-A 3177897-C-A **
9013244-C-A 9175635-C-A **
4926247-G-T 5058206-G-T **
7621791-G-T 7753750-G-T **
17481256-C-A 15369376-C-A **
10683680-C-CATTTA **
26046017-C-T 23899870-C-T P1_Y1 **
6402592-C-A 6534551-C-A **
23036697-AAAG-A 20874811-AAAG-A **
18895684-C-A 16783804-C-A **
10694020-C-A **
17584161-C-G 15472281-C-G **
10892500-C-T **
8786719-G-T 8918678-G-T **
10746980-T-C **
23395924-C-A 21234038-C-A **
9968355-G-TT 10130746-G-TT **
15556758-C-A 13444878-C-A **
24904574-C-A 22758427-C-A g1 **
15252801-C-T 13140887-C-T **
10759887-CCGCAT-C **
13505061-C-A 11349385-C-A **
10759879-A-C **
21700620-T-A 19538734-T-A **
10992626-C-A **
7534678-T-G 7666637-T-G **
18328814-T-A 16216934-T-A P6_Prx **
9666705-G-T 9829096-G-T IR3_Prx **
4840177-C-A 4972136-C-A **
10892576-TC-T **
10828865-T-C **
6992553-C-CTT 7124512-C-CTT 17×T**
10667046-T-C **
5851287-C-A 5983246-C-A **
19410144-C-A 17298264-C-A **
21324256-G-T 19162370-G-T **
13354892-T-A 11199216-T-A **
6881217-C-A 7013176-C-A **
15940288-C-A 13828408-C-A **
10845748-T-C **
23488833-C-A 21326947-C-A **
14312236-C-A 12191530-C-A **
6769860-C-A 6901819-C-A **
8008132-C-A 8140091-C-A **
14421694-C-A 12300969-C-A **
4702938-C-A 4834897-C-A **
10970998-C-A **
10678220-A-C **
3286510-C-A 3418469-C-A **
7281763-G-C 7413722-G-C **
7510666-C-A 7642625-C-A **
7313432-TA-T 7445391-TA-T 8×A**
18165823-C-A 16053943-C-A **
18625918-G-T 16514038-G-T **
18381906-C-A 16270026-C-A P6_Gap **
18374447-G-T 16262567-G-T P6_Prx **
18263334-C-T 16151454-C-T **
18190643-A-G 16078763-A-G **
18186952-A-T 16075072-A-T **
18158533-C-A 16046653-C-A **
18756314-T-A 16644434-T-A **
17860798-A-G 15748918-A-G **
17854381-T-C 15742501-T-C **
17728658-C-G 15616778-C-G **
17728597-A-C 15616717-A-C **
17588759-C-A 15476879-C-A **
17549387-T-C 15437507-T-C **
17503685-T-A 15391805-T-A **
18672636-C-A 16560756-C-A **
18763755-A-T 16651875-A-T **
17449239-C-A 15337359-C-A **
19604799-C-A 17492919-C-A P5_Prx **
21118640-C-A 18956754-C-A **
21048197-T-C 18886311-T-C **
20989012-C-A 18827126-C-A P4_Dst **
20685122-C-A 18523236-C-A P4_Prx **
20661843-C-T 18499957-C-T P4_Prx **
20101690-G-A 17989810-G-A P5_Dst **
19489264-C-A 17377384-C-A **
18849412-C-A 16737532-C-A **
19449258-C-A 17337378-C-A **
19415471-T-C 17303591-T-C **
19340449-C-A 17228569-C-A **
19330572-T-A 17218692-T-A **
19286483-C-A 17174603-C-A **
18932649-G-T 16820769-G-T **
18856207-C-A 16744327-C-A **
17503287-G-T 15391407-G-T **
17243763-C-A 15131883-C-A **
21133373-T-A 18971487-T-A **
16044243-C-A 13932363-C-A **
16161018-T-A 14049138-T-A P8_Dst **
16092868-C-A 13980988-C-A **
16089755-G-T 13977875-G-T **
16084352-C-A 13972472-C-A **
16079349-T-A 13967469-T-A **
16045400-C-A 13933520-C-A **
16021269-C-A 13909389-C-A **
16228039-C-A 14116159-C-A **
15844878-C-A 13732998-C-A **
15841874-G-A 13729994-G-A **
15712322-A-G 13600442-A-G **
15688359-A-G 13576479-A-G Y68659 **
15679757-G-T 13567877-G-T **
15608182-C-A 13496302-C-A **
15556752-C-A 13444872-C-A **
16220701-C-A 14108821-C-A **
16290892-C-A 14179012-C-A **
17222679-C-A 15110799-C-A **
16688411-C-A 14576531-C-A **
17203385-T-G 15091505-T-G **
17061556-G-T 14949676-G-T **
16841976-C-T 14730096-C-T **
16823875-A-G 14711995-A-G **
16783603-G-A 14671723-G-A **
16738733-G-T 14626853-G-T **
16702887-C-G 14591007-C-G **
16605147-T-C 14493267-T-C **
16309398-C-T 14197518-C-T **
16602835-G-A 14490955-G-A **
16572709-G-C 14460829-G-C **
16522947-A-T 14411067-A-T **
16520758-C-T 14408878-C-T Y70062 **
16475214-A-G 14363334-A-G **
16427811-T-C 14315931-T-C **
16309400-A-T 14197520-A-T **
21133360-A-C 18971474-A-C **
21154588-C-T 18992702-C-T **
15396724-T-C 13284844-T-C **
24290848-A-T 22144701-A-T P3_t1 **
25995521-T-A 23849374-T-A P1_Y1 **
25509116-A-T 23362969-A-T P1_gr1 **
24518054-C-A 22371907-C-A **
24513620-C-A 22367473-C-A **
24378465-C-A 22232318-C-A **
24378449-A-C 22232302-A-C **
24290673-T-G 22144526-T-G P3_t1 **
27861870-G-A 25715723-G-A P1_Y2 **
24115135-C-A 21968988-C-A P3_b1 **
24115134-C-A 21968987-C-A P3_b1 **
23952403-T-A 21806256-T-A **
23881897-G-T 21720011-G-T **
23875285-C-T 21713399-C-T **
23848722-T-C 21686836-T-C **
23837799-T-C 21675913-T-C **
26228595-T-C 24082448-T-C P1_Y1 **
27914882-C-A 25768735-C-A P1_Y2 **
23773851-C-A 21611965-C-A **
28732974-G-T 26586827-G-T **
56836089-C-A **
56822729-G-T **
28779096-T-A 26632949-T-A **
28777858-C-A 26631711-C-A **
28765016-C-A 26618869-C-A **
28759618-T-A 26613471-T-A **
28743137-C-A 26596990-C-A **
28649261-A-G 26503114-A-G **
28465164-GA-G 26319017-GA-G 8×A**
28633696-C-A 26487549-C-A **
28632812-T-G 26486665-T-G **
28561860-T-A 26415713-T-A **
28533745-T-A 26387598-T-A **
28530894-A-G 26384747-A-G **
28486093-G-C 26339946-G-C **
28471451-C-A 26325304-C-A **
23837778-G-A 21675892-G-A **
23723111-A-T 21561225-A-T **
21239031-C-A 19077145-C-A **
21679179-G-T 19517293-G-T **
22123131-T-A 19961245-T-A **
22100990-G-A 19939104-G-A **
22100984-C-A 19939098-C-A **
22100976-C-T 19939090-C-T **
22085936-C-A 19924050-C-A **
21834140-A-G 19672254-A-G **
21597606-C-A 19435720-C-A **
22170441-T-C 20008555-T-C **
21476440-C-A 19314554-C-A **
21473815-C-A 19311929-C-A **
21444663-T-C 19282777-T-C **
21328661-C-A 19166775-C-A **
21323312-C-A 19161426-C-A **
21315230-C-A 19153344-C-A **
21285090-T-C 19123204-T-C **
22164449-G-A 20002563-G-A **
22176831-A-G 20014945-A-G **
23633432-AT-A 21471546-AT-A **
23004591-T-C 20842705-T-C **
23510588-C-A 21348702-C-A **
23341951-G-T 21180065-G-T **
23306615-G-A 21144729-G-A **
23199295-C-A 21037409-C-A **
23056164-A-G 20894278-A-G **
23052407-G-A 20890521-G-A **
23052392-C-T 20890506-C-T **
22903778-T-A 20741892-T-A **
22505894-C-A 20344008-C-A DYZ19 **
22857709-C-A 20695823-C-A **
22829634-G-A 20667748-G-A **
22829631-C-G 20667745-C-G **
22798310-T-C 20636424-T-C **
22767337-C-A 20605451-C-A **
22691526-G-T 20529640-G-T **
22598745-C-CAAA 20436859-C-CAAA 15×A**
15496370-C-A 13384490-C-A **
15210763-G-C 13098849-G-C **
7420734-A-C 7552693-A-C **
10759848-T-G **
10795869-T-C **
10777462-T-G **
10762703-C-A **
10759870-C-A **
10759865-C-T **
10759857-A-G **
10746990-T-A **
10811359-C-A **
10746972-C-CTGGTTGATTA **
10693295-A-C **
10693271-A-T **
10693269-A-T **
10672560-A-G **
10668687-A-G **
10657416-A-G **
10807472-T-C **
10812542-C-A **
10018290-C-A 10180681-C-A **
10899440-A-C **
10987204-T-G **
10987186-C-CCTTTT **
