Tree Position

R-P312/S116 > Z290 > L21/S145 > DF63/S522 > CTS6919 > A92 > Z16506 > BY674 > ~19755919-G-A > 15829160-T-C

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
113242
FTDNA
113242
26659152-G-T A*
11557106-T-C A*
14781627-C-T 12669697-C-T YY**+
21929740-TC-T 19767854-TC-T **+
16641386-C-T 14529506-C-T CTS6056 Z1123 YY**+
15693255-C-G 13581375-C-G YY***+
14215340-CACTCCATGT-C 12094634-CACTCCATGT-C **+
2687840-C-G 2819799-C-G YY**+
8769735-GGGTGGCTGAGTTCCTCCACCTCCCTGGCCAAGA-G 8901694-GGGTGGCTGAGTTCCTCCACCTCCCTGGCCAAGA-G +
17716251-T-C 15604371-T-C YY**+
22904820-C-A 20742934-C-A YY***+
18388574-TCCTTGTCAAATTTGCTTC-T 16276694-TCCTTGTCAAATTTGCTTC-T P6_Gap **+
8353484-CCAGAG-C 8485443-CCAGAG-C ***+
6905462-GTTATACTGTATTGGTTTTTTATTTGTATT-G 7037421-GTTATACTGTATTGGTTTTTTATTTGTATT-G **+
18063802-A-G 15951922-A-G F2692 M2239 S20571 YY**+
16967534-C-A 14855654-C-A YY**+
22887562-C-A 20725676-C-A YY***+
23099749-CATATGTATACATGTGAAA-C 20937863-CATATGTATACATGTGAAA-C **+
17710302-G-A 15598422-G-A YY**+
13199453-G-T 11043777-G-T **+
7031905-C-A 7163864-C-A Y***+
21144411-GCCACTACCACCATC-G 18982525-GCCACTACCACCATC-G +
15565866-C-A 13453986-C-A YY**+
11723282-T-A *
11723286-A-T *
20438884-GAA-G *
13939967-T-TA *
7401645-G-T **
7356634-C-A **
9938654-C-A **
7449485-C-A **
7410716-C-T **
7425125-C-A **
7447823-C-A **
7337307-T-A **
7455652-C-A **
7484472-C-A **
7497466-A-G **
7519386-A-T **
7346659-C-A **
15181267-C-A **
15162413-C-A **
15254895-A-G **
7002563-C-A **
7003572-C-A **
7016824-C-A **
7030791-C-A **
15324613-G-T **
7061840-C-A **
7063144-C-A **
7064825-G-T **
15288997-G-A **
15281965-C-A **
7085436-C-A **
7152276-C-A **
7324319-C-A **
7152283-C-A **
7153880-G-A **
7162101-C-A **
7167569-C-A **
15222773-A-AT **
15214010-G-T **
7290851-C-A **
7530027-CTTAGCG-C **
15168984-C-A **
15164148-C-A **
7319662-C-A **
7324178-C-A **
7519396-G-T **
14937743-C-A **
14977616-C-A **
8304646-CTTTTTTTT-C **
8053207-T-A **
14672337-A-G **
8066934-C-A **
8077501-CT-C **
14657479-TG-T **
14650284-C-A **
14604086-C-A **
14593151-A-G **
14555140-T-A **
8260357-C-A **
14528198-C-A **
14516726-A-G **
14694907-C-A **
14497159-C-A **
8403410-A-G **
14490185-C-A **
14487100-TCAACA-T **
8442872-G-T **
14476368-C-A **
8449091-C-A **
8471652-A-G **
8482255-T-A **
8484355-C-A **
14471545-C-A **
14688803-T-A **
8031153-C-A **
7546953-C-A **
7769939-C-A **
14962042-C-A **
7597764-C-A IR1_L **
7605958-C-A IR1_L **
14920929-C-A **
7704653-C-A **
7713721-A-G **
7724287-C-G **
14891084-C-A **
14854992-C-A **
7749645-T-C **
14846318-TG-T **
7778378-A-G **
8022412-T-C **
7796879-C-A **
7813110-C-A **
7817425-A-C **
7826979-C-A **
7835378-C-A **
7855494-A-G **
7913329-C-A **
7921811-G-T **
14769960-C-A **
7925312-C-A **
7954261-C-A **
7988544-C-A **
7001435-C-T **
6839336-C-A **
6948446-A-G **
2950210-C-T **
15744886-C-A **
2870336-C-A **
2870929-C-A **
15719380-A-T **
2898748-C-A **
15694998-C-A **
2899070-C-A **
2905677-A-C **
2928086-C-A **
2946836-TAAAA-T **
2950165-C-A **
2967566-C-A **
10747001-TCC-T **
2980570-C-A **
3003945-C-A **
3009289-C-A **
15657856-C-T **
15657851-G-C **
15608067-C-A **