10987168-A-C **
10939761-C-A **
10932409-C-A **
10911422-C-A **
10892470-C-CCACAT **
10824426-C-A **
10870103-C-G **
10850189-C-G **
10845770-C-A **
10845715-C-A **
10844937-C-T **
10844796-T-C **
10844767-C-A **
10026181-C-A 10188572-C-A **
10015094-C-T 10177485-C-T **
10987223-A-ACTGCC **
8230442-C-A 8362401-C-A **
8825267-C-A 8957226-C-A **
8825257-A-G 8957216-A-G **
8806906-C-A 8938865-C-A **
8785655-C-A 8917614-C-A **
8379731-C-A 8511690-C-A **
8261180-C-A 8393139-C-A **
8080225-C-A 8212184-C-A **
9015946-C-A 9178337-C-A **
8072609-C-A 8204568-C-A **
8051946-C-A 8183905-C-A **
7918471-C-T 8050430-C-T **
7918467-G-T 8050426-G-T **
7918463-G-T 8050422-G-T **
7625203-C-A 7757162-C-A **
7536495-A-T 7668454-A-T **
9015324-C-A 9177715-C-A **
9034642-T-G 9197033-T-G **
9997993-C-A 10160384-C-A **
9557052-T-TCGG 9719443-T-TCGG IR3_Prx **
9996262-G-C 10158653-G-C **
9973466-G-C 10135857-G-C **
9941281-A-C 10103672-A-C **
9935969-C-A 10098360-C-A **
9865223-C-A 10027614-C-A **
9830930-C-A 9993321-C-A **
9772097-A-ATTT 9934488-A-ATTT 11×T**
9557047-GT-G 9719438-GT-G IR3_Prx **
9040365-T-G 9202756-T-G **
9465229-G-T 9627620-G-T **
9201285-C-A 9363676-C-A **
9131309-C-A 9293700-C-A **
9094535-C-A 9256926-C-A **
9079519-G-T 9241910-G-T **
9044051-G-C 9206442-G-C **
9040786-G-T 9203177-G-T **
10987220-T-G **
10988895-C-A **
15206111-G-A 13094197-G-A **
14347925-C-T 12227220-C-T **
14447366-C-A 12326639-C-A **
14441904-C-T 12321177-C-T **
14425660-C-A 12304935-C-A **
14401948-A-G 12281245-A-G **
14376178-T-A 12255474-T-A **
14352800-C-A 12232095-C-A **
14328039-A-G 12207333-A-G **
14459916-T-G 12339189-T-G **
14315579-C-A 12194873-C-A **
14313667-A-C 12192961-A-C **
14312306-T-G 12191600-T-G **
14278435-C-A 12157729-C-A **
14246913-C-A 12126207-C-A **
14225753-C-A 12105047-C-A **
14077959-C-A 11957253-C-A **
14458214-G-T 12337487-G-T **
14463376-C-A 12342649-C-A **
14071390-C-G 11950684-C-G Y90214 **
14686670-A-G 12574736-A-G **
15150895-A-G 13038982-A-G **
15137972-G-T 13026059-G-T **
15073257-G-T 12961347-G-T **
15060532-C-A 12948624-C-A **
14867097-T-C 12755167-T-C **
14858666-A-T 12746732-A-T 19×T**
14717582-C-T 12605650-C-T **
12555881-TCAAA-T **
14470500-G-C 12349769-G-C **
14586149-G-T 12474349-G-T **
14576001-A-G 12464201-A-G **
14566584-C-A 12454784-C-A **
14516966-A-G 12405167-A-G **
14516953-C-T 12405154-C-T **
14501891-C-A 12390096-C-A **
14474894-C-A 12354163-C-A **
14077938-G-T 11957232-G-T **
14070174-C-A 11949468-C-A **
10999326-G-T **
13234936-C-T 11079260-C-T **
13354913-T-A 11199237-T-A **
13354894-G-A 11199218-G-A **
13349849-A-T 11194173-A-T **
13331192-C-A 11175516-C-A **
13328837-C-A 11173161-C-A **
13234984-A-G 11079308-A-G **
13233463-C-A 11077787-C-A **
13489033-C-A 11333357-C-A **
13227935-C-A 11072259-C-A **
13225733-C-A 11070057-C-A **
13224761-C-A 11069085-C-A **
13198715-C-A 11043039-C-A **
11019113-C-T **
11013385-A-C **
11011512-G-T **
13469007-C-A 11313331-C-A **
13522855-C-A 11367179-C-A **
14069107-T-G 11948401-T-G **
11675101-C-A **
14055499-C-A 11934793-C-A **
14041697-C-A 11920991-C-A **
13941643-C-A 11820937-C-A **
13927047-C-A 11806341-C-A **
13809407-C-A 11688701-C-A **
11675674-C-A **
11675116-G-C **
11669308-C-A **
13523894-T-A 11368218-T-A **
11663207-G-A **
11653905-T-G **
11644649-A-T **
11643650-A-G **
13641302-C-A 11485626-C-A **
13603171-C-A 11447495-C-A **
13603140-C-A 11447464-C-A **
5338371-GATCTGTAGGTTCTCATATTTATTTATT-G 5470330-GATCTGTAGGTTCTCATATTTATTTATT-G **
56838555-C-A **
4222745-C-CA 4354704-C-CA 9×A**
22354307-G-A 20192421-G-A DYZ19 **
22346863-A-G 20184977-A-G DYZ19 **
13254626-G-A 11098950-G-A **
19073869-TAC-T 16961989-TAC-T 10×AC**
5147441-C-CAAAAA 5279400-C-CAAAAA 30×A**
21388665-CTCT-C 19226779-CTCT-C **
59001381-A-T 56855234-A-T **
9931303-T-C 10093694-T-C **
58999569-A-G 56853422-A-G **
22337441-A-G 20175555-A-G DYZ19 **
10064142-C-G 10226533-C-G **
18035697-A-T 15923817-A-T **
9946118-T-G 10108509-T-G **
22344146-A-G 20182260-A-G DYZ19 **
22351276-A-G 20189390-A-G DYZ19 **
13262769-T-C 11107093-T-C **
4661084-G-A 4793043-G-A S6157 **
3229154-C-A 3361113-C-A 20×A**
13203958-C-A 11048282-C-A **
22273654-C-G 20111768-C-G DYZ19 **
4661072-T-C 4793031-T-C **
9700780-C-CAAA 9863171-C-CAAA FGC5285 IR3_Prx 23×A**
7195307-C-A 7327266-C-A 16×A**
18643392-GAC-G 16531512-GAC-G 16×AC*****
18255888-T-A 16144008-T-A 22×A**
13262767-C-G 11107091-C-G **
15252782-C-A 13140868-C-A **
24567078-G-A 22420931-G-A FGC61344 P3_t2 **
15128141-C-T 13016228-C-T **
25954134-T-C 23807987-T-C P1_Y1 **
24290749-G-GCA 22144602-G-GCA P3_t1 20×CA**
13419165-G-GA 11263489-G-GA 8×A**
9945358-C-T 10107749-C-T FGC21143 **
19059747-C-T 16947867-C-T 25×T**
13203957-T-C 11048281-T-C **
9654385-A-G 9816776-A-G IR3_Prx **
9950937-TA-T 10113328-TA-T **
22273660-G-C 20111774-G-C DYZ19 **
13856301-T-C 11735595-T-C **
3051207-C-A 3183166-C-A **
14107068-A-C 11986362-A-C **
13140115-CATTAA-C 10629601-CATTAA-C **
13424582-T-G 11268906-T-G **
14339106-C-T 12218401-C-T 19×T**
16590649-T-C 14478769-T-C **
13203961-T-A 11048285-T-A **
13470450-T-A 11314774-T-A **
18042861-G-A 15930981-G-A CTS8473 ****
58910408-T-C 56680463-A-G ***
58875224-C-A 56715647-G-T ***
27306785-TTCA-T 25160638-TTCA-T P1_g3 ***
58847218-C-T 56743653-G-A 4×CCATT***
58849343-G-C 56741528-C-G ***
58850684-A-C 56740187-T-G ***
58872236-G-C 56718635-C-G ***
13699837-TC-AT 11544161-TC-AT ***
13864656-GACTCA-G 11743950-GACTCA-G ***
58819354-N-NTCCA ***
58890640-A-C 56700231-T-G ***
58906355-G-A 56684516-C-T ***
58908546-T-A 56682325-A-T ***
22267293-TAC-GGT 20105407-TAC-GGT DYZ19 ***
58911443-C-G 56679428-G-C ***
58910405-C-T 56680466-G-A ***
6090803-C-T 6222762-C-T ***
58819359-NNNGAA-N ***
58889841-T-C 56701030-A-G ***
58876136-G-A 56714735-C-T ***
58832664-G-A 56758207-C-T ***
22367956-G-T 20206070-G-T DYZ19 ***
10104558-N-A 10266949-N-A ***
22267319-C-G 20105433-C-G DYZ19 ***
10104557-N-G 10266948-N-G ***
58847195-GT-CA 56743675-AC-TG ***
22265873-GC-TG 20103987-GC-TG DYZ19 ***
22265856-GT-TA 20103970-GT-TA DYZ19 ***
22235089-AC-A 20073203-AC-A DYZ19 ***
14658026-CTTTT-C 12546091-CTTTT-C 16×T***
13648116-TAGTTG-CAGTGGACACA 11492440-TAGTTG-CAGTGGACACA ***
2772512-CA-C 2904471-CA-C 25×A***
58904203-G-A 56686668-C-T ***
58825356-G-A 56765515-C-T ***
58825314-CCATTCTATT-GCATACTACA 56765548-AATAGAATGG-TGTAGTATGC ***
58823047-A-C 56767824-T-G ***
22364901-T-G 20203015-T-G DYZ19 ***
22342383-T-C 20180497-T-C DYZ19 ***
5675282-G-T 5807241-G-T ***
58903361-T-C 56687510-A-G ***
22274010-C-T 20112124-C-T DYZ19 ***
58911450-CTTCAG-TTTCCC 56679416-CTGAAG-GGGAAA ***
58833044-T-A 56757827-A-T ***
58908514-GA-CC 56682356-TC-GG ***
58870585-TTAATTCGAGCCACCCA-T 56720268-GATGGGTGGCTCGAATT-G ***
58870550-TGTC-T 56720317-GGAC-G ***
58870539-A-AT 56720330-G-GA ***
58861657-TTTTGAA-ATTCGAT 56729208-TTCAAAA-ATCGAAT ***
58847251-GTTT-ATTC 56743617-AAAC-GAAT ***
58847195-G-C 56743676-C-G ***
10016724-T-C 10179115-T-C ***
58832592-A-C 56758279-T-G ***
13489598-CC-AA 11333922-CC-AA ***
22273629-C-G 20111743-C-G DYZ19 ***
22352888-ACTC-TATT 20191002-ACTC-TATT DYZ19 ***
22501987-A-T 20340101-A-T DYZ19 ***
22501960-A-T 20340074-A-T DYZ19 ***
22481686-T-C 20319800-T-C DYZ19 ***
22358332-C-A 20196446-C-A DYZ19 ***
22358325-G-A 20196439-G-A DYZ19 ***
13636000-G-A 11480324-G-A ***
22480584-GTTTGAA-G 20318698-GTTTGAA-G DYZ19 ***
15029495-CTTTT-C 12917583-CTTTT-C 16×T***
59007432-C-CTTTATT 56861285-C-CTTTATT 18×T***
58910216-TC-T 56680652-TG-T ***
13489604-CCC-ACT 11333928-CCC-ACT ***
10023199-C-A 10185590-C-A ***
13616457-G-T 11460781-G-T ***
10023435-T-C 10185826-T-C ***
58844974-G-T 56745897-C-A ***
10034484-C-A 10196875-C-A ***
58840387-T-A 56750484-A-T ***
22491691-G-T 20329805-G-T DYZ19 ***
10669379-C-A ***
22491418-C-A 20329532-C-A DYZ19 ***
10678627-C-A ***
10686715-C-A ***
22273755-A-T 20111869-A-T DYZ19 ***
22273733-G-C 20111847-G-C DYZ19 ***
22273773-A-T 20111887-A-T DYZ19 ***
22273721-G-T 20111835-G-T DYZ19 ***
22273695-C-G 20111809-C-G DYZ19 ***
22342808-A-C 20180922-A-C DYZ19 ***
58824665-T-A 56766206-A-T ***
58877159-A-C 56713712-T-G ***
22421551-G-A 20259665-G-A DYZ19 ***
22352673-C-A 20190787-C-A DYZ19 ***
22344126-G-T 20182240-G-T DYZ19 ***
22232344-T-C 20070458-T-C DYZ19 ***
20376135-A-T 18214249-A-T P5_Dst ***
13703175-T-G 11547499-T-G ***
7360373-C-T 7492332-C-T ***
3316459-T-C 3448418-T-C ***
13616470-T-G 11460794-T-G FGC23169 ***
22322568-A-T 20160682-A-T DYZ19 ***
22352681-A-T 20190795-A-T DYZ19 ***
10104555-N-T 10266946-N-T ***
23380570-CAAA-C 21218684-CAAA-C 13×A***
58872337-G-A 56718534-C-T ***
22292646-T-C 20130760-T-C DYZ19 ***
58848564-T-C 56742307-A-G ***
5792833-T-G 5924792-T-G YFS032851 ***
22354334-A-T 20192448-A-T DYZ19 ***
8230604-G-A 8362563-G-A ***
58824631-TTT-AAG 56766238-AAA-CTT ***
8555721-C-CA 8687680-C-CA 9×A***
20252796-C-CAAAAAA 18090910-C-CAAAAAA P5_Dst 24×A***
58872380-A-C 56718491-T-G ***
58847241-T-A 56743630-A-T ***
58847217-G-T 56743654-C-A ***
58830773-G-C 56760098-C-G ***
58824639-A-C 56766232-T-G ***
13393395-T-C 11237719-T-C ***
22328421-T-G 20166535-T-G DYZ19 ***
58876160-G-C 56714711-C-G ***
13203922-CGGC-TGGT 11048246-CGGC-TGGT ***
58898645-C-A 56692226-G-T A8827 ***
56829958-C-T ***
24386256-T-C 22240109-T-C ***
22949512-C-T 20787626-C-T 17×T***
27692964-A-T 25546817-A-T P1_Y2 ***
7146813-G-T 7278772-G-T ***
22273993-C-G 20112107-C-G DYZ19 ***
22127974-TC-T 19966088-TC-T ***
21623841-G-A 19461955-G-A ***
19754984-C-T 17643104-C-T P5_Prx ***
14412786-C-CA 12292083-C-CA 8×A***
13636016-C-T 11480340-C-T ***
15151489-T-G 13039576-T-G ***
24425341-A-ATGCG 22279194-A-ATGCG ***
10024429-C-CTTTCTTTCTG 10186820-C-CTTTCTTTCTG ***
28609569-TG-T 26463422-TG-T ***
3680532-C-A 3812491-C-A ***
22365607-A-C 20203721-A-C DYZ19 ***
58819361-NGA-N ***
22352870-ACA-CCT 20190984-ACA-CCT DYZ19 ***
58909962-G-C 56680909-C-G ***
58874429-G-C 56716442-C-G ***
58849337-T-C 56741534-A-G ***
13846624-GATATGCAATT-G 11725918-GATATGCAATT-G ***
13136457-T-C 10625943-T-C ***
22366759-ATTGTTTCTC-TTTTTTCCTT 20204873-ATTGTTTCTC-TTTTTTCCTT DYZ19 ***
19918178-TTTCCTTCT-ATTACTTTA 17806298-TTTCCTTCT-ATTACTTTA P5_Prx ***
19918169-TACCCTT-GA 17806289-TACCCTT-GA P5_Prx ***
19918164-T-TA 17806284-T-TA P5_Prx ***
14651296-C-A 12539361-C-A ***
58889745-T-C 56701126-A-G ***
19918141-CATTTGACTTCGTC-AATCAGTCTAGT 17806261-CATTTGACTTCGTC-AATCAGTCTAGT P5_Prx ***
58868072-G-C 56722799-C-G ***
8705698-C-T 8837657-C-T 16×T***
22343492-A-T 20181606-A-T DYZ19 ***
13457741-CA-C 11302065-CA-C ***
13457744-T-TA 11302068-T-TA ***
22307776-G-C 20145890-G-C DYZ19 ***
22356824-C-T 20194938-C-T DYZ19 ***
22535461-T-C 20373575-T-C ***
13140108-TCCAATCCATTAAACTC-T 10629594-TCCAATCCATTAAACTC-T ***
58907521-G-A 56683350-C-T ***
15507819-C-T 13395939-C-T ***
56835111-C-A ***
58904197-T-C 56686674-A-G ***
58883279-G-A 56707592-C-T ***
58839565-T-C 56751306-A-G ***
13110053-A-G 10599539-A-G ***
58839562-T-A 56751309-A-T ***
15507827-G-T 13395947-G-T ***
58832622-G-C 56758249-C-G ***
26362431-A-T 24216284-A-T P1_Y1 ***
23046158-C-A 20884272-C-A ***
58819360-NNGA-N ***
28022766-A-G 25876619-A-G P1_Y2 ***
22349275-G-A 20187389-G-A DYZ19 ***
58843242-T-G 56747629-A-C ***
9634139-T-C 9796530-T-C IR3_Prx ***
58911339-A-G 56679532-T-C ***
58859265-G-T 56731606-C-A ***
58832653-G-C 56758218-C-G ***
19918158-TCCTA-T 17806278-TCCTA-T P5_Prx ***
19918095-GA-AT 17806215-GA-AT P5_Prx ***
58877133-GT-TC 56713737-AC-GA ***
13329135-A-G 11173459-A-G ***
58832594-T-A 56758277-A-T ***
22344117-G-T 20182231-G-T DYZ19 ***
22343914-T-C 20182028-T-C DYZ19 ***
22343913-T-A 20182027-T-A DYZ19 ***
22265894-C-CAAGA 20104008-C-CAAGA DYZ19 ***
58847152-G-A 56743719-C-T ***
22265929-A-G 20104043-A-G DYZ19 ***
22481219-T-G 20319333-T-G DYZ19 ***
22265923-A-T 20104037-A-T DYZ19 ***
58911401-C-G 56679470-G-C ***
18735674-C-CTTTTT 16623794-C-CTTTTT 24×T***
22505177-T-G 20343291-T-G DYZ19 ***
22273781-G-C 20111895-G-C DYZ19 ***
22164374-TAC-AAA 20002488-TAC-AAA ***
22337744-TTGA-CTGG 20175858-TTGA-CTGG DYZ19 ***
22293051-A-T 20131165-A-T DYZ19 ***
58909785-C-CCACT 56681084-G-GGAGT ***
58830759-CATA-TAT 56760109-TATG-ATA ***
22342198-GCAT-TCAC 20180312-GCAT-TCAC DYZ19 ***
58861964-T-TC 56728905-T-TG ***
58915515-G-C 56675356-C-G ***
58868012-G-C 56722859-C-G ***
4388410-T-C 4520369-T-C ***
58849319-T-A 56741552-A-T ***
58832634-C-A 56758237-G-T ***
22342184-C-T 20180298-C-T DYZ19 ***
22342149-A-C 20180263-A-C DYZ19 ***
22276447-G-T 20114561-G-T DYZ19 ***
58832649-G-A 56758222-C-T ***
15171226-CTTTT-C 13059312-CTTTT-C 19×T***
13104555-A-ATCT 10594041-A-ATCT ***
25749309-GT-G 23603162-GT-G P1_b3 16×T***
13223520-A-G 11067844-A-G ***
10084452-G-T 10246843-G-T ***
58911316-CTCTAG-TTCGAT 56679550-CTAGAG-ATCGAA ***
14030243-C-A 11909537-C-A ***