3056026-G-T **
3057934-C-A **
15593199-C-A **
3195685-T-TAA **
3195760-C-G **
15761809-AGTAGTAAT-A **
15767937-C-A **
3224387-C-A **
10977100-C-A **
15782434-C-A **
7014404-C-A **
20612983-CTTTT-C **
20599000-C-A **
10759929-A-G **
11901391-C-A **
20003316-C-A **
9887573-C-A IR3_Prx **
12958705-CAAAAAAA-C **
10977080-C-CTGCAT **
10977088-C-T **
10977105-T-C **
4653281-TAAA-T **
3932051-AACAC-A **
15817012-C-G **
18039525-T-G P5_Dst **
18039482-T-TG P5_Dst **
6089153-C-A **
26573222-T-C **
19963302-C-A **
56843732-C-A **
15797552-C-A **
8822210-G-C **
15121894-C-A **
3208028-C-CTT **
3403475-C-T **
6942520-G-A **
6577900-G-A **
6133863-C-A **
6155977-G-T **
6171303-G-T **
6172107-C-A **
6252336-A-G **
15501776-C-A **
6487575-C-T **
6518014-C-A **
6520893-C-A **
6523111-A-T **
6531528-G-T **
6764924-G-T **
5928916-GAA-G **
15479813-G-T **
6786867-A-G **
15457078-G-T **
15435585-C-A **
6829007-C-A **
15435572-T-A **
6839356-C-A **
15435551-C-A **
6847767-C-A **
15420627-C-A **
15395107-G-A **
6095499-T-C **
5910802-A-T **
3406766-C-A **
15525315-C-A **
15534837-C-A **
3554084-C-A **
3676989-C-A **
3710543-A-G **
3731340-C-A **
4104045-C-A **
4128998-C-A **
4140998-G-T **
4199209-C-A **
4268793-T-C **
4389088-C-A **
4603507-G-T **
5626738-C-A **
4694814-G-T **
4758709-C-A **
4912641-C-T **
5004306-C-A **
5033652-C-G **
5063843-T-C **
5240047-T-C **
15503365-C-A **
5490386-C-A **
5552539-C-A **
5605276-G-T **
8529785-C-A **
8613043-A-T **
8534811-C-A **
11779043-C-A **
11643309-C-A **
11655685-A-G **
11655686-C-G **
11655691-G-T **
11678152-G-T **
11684168-A-G **
11687400-G-T **
11712770-G-T **
13343833-C-A **
11734889-C-A **
11820587-C-A **
11548289-G-A **
13300926-C-A **
11903592-C-A **
13279304-A-G **
11950648-CTTTTTT-C **
13263972-C-A **
11994818-C-A **
11996055-G-T **
12019156-C-A **
12032196-C-A **
12064644-C-A **
12079717-C-A **
11564811-G-T **
11525749-C-A **
12085542-C-A **
13418498-A-G **
13511464-AT-A **
13503821-C-A **
11298077-C-A **
11298080-TC-T **
11298099-T-A **
13502629-C-A **
13499930-C-T **
11307772-C-A **
13475958-ACAGAGGTTGCAGTG-A **
11311171-T-C **
13438292-C-A **
11315563-G-T **
13364519-C-A **
11317891-G-A **
11327177-C-A **
13388884-G-A **
11330039-A-T **
11330057-G-C **
11330104-G-C **
13371004-GC-G **
11429873-C-A **
11430210-G-T **
13364546-A-G **
11449674-C-A **
13260627-C-A **
12085585-C-A **
11098203-T-C **
12956945-A-T **
12332958-AC-A **
12355886-C-A **
12363766-A-T **
13047080-C-A **
13033101-C-A **
13024129-C-A **
12397043-C-A **
12438440-T-A **
12458144-ATTTAAAG-A **
12459537-C-A **
12466340-C-A **
12895130-C-A **
12331466-C-A **
12509306-C-A **
12514972-C-A **
12539908-C-A **
12869914-C-A **
12542183-C-A **
12636155-C-T **
12793420-C-CT **
12652297-C-A **
12749548-C-A **
12703153-A-T **
12746732-A-ATTT **
12332499-A-T **
12310242-C-A **
13232660-C-A **
12161157-C-A **
12092531-C-A **
12106013-C-A **
13224082-G-A **
13201553-C-A **
12117279-G-T **
12117280-A-G **
12117711-A-G **
12119914-C-A **
12127859-T-C **
12146050-G-T **
13151959-C-A **
12161196-C-A **
12305622-C-A **
13122565-A-T **
12189837-C-T **
12203825-C-A **
13120920-C-A **