15369007-C-A 13257127-C-A ***
58840473-GTCAATTCCT-TTGCATTACA 56750389-AGGAATTGAC-TGTAATGCAA ***
13992191-C-CA 11871485-C-CA 22×A***
22367644-C-G 20205758-C-G DYZ19 ***
22337141-T-C 20175255-T-C DYZ19 ***
13463154-A-T 11307478-A-T ***
58909781-CG-TGA 56681089-CG-TCA ***
16308523-A-C 14196643-A-C ***
58844900-AGAGGA-C 56745966-TCCTCT-G ***
22356799-TTG-GTC 20194913-TTG-GTC DYZ19 ***
22273771-C-G 20111885-C-G DYZ19 ***
22273721-GGTCT-TGTCC 20111835-GGTCT-TGTCC DYZ19 ***
22273771-CGA-GGT 20111885-CGA-GGT DYZ19 ***
58857553-C-A 56733318-G-T ***
10685646-C-A ***
17306299-C-A 15194419-C-A ***
58844989-G-T 56745882-C-A ***
58840199-A-T 56750672-T-A ***
58838334-T-C 56752537-A-G ***
27310395-A-T 25164248-A-T P1_g3 ***
22535457-G-A 20373571-G-A ***
22328232-G-T 20166346-G-T DYZ19 ***
10064129-T-G 10226520-T-G ***
2763814-G-C 2895773-G-C ***
22273725-T-C 20111839-T-C DYZ19 ***
19819554-A-T 17707674-A-T P5_Prx ***
22456875-T-G 20294989-T-G DYZ19 ***
22251619-A-T 20089733-A-T DYZ19 ***
22309516-CAC-TAA 20147630-CAC-TAA DYZ19 ***
22309444-AT-GA 20147558-AT-GA DYZ19 ***
22268227-TCCAGAG-CATAGAT 20106341-TCCAGAG-CATAGAT DYZ19 ***
13485854-CCG-TCA 11330178-CCG-TCA ***
5241165-CTC-TTT 5373124-CTC-TTT ***
22297249-GTT-CAG 20135363-GTT-CAG DYZ19 ***
19476635-C-A 17364755-C-A ***
14898435-C-CT 12786501-C-. 15×T***
58877061-C-A 56713810-G-T ***
58872247-T-A 56718624-A-T ***
58847905-G-C 56742966-C-G ***
58836512-C-T 56754359-G-A ***
22366039-G-T 20204153-G-T DYZ19 ***
22292129-C-T 20130243-C-T DYZ19 ***
22251587-C-T 20089701-C-T DYZ19 ***
27636974-GATT-CATC 25490827-GATT-CATC P1_Y2 ***
13703163-G-A 11547487-G-A ***
13129623-A-G 10619109-A-G ***
21211640-A-G 19049754-A-G ***
13129622-C-G 10619108-C-G ***
13129616-T-G 10619102-T-G ***
13129615-C-T 10619101-C-T ***
10022156-T-C 10184547-T-C FGC19274 ***
22337428-C-T 20175542-C-T DYZ19 ***
22504831-G-T 20342945-G-T DYZ19 ***
22341515-G-A 20179629-G-A DYZ19 ***
22268348-A-G 20106462-A-G DYZ19 ***
21528342-G-T 19366456-G-T ***
22268187-T-C 20106301-T-C DYZ19 ***
13436662-A-T 11280986-A-T ***
22421837-AGGTT-TGTTG 20259951-AGGTT-TGTTG DYZ19 ***
58872258-GC-TT 56718612-GC-AA ***
22010433-C-A 19848547-C-A ***
17382640-C-A 15270760-C-A ***
22268207-A-C 20106321-A-C DYZ19 ***
22365767-A-T 20203881-A-T DYZ19 ***
58870586-TAATTCGAGCCAC-T 56720272-GGTGGCTCGAATT-G ***
58870562-TGTATTTCA-T 56720300-ATGAAATAC-A ***
22263788-TGTTACAAC-CGTTTCAGT 20101902-TGTTACAAC-CGTTTCAGT DYZ19 ***
22232108-GTTC-AGTG 20070222-GTTC-AGTG DYZ19 ***
13467498-T-TC 11311822-T-TC ***
4151936-CA-C 4283895-CA-C 17×A***
17014785-C-A 14902905-C-A ***
59027472-T-TAAA 56881325-T-TAAA 11×A***
17170193-C-T 15058313-C-T ***
58838400-C-A 56752471-G-T ***
22365597-T-G 20203711-T-G DYZ19 ***
22352905-G-T 20191019-G-T DYZ19 ***
22337747-A-G 20175861-A-G DYZ19 ***
58909135-A-G 56681736-T-C ***
22337744-T-C 20175858-T-C DYZ19 ***
58890502-G-A 56700369-C-T ***
59027575-G-C 56881428-G-C ***
58847920-A-C 56742951-T-G ***
22481804-T-G 20319918-T-G DYZ19 ***
22366040-T-C 20204154-T-C DYZ19 ***
22366032-G-A 20204146-G-A DYZ19 ***
22337437-A-C 20175551-A-C DYZ19 ***
22268341-T-A 20106455-T-A DYZ19 ***
22268302-C-T 20106416-C-T DYZ19 ***
22268297-G-T 20106411-G-T DYZ19 ***
13567070-G-C 11411394-G-C ***
14491317-T-C ***
27637479-C-T 25491332-C-T P1_Y2 ***
22268350-A-G 20106464-A-G DYZ19 ***
27056034-T-C 24909887-T-C P1_r4 ***
22365805-G-A 20203919-G-A DYZ19 ***
13703147-C-A 11547471-C-A ***
13606903-G-A 11451227-G-A ***
13833439-T-TTGGAA 11712733-T-TTGGAA ***
22223591-A-T 20061705-A-T DYZ19 ***
13312323-G-A 11156647-G-A ***
22505107-T-G 20343221-T-G DYZ19 ***
22250888-T-A 20089002-T-A DYZ19 ***
13470621-G-A 11314945-G-A ***
13678597-C-G 11522921-C-G ***
23300554-CTT-C 21138668-CTT-C 16×T***
58833986-CCCATT-C 56756844-CAATGG-C 8×CCATT***
25678507-C-T 23532360-C-T P1_b3 ***
22352967-G-T 20191081-G-T DYZ19 ***
13469107-G-A 11313431-G-A ***
22260699-G-T 20098813-G-T DYZ19 ***
22503694-G-A 20341808-G-A DYZ19 ***
13436864-A-G 11281188-A-G ***
13804004-A-C 11683298-A-C ***
22491341-A-T 20329455-A-T DYZ19 ***
13453718-T-C 11298042-T-C ***
21118158-TAC-T 18956272-TAC-T 22×AC***
58976092-T-C 56829945-T-C ***
58982082-A-T 56835935-A-T ***
28800610-C-A 26654463-C-A ***
22234890-T-A 20073004-T-A DYZ19 ***
56826383-G-GATTCCATTCCATTCC ***
56829948-C-T ***
56835847-CCCACTCCATTCCAATCCGTGC-C,CCCACTCCATTCCAATCCGTGT ***
56835916-CTCAAT-C,CTCAAC ***
56835929-CACTCA-C,CTCTCC ***
22241462-A-C 20079576-A-C DYZ19 ***
22268200-G-T 20106314-G-T DYZ19 ***
22268343-T-C 20106457-T-C DYZ19 ***
5308801-G-T 5440760-G-T ***
58875234-G-T 56715637-C-A ***
27035480-CT-C 24889333-CT-C P1_r4 16×T***
5785679-GAAAG-AAAAA 5917638-GAAAG-AAAAA ***
13203971-C-A 11048295-C-A ***
22496169-TTTTG-CTTAC 20334283-TTTTG-CTTAC DYZ19 ***
22488489-GGTTTCTGT-AGTGTCTTC 20326603-GGTTTCTGT-AGTGTCTTC DYZ19 ***
22487825-G-T 20325939-G-T DYZ19 ***
22487844-G-T 20325958-G-T DYZ19 ***
13203955-CATCATT-GACAATA 11048279-CATCATT-GACAATA ***
13140079-CGTGTG-C 10629565-CGTGTG-C ***
26123230-T-TA 23977083-T-TA P1_Y1 14×A***
22755417-T-G 20593531-T-G ***
28802844-G-GAGCGA 26656697-G-GAGCGA ***
4136641-TAC-T 4268600-TAC-T 20×AC***
13203965-GA-G 11048289-GA-G ***
58875220-T-G 56715651-A-C ***
13468668-T-C 11312992-T-C ***
22248495-G-A 20086609-G-A DYZ19 ***
22421811-C-T 20259925-C-T DYZ19 ***
22496198-T-G 20334312-T-G DYZ19 ***
22309684-A-G 20147798-A-G DYZ19 ***
22341747-A-C 20179861-A-C DYZ19 ***
20569648-G-A 18407762-G-A P5_Dst ***
23377701-C-A 21215815-C-A ***
23315734-G-T 21153848-G-T ***
58863460-T-G 56727411-A-C ***
22268293-A-G 20106407-A-G DYZ19 ***
22289708-C-T 20127822-C-T BY22909 DYZ19 ***
22292886-C-G 20131000-C-G DYZ19 ***
22293063-A-C 20131177-A-C DYZ19 ***
22366828-G-T 20204942-G-T DYZ19 ***
22502509-G-A 20340623-G-A DYZ19 ***
22268217-T-A 20106331-T-A DYZ19 ***
22502042-G-C 20340156-G-C DYZ19 ***
17648640-C-T 15536760-C-T CTS7753 ***
22343981-T-C 20182095-T-C DYZ19 ***
22354889-C-T 20193003-C-T DYZ19 ***
22241438-G-C 20079552-G-C DYZ19 ***
22273631-G-T 20111745-G-T DYZ19 ***
58824613-CCATTCTAGT-GCATACTACA 56766249-ACTAGAATGG-TGTAGTATGC ***
58824606-ATC-TTG 56766263-GAT-CAA ***
28253491-C-CAAAA 26107344-C-CAAAA P1_b4 32×A***
22367094-ATGG-CTGT 20205208-ATGG-CTGT DYZ19 ***
9190971-A-AAC 9353362-A-AAC 18×AC***
6605511-T-TTA 6737470-T-TTA 14×TA***
5757308-CAAAAA-C 5889267-CAAAAA-C 18×A***
13535639-GTATATA-G 11379963-GTATATA-G 21×TA***
13457725-C-T 11302049-C-T ***
13463173-A-T 11307497-A-T ***
26499948-G-T 24353801-G-T P1_Y1 ***
58845675-G-A 56745196-C-T ***
11026407-G-T ***
22535336-G-C 20373450-G-C ***
58917665-N-A 56673206-N-T ***
58917666-N-A 56673205-N-T ***
58917664-N-G 56673207-N-C ***
28478036-TAT-GAG 26331889-TAT-GAG ***
22367118-GA-AG 20205232-GA-AG DYZ19 ***
22367107-C-A 20205221-C-A DYZ19 ***
9932691-A-G 10095082-A-G ***
9932677-T-C 10095068-T-C ***
13468777-T-A 11313101-T-A ***
58910219-ATTCCATTCC-A 56680642-TGGAATGGAA-T ***
22236782-CGA-TGG 20074896-CGA-TGG DYZ19 ***
13938875-T-C 11818169-T-C ***
13478754-TGTGCGGG-CGTGTGGA 11323078-TGTGCGGG-CGTGTGGA ***
22354872-T-TG 20192986-T-TG DYZ19 ***
11022900-T-A,C ***
7414277-CAA-C 7546236-CAA-C 27×A***
58890647-C-A 56700224-G-T ***
24408991-A-ACCCCCCC 22262844-A-ACCCCCCC 14×C***
9854343-CTTTTT-C 10016734-CTTTTT-C 19×T***
10772498-C-A ***
25990634-G-T 23844487-G-T P1_Y1 23×T***
22365813-C-T 20203927-C-T DYZ19 ***
13725297-G-A 11569621-G-A ***
22357103-C-A 20195217-C-A DYZ19 ***
13698836-A-T 11543160-A-T ***
22457188-T-G 20295302-T-G DYZ19 ***
58875241-ATTCCAT-CTGCCAG 56715624-ATGGAAT-CTGGCAG ***
58875205-GAT-CAG 56715664-ATC-CTG ***
58875196-TTTC-ATTG 56715672-GAAA-CAAT ***
58870596-CACCCA-GATCTC 56720270-TGGGTG-GAGATC ***
28802746-TTCAAATTGCATAGA-GTCGAATGTCAACC 26656599-TTCAAATTGCATAGA-GTCGAATGTCAACC ***
58889826-A-C 56701045-T-G ***
22268178-T-G 20106292-T-G DYZ19 ***
58841404-C-T 56749467-G-A ***
22358841-C-G 20196955-C-G DYZ19 ***
22421538-G-C 20259652-G-C DYZ19 ***
58823024-C-T 56767847-G-A ***
58823033-T-A 56767838-A-T ***
58829066-T-G 56761805-A-C ***
58832573-G-C 56758298-C-G ***
58845102-C-A 56745769-G-T ***
58889797-G-A 56701074-C-T ***
58847152-G-T 56743719-C-A ***
10946017-T-A ***
58847206-T-A 56743665-A-T ***
58875185-C-T 56715686-G-A ***
58875212-T-A 56715659-A-T ***
58876405-A-C 56714466-T-G ***
13140071-CTCGAGTGCGTGTGAT-C 10629557-CTCGAGTGCGTGTGAT-C ***
58917663-N-A 56673208-N-T ***
58840442-C-A 56750429-G-T ***
16005904-C-A 13894024-C-A ***
22235029-A-T 20073143-A-T DYZ19 ***
22419676-N-T 20257790-N-T DYZ19 ***
22341971-A-T 20180085-A-T DYZ19 ***
22337322-T-G 20175436-T-G DYZ19 ***
10090758-G-A 10253149-G-A ***
15410719-T-C 13298839-T-C ***
58844918-ATG-TTC 56745951-CAT-GAA ***
22504827-TTT-CGG 20342941-TTT-CGG DYZ19 ***
22353018-TG-T 20191132-TG-T DYZ19 ***
13140073-CGAGTG-C 10629559-CGAGTG-C ***
13140069-CACTCGAGTGCGTGTG-C 10629555-CACTCGAGTGCGTGTG-C ***
22353012-GG-AA 20191126-GG-AA DYZ19 ***
58877158-G-T 56713713-C-A ***
22352981-G-T 20191095-G-T DYZ19 ***
22435826-C-T 20273940-C-T DYZ19 ***
26499952-A-T 24353805-A-T P1_Y1 20×T***
22435823-T-C 20273937-T-C DYZ19 ***
22353013-G-A 20191127-G-A DYZ19 ***
13460188-C-G 11304512-C-G ***
13262752-C-A 11107076-C-A ***
58859270-C-T 56731601-G-A ***
22263829-ATG-TT 20101943-ATG-TT DYZ19 ***
16094316-C-A 13982436-C-A ***
22495769-CTCATC-TCACTT 20333883-CTCATC-TCACTT DYZ19 ***
13203970-CCACCCCGCCTC-TAAT 11048294-CCACCCCGCCTC-TAAT ***
22361071-CTA-AG 20199185-CTA-AG DYZ19 ***
13129690-TCAAATCTGTCAGT-AAAACTCTATGAGA 10619176-TCAAATCTGTCAGT-AAAACTCTATGAGA ***
59002262-AAA-G 56856115-AAA-G ***
13267431-CAAA-C 11111755-CAAA-C 16×A***
58851978-G-C 56738893-C-G ***
22535350-C-G 20373464-C-G ***
58828536-C-G 56762335-G-C ***
58917661-N-C 56673210-N-G ***
14412786-C-A 12292083-C-A 8×A***
58917660-N-T 56673211-N-A ***
58851946-G-C 56738925-C-G ***
58838415-T-A 56752456-A-T ***
58830817-C-T 56760054-G-A ***
14238412-CAAA-C,CAA 12117706-CAAA-C,CAA 12×A***
22420891-G-C 20259005-G-C DYZ19 ***
22361357-A-G 20199471-A-G DYZ19 ***
22344726-G-T 20182840-G-T DYZ19 ***
22344713-A-T 20182827-A-T DYZ19 ***
22342557-A-C 20180671-A-C DYZ19 ***
13703173-G-A 11547497-G-A ***
22273984-A-G 20112098-A-G DYZ19 ***
22273937-A-C 20112051-A-C DYZ19 ***
58917659-N-T 56673212-N-A ***
14424200-G-T 12303475-G-T ***
58859226-G-C 56731645-C-G ***
58864089-T-A 56726782-A-T ***
58917658-N-A 56673213-N-T ***
58917662-N-C 56673209-N-G ***
13682963-GAGTA-AAGTG 11527287-GAGTA-AAGTG ***
9964692-T-G 10127083-T-G ***
13460221-C-G 11304545-C-G ***
13468625-A-G 11312949-A-G ***
22292361-A-T 20130475-A-T DYZ19 ***
58820506-G-A 56770365-C-T ***
22245077-G-A 20083191-G-A DYZ19 ***
22355204-T-G 20193318-T-G DYZ19 ***
22245066-AT-A 20083180-AT-A DYZ19 ***
14452024-G-A 12331297-G-A ***
22245071-G-ACT 20083185-G-ACT DYZ19 ***
22292227-ATCCAGT-GTCAAGA 20130341-ATCCAGT-GTCAAGA DYZ19 ***
13725227-C-A 11569551-C-A ***
4767593-A-AT 4899552-A-AT 12×T***
58825351-G-A 56765520-C-T ***
58836590-C-T 56754281-G-A 4×CCATT***
28442370-T-C 26296223-T-C P1_gr2 ***
58823015-A-T 56767856-T-A ***
58823019-T-G 56767852-A-C ***
58823076-T-C 56767795-A-G ***
58823078-T-A 56767793-A-T ***
58823101-T-C 56767770-A-G ***
58823106-A-C 56767765-T-G ***
58824566-T-A 56766305-A-T ***
58824671-A-T 56766200-T-A ***
58824679-G-C 56766192-C-G ***
58824689-G-C 56766182-C-G ***
58830428-C-G 56760443-G-C ***
58832593-A-C 56758278-T-G ***
58836589-G-T 56754282-C-A ***
58840994-C-T 56749877-G-A 9×CCATT***
28399159-A-C 26253012-A-C P1_gr2 ***
58843154-T-C 56747717-A-G ***
58843730-A-T 56747141-T-A ***
58855073-A-C 56735798-T-G ***
58859378-C-A 56731493-G-T ***
58859851-C-T 56731020-G-A ***
58861537-T-A 56729334-A-T ***
58861542-G-A 56729329-C-T ***
58861550-A-T 56729321-T-A ***
58861576-A-G 56729295-T-C ***
58861581-A-C 56729290-T-G ***
58861617-A-G 56729254-T-C ***
58861630-A-C 56729241-T-G ***
58861631-G-C 56729240-C-G ***
58862126-A-T 56728745-T-A ***
28399162-A-G 26253015-A-G P1_gr2 ***
28022786-A-G 25876639-A-G P1_Y2 ***
58879591-G-T 56711280-C-A ***
27534629-T-A 25388482-T-A P1_Y2 ***
27136111-C-A 24989964-C-A P1_g3 ***
27158320-A-G 25012173-A-G P1_g3 ***
27158332-T-C 25012185-T-C P1_g3 ***
27162795-C-G 25016648-C-G P1_g3 ***
27202794-A-G 25056647-A-G P1_g3 ***
27254717-T-G 25108570-T-G P1_g3 ***
27254718-C-A 25108571-C-A P1_g3 ***
27307031-G-C 25160884-G-C P1_g3 ***
27384939-C-T 25238792-C-T P1_g3 ***
27512517-A-T 25366370-A-T P1_Y2 ***
27512518-A-G 25366371-A-G P1_Y2 ***
27512524-G-T 25366377-G-T P1_Y2 ***
27512525-G-T 25366378-G-T P1_Y2 ***
27512529-C-T 25366382-C-T P1_Y2 ***
27534638-C-A 25388491-C-A P1_Y2 ***
27954230-A-C 25808083-A-C P1_Y2 ***
27706421-C-T 25560274-C-T P1_Y2 ***
27864381-C-G 25718234-C-G P1_Y2 ***
27852600-A-G 25706453-A-G P1_Y2 ***
27806986-A-T 25660839-A-T P1_Y2 ***
27799220-C-A 25653073-C-A P1_Y2 ***