12206505-C-T **
12208816-C-A **
13110871-C-A **
13108353-T-C **
13090680-C-A **
12286120-C-A **
12294980-C-A **
11098345-TC-T **
11081209-C-A **
14440718-C-A **
8974489-G-T **
14200153-C-A **
8838699-C-A **
14182510-C-A **
8852763-C-A **
14128716-C-T **
14121450-T-C **
14119910-C-A **
14079927-C-A **
8969396-A-G **
8970580-C-T **
8985360-G-T **
8801378-C-A **
8997705-C-A **
14072850-C-A **
8999008-C-A **
9025670-G-T **
9141084-A-G **
13982380-C-A **
9180640-C-A **
13964704-A-G **
13945610-C-A **
9245955-CT-C **
9266835-G-A **
8808785-C-A **
14209885-G-A **
9533871-A-ATG **
14306872-G-A **
8539170-C-A **
8539747-C-A **
14403902-C-A **
8573666-C-A **
14380392-C-T **
8575114-C-T **
8613037-A-T **
15835345-C-T **
8613056-A-T **
8613054-TTA-T **
8629681-G-A **
14302497-C-A **
14226321-C-A **
8672604-C-A **
8672680-C-A **
8717559-C-T **
14295578-C-A **
8721934-C-A **
14292462-C-A **
8726990-C-A **
8763418-A-T **
8763429-A-T **
14232512-C-T **
14228536-C-A **
13896876-A-G **
9589779-C-A **
11070525-G-A **
10816518-G-T **
10626563-G-T **
10627402-CCA-C **
10667012-TC-T **
10671030-C-A **
10677243-C-A **
10694121-G-T **
13571995-C-A **
10755010-T-A **
10768873-C-G **
10772409-T-G **
10781364-C-A **
10816533-A-T **
13578301-C-A **
13566708-C-A **
10837846-CA-C **
10888390-TC-T **
10944114-C-T **
11011524-A-G **
11011537-A-G **
11014492-C-TGGTAG **
11014952-C-A **
11020825-C-A **
11049557-C-A **
11064769-G-T **
10625036-C-A **
10178196-C-A **
13874931-C-A **
13679381-T-C **
9601360-C-A **
13864270-C-A **
9624543-G-T **
9651994-C-A **
9653504-C-A **
13800767-C-A **
13789542-C-A **
9769002-G-T IR3_Prx **
13709691-C-T **
13692023-A-T **
9926345-G-T **
13658172-C-A **
13595014-C-A **
10001771-A-G **
13612356-T-A **
10035550-C-A **
13612002-C-A **
10051672-G-A **
10088304-C-A **
10090181-C-A **
10096978-C-A **
10111296-G-A **
13603821-G-T **
13596128-C-A **
11310278-A-T **
3023150-C-A **
10764571-A-ACACCGTTGCG **
20038805-C-A **
20392881-C-A **
20374887-T-C **
20317989-C-A DYZ19 **
20281207-G-C DYZ19 **
20277965-G-T DYZ19 **
20136082-C-A DYZ19 **
20096105-C-A DYZ19 **
19968306-G-T **
20491281-C-A **
19966078-G-A **
19963740-C-T **
19869682-C-A **
19863504-C-A **
19856994-C-A **
19814190-G-T **
19813341-A-G **
19807703-T-A **
20451706-C-A **
20520410-G-A **
19783633-C-A **
20892700-G-A **
20991192-C-A **
20985525-C-A **
20976608-T-A **
20974266-G-T **
20966983-G-T **
20955781-C-A **
20918709-C-A **
20881339-T-A **
20611388-G-T **
20863783-C-A **
20835472-T-A **
20807210-C-A **
20754237-T-C **
20728204-C-A **
20725323-C-A **
20683926-T-C **
20659673-C-A **
19807642-AAAAT-A **
19665960-C-A **
21110579-C-T **
18729992-C-A P4_Dst **
20994211-A-AAG 18832325-A-AAG P4_Dst **
19048506-C-A **
19043098-C-A **
18983459-C-A **
18979652-C-A **
18978685-C-A **
18870441-C-A **
18677780-C-A P4_Gap **
20933421-CCCCA-C 18771535-CCCCA-C P4_Dst **
18677252-C-A P4_Gap **
18660854-C-A P4_Gap **
18646572-CTATATTCT-C P4_Gap **
18497462-T-A P4_Prx **
18398726-G-T P5_Dst **
18335491-T-TC P5_Dst **
17885670-C-A P5_Prx **
17815096-T-A P5_Prx **
20994205-A-G 18832319-A-G P4_Dst **
19076929-C-A **
19626600-C-CT **
19293904-GA-G **