27750941-G-C 25604794-G-C P1_Y2 ***
27706481-G-C 25560334-G-C P1_Y2 ***
27701496-C-T 25555349-C-T P1_Y2 ***
27534639-T-G 25388492-T-G P1_Y2 ***
27701481-C-T 25555334-C-T P1_Y2 ***
27701473-G-A 25555326-G-A P1_Y2 ***
27701462-C-T 25555315-C-T P1_Y2 ***
27591793-G-A 25445646-G-A P1_Y2 ***
27591699-A-G 25445552-A-G P1_Y2 ***
27591696-A-T 25445549-A-T P1_Y2 ***
58875167-T-A 56715704-A-T ***
58879594-G-C 56711277-C-G ***
27124839-A-G 24978692-A-G P1_g3 ***
17990633-TTCGTCAGTTGG-ACCCTA 15878753-TTCGTCAGTTGG-ACCCTA P7_Prx ***
13140119-AAAC-A 10629605-AAAC-A ***
13222176-A-GAAG 11066500-A-GAAG ***
13223499-AAGG-GACA 11067823-AAGG-GACA ***
19815987-A-G 17704107-A-G P5_Prx ***
13454770-TCTTGTTGAATAAATTGCACTCTA-T 11299094-TCTTGTTGAATAAATTGCACTCTA-T ***
13467558-CAATGCCTC-TAAATCCCA 11311882-CAATGCCTC-TAAATCCCA ***
13467576-GAGCA-AAGTC 11311900-GAGCA-AAGTC ***
13703181-AAG-GAA 11547505-AAG-GAA ***
14624764-ATAAATT-A 12512964-ATAAATT-A ***
15336707-C-CAAAAAAAAAAA 13224825-C-CAAAAAAAAAAA 20×A***
16409013-CTTTT-C 14297133-CTTTT-C 18×T***
16598984-C-CA 14487104-C-CA 25×A***
16768498-CAAC-AAAA 14656618-CAAC-AAAA ***
16990223-CAAAAAAA-C 14878343-CAAAAAAA-C 24×A***
18688500-C-CAAATTAAAAA 16576620-C-CAAATTAAAAA 20×A***
9847289-ATTTTTTTTTTTTTT-A 10009680-ATTTTTTTTTTTTTT-A 28×T***
18965642-CTTTTTTT-C 16853762-CTTTTTTT-C 19×T***
19690411-GCA-CCC 17578531-GCA-CCC P5_Prx ***
19744991-ATTTTTT-A 17633111-ATTTTTT-A P5_Prx 23×T***
19759439-CTTC-TTTT 17647559-CTTC-TTTT P5_Prx ***
19789629-CCA-ACT 17677749-CCA-ACT P5_Prx ***
19815980-TTG-CTT 17704100-TTG-CTT P5_Prx ***
19815992-TAT-CATC 17704112-TAT-CATC P5_Prx ***
19815999-G-GA 17704119-G-GA P5_Prx ***
19816002-TA-T 17704122-TA-T P5_Prx ***
19816006-CATTT-GGTTC 17704126-CATTT-GGTTC P5_Prx ***
19816014-CT-C 17704134-CT-C P5_Prx ***
19816031-GG-T 17704151-GG-T P5_Prx ***
19816044-TTCTC-CCTT 17704164-TTCTC-CCTT P5_Prx ***
19826693-AT-A 17714813-AT-A P5_Prx ***
10084085-TATCAAAAGATCA-AACCATTAGAACG 10246476-TATCAAAAGATCA-AACCATTAGAACG ***
9634139-TTGTGTGTT-CTGTAGGTA 9796530-TTGTGTGTT-CTGTAGGTA IR3_Prx ***
58881422-G-T 56709449-C-A ***
58915557-T-A 56675314-A-T ***
58883887-G-T 56706984-C-A 4×CATTC***
58883888-C-G 56706983-G-C ***
58884750-C-A 56706121-G-T ***
58890615-T-C 56700256-A-G ***
58904202-C-A 56686669-G-T ***
58907240-G-C 56683631-C-G ***
58908557-T-C 56682314-A-G ***
58909200-C-T 56681671-G-A ***
58909264-A-G 56681607-T-C ***
58909829-G-T 56681042-C-A ***
58909834-C-T 56681037-G-A ***
58909983-C-G 56680888-G-C ***
58914193-A-C 56676678-T-G ***
58915543-T-G 56675328-A-C ***
58917318-A-C 56673553-T-G ***
9557453-TC-AA 9719844-TC-AA IR3_Prx ***
4981758-TA-T 5113717-TA-T 11×A***
8094788-TAC-CAG 8226747-TAC-CAG ***
7935855-TAAA-T 8067814-TAAA-T 22×A***
7269610-C-CTTTTT 7401569-C-CTTTTT 22×T***
6187840-ATTG-TGTC 6319799-ATTG-TGTC IR3_Dst ***
5740515-TA-T 5872474-TA-T 11×A***
19816022-G-A 17704142-G-A P5_Prx ***
4817267-CCTA-AATAG 4949226-CCTA-AATAG ***
13465138-CA-TG 11309462-CA-TG ***
4382449-CAA-C 4514408-CAA-C 17×A***
3957616-TA-T 4089575-TA-T 12×A***
3514522-CTTTT-C 3646481-CTTTT-C 16×T***
2856782-C-CCTTTTTT 2988741-C-CCTTTTTT 24×T***
2750839-CAAAAA-C 2882798-CAAAAA-C 16×A***
19753954-A-AT 17642074-A-AT P5_Prx 15×T***
27136107-G-T 24989960-G-T P1_g3 ***
26721925-G-A 24575778-G-A P1_g2 ***
20010081-ACCTACAAGGAGGAGCT-A 17898201-ACCTACAAGGAGGAGCT-A P5_Prx ***
20950885-G-C 18788999-G-C P4_Dst ***
20630988-C-T 18469102-C-T P4_Prx ***
20643399-T-A 18481513-T-A P4_Prx ***
20643405-A-G 18481519-A-G P4_Prx ***
20644720-G-A 18482834-G-A P4_Prx ***
20711078-A-G 18549192-A-G P4_Prx ***
20711079-G-A 18549193-G-A P4_Prx ***
20711080-G-A 18549194-G-A P4_Prx ***
20786138-C-T 18624252-C-T P4_Prx ***
20801048-A-T 18639162-A-T P4_Prx ***
20845368-T-G 18683482-T-G P4_Dst ***
20933113-T-A 18771227-T-A P4_Dst ***
20933121-C-A 18771235-C-A P4_Dst ***
20946550-A-T 18784664-A-T P4_Dst ***
20950880-T-C 18788994-T-C P4_Dst ***
20950892-C-A 18789006-C-A P4_Dst ***
20599447-C-G 18437561-C-G P5_Dst ***
21008944-T-A 18847058-T-A P4_Dst ***
22223627-A-C 20061741-A-C DYZ19 ***
22223703-A-T 20061817-A-T DYZ19 ***
22231968-C-A 20070082-C-A DYZ19 ***
22231970-C-A 20070084-C-A DYZ19 ***
22232217-A-G 20070331-A-G DYZ19 ***
22247639-A-G 20085753-A-G DYZ19 ***
22248047-G-T 20086161-G-T DYZ19 ***
22250926-A-T 20089040-A-T DYZ19 ***
22265842-G-C 20103956-G-C DYZ19 ***
22265843-T-A 20103957-T-A DYZ19 ***
22266577-G-A 20104691-G-A DYZ19 ***
22273598-T-C 20111712-T-C DYZ19 ***
22273936-A-C 20112050-A-C DYZ19 ***
20630963-C-T 18469077-C-T P4_Prx ***
20599446-C-A 18437560-C-A P5_Dst ***
22292756-A-G 20130870-A-G DYZ19 ***
20049538-T-C 17937658-T-C P5_Prx ***
19826700-T-C 17714820-T-C P5_Prx ***
19837585-T-C 17725705-T-C P5_Prx ***
19871857-G-A 17759977-G-A P5_Prx ***
19871858-C-T 17759978-C-T P5_Prx ***
19871859-A-C 17759979-A-C P5_Prx ***
19878887-C-A 17767007-C-A P5_Prx ***
19884388-T-C 17772508-T-C P5_Prx ***
19884392-T-A 17772512-T-A P5_Prx ***
19884394-T-G 17772514-T-G P5_Prx ***
19952411-T-C 17840531-T-C P5_Prx ***
19999133-A-G 17887253-A-G P5_Prx ***
20010075-T-C 17898195-T-C P5_Prx ***
20014892-G-T 17903012-G-T P5_Prx ***
20019030-T-C 17907150-T-C P5_Prx ***
20050558-G-A 17938678-G-A P5_Prx ***
20519680-G-A 18357794-G-A P5_Dst ***
20371305-T-C 18209419-T-C P5_Dst ***
20519667-C-A 18357781-C-A P5_Dst ***
20478143-A-G 18316257-A-G P5_Dst ***
20478114-C-A 18316228-C-A P5_Dst ***
20426917-A-C 18265031-A-C P5_Dst ***
20385229-A-G 18223343-A-G P5_Dst ***
20371321-T-A 18209435-T-A P5_Dst ***
20202390-A-G 18040504-A-G P5_Dst ***
20050589-G-A 17938709-G-A P5_Prx ***
20125152-G-T 18013272-G-T P5_Dst ***
20068698-C-T 17956818-C-T P5_Dst ***
20068692-G-T 17956812-G-T P5_Dst ***
20062126-G-T 17950246-G-T P5_Prx ***
20062124-A-T 17950244-A-T P5_Prx ***
20050635-C-G 17938755-C-G P5_Prx ***
22292752-G-C 20130866-G-C DYZ19 ***
22292759-G-C 20130873-G-C DYZ19 ***
26460350-A-G 24314203-A-G P1_Y1 ***
26056863-T-C 23910716-T-C P1_Y1 ***
25200980-A-C 23054833-A-C g1 ***
25601347-G-T 23455200-G-T P1_gr1 ***
25601353-T-G 23455206-T-G P1_gr1 ***
25642604-G-A 23496457-G-A P1_b3 ***
25657529-T-A 23511382-T-A P1_b3 ***
25678523-A-G 23532376-A-G P1_b3 ***
25680300-G-A 23534153-G-A P1_b3 ***
25709642-G-A 23563495-G-A P1_b3 ***
25800226-A-T 23654079-A-T P1_b3 ***
25800229-A-T 23654082-A-T P1_b3 ***
25856033-G-A 23709886-G-A P1_Y1 ***
25856034-G-A 23709887-G-A P1_Y1 ***
25856045-T-C 23709898-T-C P1_Y1 ***
25902471-A-T 23756324-A-T P1_Y1 ***
26056898-A-C 23910751-A-C P1_Y1 ***
24732621-T-G 22586474-T-G P3_b2 ***
26295495-T-A 24149348-T-A P1_Y1 ***
26460346-C-A 24314199-C-A P1_Y1 ***
26454867-C-A 24308720-C-A P1_Y1 ***
26422703-A-T 24276556-A-T P1_Y1 ***
26373229-C-A 24227082-C-A P1_Y1 ***
26372749-G-C 24226602-G-C P1_Y1 ***
26372743-C-T 24226596-C-T P1_Y1 ***
26295492-A-C 24149345-A-C P1_Y1 ***
26111869-T-C 23965722-T-C P1_Y1 ***
26185481-T-A 24039334-T-A P1_Y1 ***
26176802-G-A 24030655-G-A P1_Y1 ***
26156036-A-C 24009889-A-C P1_Y1 ***
26126935-A-T 23980788-A-T P1_Y1 ***
26111910-C-A 23965763-C-A P1_Y1 ***
26111871-G-C 23965724-G-C P1_Y1 ***
25200975-G-A 23054828-G-A g1 ***
24386280-A-C 22240133-A-C ***
22292762-T-A 20130876-T-A DYZ19 ***
22364810-C-G 20202924-C-G DYZ19 ***
22292763-C-A 20130877-C-A DYZ19 ***
22292765-T-A 20130879-T-A DYZ19 ***
22309729-C-T 20147843-C-T DYZ19 ***
22321198-C-T 20159312-C-T DYZ19 ***
22324867-T-A 20162981-T-A DYZ19 ***
22329827-G-T 20167941-G-T DYZ19 ***
22337214-G-A 20175328-G-A DYZ19 ***
22337227-T-G 20175341-T-G DYZ19 ***
22337729-C-T 20175843-C-T DYZ19 ***
22342035-A-T 20180149-A-T DYZ19 ***
22343479-G-T 20181593-G-T DYZ19 ***
22344085-T-C 20182199-T-C DYZ19 ***
22349277-C-A 20187391-C-A DYZ19 ***
22354325-G-A 20192439-G-A DYZ19 ***
22365770-A-G 20203884-A-G DYZ19 ***
24386279-T-C 22240132-T-C ***
22535444-G-A 20373558-G-A ***
24386255-T-C 22240108-T-C ***
24346217-A-G 22200070-A-G P3_t1 ***
24272513-A-C 22126366-A-C P3_b1 ***
24010664-A-T 21864517-A-T ***
19816055-T-C 17704175-T-C P5_Prx ***
22535447-T-A 20373561-T-A ***
22535431-G-A 20373545-G-A ***
22365781-G-T 20203895-G-T DYZ19 ***
22503943-T-G 20342057-T-G DYZ19 ***
22502639-C-G 20340753-C-G DYZ19 ***
22495720-C-A 20333834-C-A DYZ19 ***
22495695-T-A 20333809-T-A DYZ19 ***
22481839-A-T 20319953-A-T DYZ19 ***
22481736-C-A 20319850-C-A DYZ19 ***
19951311-GGT-TGTA 17839431-GGT-TGTA P5_Prx ***
20010101-AC-A 17898221-AC-A P5_Prx ***
58840215-T-C 56750656-A-G ***
9634144-T-G 9796535-T-G IR3_Prx ***
8893036-ATT-A 9024995-ATT-A 13×T***
13110016-G-A 10599502-G-A ***
13109641-C-G 10599127-C-G ***
10091209-A-C 10253600-A-C ***
10084453-G-C 10246844-G-C ***
10084103-T-A 10246494-T-A ***
10084102-G-A 10246493-G-A ***
10686608-TTCCAC-T,TTCCAT ***
9688148-G-T 9850539-G-T IR3_Prx ***
9688140-T-A 9850531-T-A IR3_Prx ***
9670758-A-C 9833149-A-C IR3_Prx ***
9670718-A-G 9833109-A-G IR3_Prx ***
9670706-C-T 9833097-C-T IR3_Prx ***
9634147-T-A 9796538-T-A IR3_Prx ***
9634143-G-A 9796534-G-A IR3_Prx ***
13121704-C-G 10611190-C-G ***
9624136-C-T 9786527-C-T IR3_Prx ***
9607733-C-A 9770124-C-A IR3_Prx ***
9575499-G-C 9737890-G-C IR3_Prx ***
9569343-T-A 9731734-T-A IR3_Prx ***
9565644-C-G 9728035-C-G IR3_Prx ***
9557454-C-A 9719845-C-A IR3_Prx ***
9557453-T-A 9719844-T-A IR3_Prx ***
9557451-C-A 9719842-C-A IR3_Prx ***
9342868-C-G 9505259-C-G ***
9204114-C-A 9366505-C-A ***
9204113-T-G 9366504-T-G ***
8094801-C-T 8226760-C-T ***
8094761-C-G 8226720-C-G ***
8094745-A-G 8226704-A-G ***
14845268-CTT-C 12733334-CTT-C 15×T***
13222915-A-G 11067239-A-G ***
17477501-T-G 15365621-T-G ***
15673884-A-G 13562004-A-G ***
13866809-CGG-AGG,C 11746103-CGG-AGG,C ***
14696732-C-A 12584798-C-A ***
17947063-C-A 15835183-C-A ***
18269174-C-A 16157294-C-A ***
21142393-C-A 18980507-C-A ***
22040221-C-A 19878335-C-A ***
22315296-A-T 20153410-A-T DYZ19 ***
22914410-C-A 20752524-C-A ***
23549745-C-A 21387859-C-A ***
25125867-T-C 22979720-T-C g1 ***
25211958-G-T 23065811-G-T P2_r1 ***
58827553-C-T 56763318-G-A ***
58995399-G-T 56849252-G-T ***
15675501-G-T 13563621-G-T ***
15673871-T-C 13561991-T-C ***
13463547-C-T 11307871-C-T ***
13725224-C-T 11569548-C-T ***
13478868-A-G 11323192-A-G ***
13579525-C-T 11423849-C-T ***
13636139-A-G 11480463-A-G ***
10946021-ATCCAC-A ***
15513751-CA-C 13401871-CA-C 9×A***
13703145-A-C 11547469-A-C ***
10657350-C-A ***
15673850-G-A 13561970-G-A ***
13732455-A-G 11576779-A-G ***
13739648-C-G 11583972-C-G ***
13739666-A-T 11583990-A-T ***
14787863-A-T 12675934-A-T ***
14990618-C-T 12878703-C-T ***
8501786-TTTC-T 8633745-TTTC-T 5×TTC***
6330225-A-C 6462184-A-C IR3_Dst 14×AC***
6330205-T-C 6462164-T-C IR3_Dst ***
13804075-T-A 11683369-T-A ***
9959346-C-T 10121737-C-T ***
22446150-TTA-T 20284264-TTA-T DYZ19 ***
13867517-G-GGCTCT 11746811-G-GGCTCT ***
13459565-C-CAGTTG 11303889-C-CAGTTG ***
13457753-T-C 11302077-T-C ***
21300233-C-A 19138347-C-A Z36493 ***
18738825-A-G 16626945-A-G ZS1586 ***
15876535-TA-T,TAA 13764655-TA-T,TAA 15×A***
16711066-TTA-T 14599186-TTA-T ***
13530079-CAA-C 11374403-CAA-C 24×A***
13457755-C-T 11302079-C-T ***
13453739-A-G 11298063-A-G Z19385 ***
13435442-T-C 11279766-T-C ***
13208770-GGAAGAAGAA-G,GGAA ***
13328895-C-G 11173219-C-G ***
9299763-A-T 9462154-A-T ***
17551743-C-A 15439863-C-A ***
13482162-G-A 11326486-G-A ***
9172684-C-A 9335075-C-A ***
24343462-AGGT-GGGG 22197315-AGGT-GGGG P3_t1 ***
22248076-G-A 20086190-G-A DYZ19 ***
28107462-G-T 25961315-G-T P1_Y2 ***
19826698-G-C 17714818-G-C P5_Prx ***
15450073-CT-C 13338193-CT-C 15×T***
58847786-T-A 56743085-A-T ***
19486895-G-T 17375015-G-T ***
23471038-CAAAAAAA-C 21309152-CAAAAAAA-C 19×A***
13820739-G-A 11700033-G-A ***
13489207-G-T 11333531-G-T ***
13483343-C-T 11327667-C-T ***
22450601-G-A 20288715-G-A DYZ19 ***
7137292-CAT-C 7269251-CAT-C ***
22357294-T-G 20195408-T-G DYZ19 ***
17963685-A-AT 15851805-A-AT 14×T***
6159368-G-T 6291327-G-T IR3_Dst ***
21085802-AAC-A 18923916-AAC-A ***
18848496-G-T 16736616-G-T ***
19045010-TAA-T,TA 16933130-TAA-T,TA 16×A***
6131157-A-G 6263116-A-G ***
5407344-A-G 5539303-A-G ***
5112510-G-T 5244469-G-T ***
4817278-T-C 4949237-T-C ***
22274109-A-T 20112223-A-T DYZ19 ***
22307771-A-T 20145885-A-T DYZ19 ***
22354328-C-G 20192442-C-G DYZ19 ***
22354348-C-A 20192462-C-A DYZ19 ***
24700874-G-A 22554727-G-A P3_b2 ***
58895922-A-C 56694949-T-G ***
13811825-G-A 11691119-G-A ***
13447698-A-CAACAC 11292022-A-CAACAC ***
3522968-TAAAAAAAAA-T 3654927-TAAAAAAAAA-T 24×A***
13726514-A-G 11570838-A-G ***
13267597-C-CAAAAAAAAA 11111921-C-CAAAAAAAAA 11×A***
22248092-C-T 20086206-C-T DYZ19 ***
2651883-C-CTTTTT 2783842-C-CTTTTT 19×T***
13735137-A-G 11579461-A-G ***
56830343-C-T ***
13136468-T-G 10625954-T-G ***
13488548-C-G 11332872-C-G ***
26943827-G-A 24797680-G-A P1_r3 ***
58910375-G-T 56680496-C-A ***
13482143-G-C 11326467-G-C ***
22337164-A-G 20175278-A-G DYZ19 ***
9569315-T-A 9731706-T-A IR3_Prx ***
9569319-A-G 9731710-A-G IR3_Prx ***
11643729-G-A ***
27306732-G-A 25160585-G-A P1_g3 ***
13859439-G-C 11738733-G-C ***
13804041-G-A 11683335-G-A ***
20010104-ATT-A 17898224-ATT-A P5_Prx ***
22502072-AG-A 20340186-AG-A DYZ19 ***
22309140-TTAC-ATCT 20147254-TTAC-ATCT DYZ19 ***
22322615-TCTG-CCGA 20160729-TCTG-CCGA DYZ19 ***
22333377-CT-GA 20171491-CT-GA DYZ19 ***
22333437-TGTCA-GATCT 20171551-TGTCA-GATCT DYZ19 ***
22337155-TAAGA-GAAAC 20175269-TAAGA-GAAAC DYZ19 ***
22337315-TTAA-ATCG 20175429-TTAA-ATCG DYZ19 ***
22344142-CTTCA-GTTCG 20182256-CTTCA-GTTCG DYZ19 ***
22344349-TTT-ATC 20182463-TTT-ATC DYZ19 ***
22350908-GA-TC 20189022-GA-TC DYZ19 ***
22354230-TTATG-AGA 20192344-TTATG-AGA DYZ19 ***
22356832-TAGA-CAGAC 20194946-TAGA-CAGAC DYZ19 ***
22357088-GG-AC 20195202-GG-AC DYZ19 ***
22357294-TGCAT-GGCAG 20195408-TGCAT-GGCAG DYZ19 ***
22495726-GT-CA 20333840-GT-CA DYZ19 ***
22504362-GGTT-TGTC 20342476-GGTT-TGTC DYZ19 ***
22289466-GCA-AC 20127580-GCA-AC DYZ19 ***
22504369-GT-TC 20342483-GT-TC DYZ19 ***
22535402-CA-C 20373516-CA-C ***
22535444-GTAT-ATAA 20373558-GTAT-ATAA ***
22535457-GGCAT-AGCAC 20373571-GGCAT-AGCAC ***
24386254-TTT-CACGTCC 22240107-TTT-CACGTCC ***
24386278-TTA-CACGTCC 22240131-TTA-CACGTCC ***
24425338-T-TGCAG 22279191-T-TGCAG ***
24508205-C-CTTTT 22362058-C-CTTTT 22×T***
24580049-G-GCT 22433902-G-GCT P3_t2 ***
24580643-CCCAGT-GAGAGG 22434496-CCCAGT-GAGAGG P3_t2 ***
24700956-GACACACACACAC-G 22554809-GACACACACACAC-G P3_b2 17×AC***
24755075-TG-CT 22608928-TG-CT P3_b2 ***
19784646-A-T 17672766-A-T P5_Prx ***
25601353-TGGT-GGGG 23455206-TGGT-GGGG P1_gr1 ***
22292749-T-TGGAACA 20130863-T-TGGAACA DYZ19 ***
22274031-CA-TC 20112145-CA-TC DYZ19 ***
25642611-AA-TACTTAT 23496464-AA-TACTTAT P1_b3 ***
20242479-T-TGGGGGGGGGG 18080593-T-TGGGGGGGGGG P5_Dst 12×G***
20010111-CTG-C 17898231-CTG-C P5_Prx ***
20010117-C-CT 17898237-C-CT P5_Prx ***
20010122-CCAATCAATAGAAAAAG-TTGCA 17898242-CCAATCAATAGAAAAAG-TTGCA P5_Prx ***
20010142-G-GC 17898262-G-GC P5_Prx ***
20010145-TCTT-CATTA 17898265-TCTT-CATTA P5_Prx ***
20019021-GGTTA-AAT 17907141-GGTTA-AAT P5_Prx ***
20025478-T-TTTCCCCCCC 17913598-T-TTTCCCCCCC P5_Prx ***
20050570-TCG-GCA 17938690-TCG-GCA P5_Prx ***
20050600-CCA-TCG 17938720-CCA-TCG P5_Prx ***
20050608-G-TC 17938728-G-TC P5_Prx ***
20050613-GGTGATGTATCT-G 17938733-GGTGATGTATCT-G P5_Prx ***
20050627-TCA-T 17938747-TCA-T P5_Prx ***
20050631-GT-G 17938751-GT-G P5_Prx ***
20050641-ATT-TTTTCC 17938761-ATT-TTTTCC P5_Prx ***
20320712-CCCTG-GCCTT 18158826-CCCTG-GCCTT P5_Dst ***
22273746-AGACCAAAAA-TGTCCAGAGT 20111860-AGACCAAAAA-TGTCCAGAGT DYZ19 ***
21235227-C-CAGTTAAA 19073341-C-CAGTTAAA 19×A***
22268417-C-CA 20106531-C-CA DYZ19 ***
22268181-GCAGCAT-ACAGCAC 20106295-GCAGCAT-ACAGCAC DYZ19 ***
22232539-AAACTATGGATATAACACCTT-TCTAAGGAAGTAGC 20070653-AAACTATGGATATAACACCTT-TCTAAGGAAGTAGC DYZ19 ***
22223603-AAAG-CAAC 20061717-AAAG-CAAC DYZ19 ***
22223532-ACTCGGGACATAACAC-GCCCTCCTT 20061646-ACTCGGGACATAACAC-GCCCTCCTT DYZ19 ***
22023201-C-CTTTTTTTTTTTTTT 19861315-C-CTTTTTTTTTTTTTT 20×T***
20950899-TG-CA 18789013-TG-CA P4_Dst ***
20371314-TGGCT-G 18209428-TGGCT-G P5_Dst ***
20711078-AGG-GAA 18549192-AGG-GAA P4_Prx ***
20697637-GT-AG 18535751-GT-AG P4_Prx ***
20643410-G-GTTTT 18481524-G-GTTTT P4_Prx ***
20638757-ACTT-GCTC 18476871-ACTT-GCTC P4_Prx ***
20581630-CATGGTTTTA-TGTGTTTCTT 18419744-CATGGTTTTA-TGTGTTTCTT P5_Dst ***
20519658-CTGTAG-C 18357772-CTGTAG-C P5_Dst ***
25606422-CAAAAA-C 23460275-CAAAAA-C P1_gr1 17×A***
25674643-TTT-GTG 23528496-TTT-GTG P1_b3 ***
13804039-T-C 11683333-T-C ***
20001265-A-T 17889385-A-T P5_Prx ***
28801446-C-A,T 26655299-C-A,T ***
13485616-G-A,T 11329940-G-A,T ***
13453722-T-A 11298046-T-A ***
19580761-T-G 17468881-T-G P5_Prx ***
13136464-G-A 10625950-G-A ***
13136469-T-A 10625955-T-A ***
21723784-TA-T 19561898-TA-T 10×A***
18528440-G-T 16416560-G-T P6_Dst ***
18488940-T-C 16377060-T-C P6_Dst ***
18443339-T-C 16331459-T-C P6_Dst ***
18362382-G-C 16250502-G-C P6_Prx ***
18362372-T-C 16250492-T-C P6_Prx ***
58979307-CCATTG-C,CCATTC 56833160-CCATTG-C,CCATTC ***
13136463-G-C 10625949-G-C ***
13809768-G-A 11689062-G-A ***
19728378-G-T 17616498-G-T P5_Prx ***
8690693-C-A 8822652-C-A ***
13804028-A-T 11683322-A-T ***
13804011-T-C 11683305-T-C ***
13482135-A-T 11326459-A-T ***
13456378-C-A 11300702-C-A ***
16121526-A-G 14009646-A-G P8_Prx ***
8709687-C-A 8841646-C-A ***
8390156-C-A 8522115-C-A ***
10017375-G-T 10179766-G-T ***
7863808-C-A 7995767-C-A ***
6427712-C-A 6559671-C-A ***
3550571-ACTC-A,ACCC 3682530-ACTC-A,ACCC ***
13866705-G-A 11745999-G-A ***
13804033-C-A 11683327-C-A ***
19048949-T-A 16937069-T-A ***
28801441-T-A 26655294-T-A ***
59007959-C-CAAAAA 56861812-C-CAAAAA 26×A***
26056945-GCCA-G 23910798-GCCA-G P1_Y1 ***
58830719-CATTA-TAT 56760148-TAATG-ATA ***
26156037-GGGTT-TGCTC 24009890-GGGTT-TGCTC P1_Y1 ***
26372733-GGA-ATGT 24226586-GGA-ATGT P1_Y1 ***
26499950-GTA-TTT 24353803-GTA-TTT P1_Y1 ***
27149936-AAA-CTG 25003789-AAA-CTG P1_g3 ***
27512517-AAGAG-TGGA 25366370-AAGAG-TGGA P1_Y2 ***
27534633-A-AG 25388486-A-AG P1_Y2 ***
27534638-CT-AG 25388491-CT-AG P1_Y2 ***
28013525-A-CTCAT 25867378-A-CTCAT P1_Y2 ***
28043595-GA-G 25897448-GA-G P1_Y2 ***
28399159-ATTA-CTTG 26253012-ATTA-CTTG P1_gr2 ***
19784644-A-T 17672764-A-T P5_Prx ***
58819330-N-NAT ***
58824576-ATAG-TTAC 56766292-CTAT-GTAA ***
58824585-ATTCCTTTGCCTTCCAT-TTTTGATTCCCTGCCAG 56766270-ATGGAAGGCAAAGGAAT-CTGGCAGGGAATCAAAA ***
58840421-GATTTAGTTCG-CATTTGTTTCC 56750440-CGAACTAAATC-GGAAACAAATG ***
58972232-CTGT-C 56826085-CTGT-C ***
58909821-AT-CC 56681049-AT-GG ***
58917655-TCN-T ***
58917654-TTCN-T ***
58917306-CCATTG-ACACTA 56673560-CAATGG-TAGTGT ***
58916668-CG-TT 56674202-CG-AA ***
58911368-CAATTCCA-GCAGTCTT 56679496-TGGAATTG-AAGACTGC ***
58911354-TATTCCG-GAGACCT 56679511-CGGAATA-AGGTCTC ***
58909792-CATGT-TATGC 56681075-ACATG-GCATA ***
58847167-GTCTCTTCAC-TTCCA 56743695-GTGAAGAGAC-TGGAA ***
58909249-TGATG-CGTTT 56681618-CATCA-AAACG ***
58909234-TGATGT-CGATGA 56681632-ACATCA-TCATCG ***
58861642-GTACGATTCC-ATTGGAGTCA 56729220-GGAATCGTAC-TGACTCCAAT ***
58859246-TGATG-CGAT 56731621-CATCA-ATCG ***
58848620-CA-C 56742249-AT-A ***
58847259-AGATT-CGATG 56743608-AATCT-CATCG ***
13453582-CCACTCGGAGT-C 11297906-CCACTCGGAGT-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page