19613560-C-A **
18019174-C-A 15907294-C-A ****
19543859-C-G **
19535211-C-A **
19408053-G-A **
18515710-TTTTCTTC-T 16403830-TTTTCTTC-T P6_Dst **
19389355-C-A **
19387311-T-A **
19274755-C-A **
20533025-AAAAATAACTACAAGAT-A 18371139-AAAAATAACTACAAGAT-A P5_Dst **
19245085-C-A **
19195936-C-G **
19170916-C-A **
19168441-C-A **
19155076-C-A **
19120203-T-A **
20085098-C-T 17973218-C-T P5_Dst **
20211217-C-G 18049331-C-G FGC17237 P5_Dst **
21087423-T-C **
21117708-C-A **
17421387-C-A **
26601396-C-A **
26637684-C-A **
13692828-C-T 11537152-C-T **
26619401-CAA-C **
26616913-C-A **
17302675-AAT-A 15190795-AAT-A **
19539568-G-GT 17427688-G-GT 9×T**
26601475-G-C **
24415767-TA-T 22269620-TA-T **
9963863-T-C 10126254-T-C **
26600797-C-A **
26575999-G-A **
26575977-C-A **
26555667-C-A **
21668138-G-GA 19506252-G-GA 10×A**
26554142-C-A **
27618169-CTT-C 25472022-CTT-C P1_Y2 14×T**
13465969-A-T 11310293-A-T **
9963864-C-T 10126255-C-T **
26641983-A-G **
26441162-C-A **
4447773-C-G 4579732-C-G Z4781 **
15202608-G-. 13090694-C-G **
**
56843758-G-C **
23305582-A-AAAT 21143696-A-AAAT **
14237131-C-T 12116425-C-T S6 PF4537 L60 ****
56749966-G-T **
13947662-CA-C 11826956-CA-C 15×A**
21542988-G-A 19381102-G-A CTS416Z29628 **
7545969-C-A 7677928-C-A M619 F989 V1190 ****
5669623-C-A 5801582-C-A **
14471488-TG-T 12350757-TG-T **
26672614-TAGGG-T **
15237234-G-A 13125320-G-A CTS3873 ****
15271994-C-G 13160083-C-G M2320 F287 V2864 **
17641985-C-T 15530105-C-T **
18945240-C-T 16833360-C-T CTS9515 M744 ****
26656312-A-G **
26644538-TGAATGGAAAAAATGGAATCCAATG-T **
26471090-G-T **
25900486-TTAAAAAA-T P1_Y2 **
21153713-C-A **
21465697-C-A **
21848819-CT-C **
21753264-T-TC **
21668343-C-A **
21627217-C-A **
21617311-C-A **
21570209-C-A **
21493614-A-G **
21462617-C-A **
21906287-C-A P3_b1 **
21448058-G-T **
21434757-C-A **
21320979-C-A **
21318379-C-A **
21288064-C-A **
21277386-C-A **
21217249-C-T **
21182016-C-A **
21860972-C-A **
22124770-ATTTTTT-A P3_b1 **
25900440-G-T P1_Y2 **
22474384-C-A P3_t2 **
25375842-G-A P1_Y2 **
25331483-TAAATAAATA-T P1_Y2 **
25232066-T-C P1_g3 **
24354314-C-T P1_Y1 **
23791748-A-G P1_Y1 **
23189669-C-A P2_r1 **
22491333-G-GTA P3_t2 **
22487859-C-T P3_t2 **
22454256-C-T P3_t2 **
22196058-C-A P3_t1 **
22323553-C-A **
22287174-C-A **
22274720-A-T **
7429086-C-T 7561045-C-T *****
22260425-T-C **
22232162-C-A **
22214508-G-T **
22211823-C-A **
17570323-A-T P5_Prx **
12746320-C-A **
16517690-C-A **
23896297-C-A P1_Y1 **
16137431-C-T **
16062477-C-A **
9480766-C-A 9643157-C-A **
17007739-C-A **
16041753-T-G **
13488245-G-T 11332569-G-T **
17071531-C-G **
12328914-C-A **
16024411-C-A **
28001595-ATTGTTACC-A 25855448-ATTGTTACC-A P1_Y2 **
10799624-C-A **
13294967-G-A **
13990151-TTG-T P8_Prx **
17007717-C-A **
3936691-C-A **
10655107-T-C **
17302867-C-A **
15519923-C-A **
17324262-C-A **
28005545-ACAAC-A 25859398-ACAAC-A P1_Y2 **
16157928-C-A **
16996643-C-A **
17156608-TA-T **
27005356-TA-T 24859209-TA-T P1_r4 **
27149220-G-T 25003073-G-T P1_g3 **
27150102-AAAAATACTTTTTGTGATTACCATCAGTTT-A 25003955-AAAAATACTTTTTGTGATTACCATCAGTTT-A P1_g3 **
22457981-G-A 20296095-G-A DYZ19 *****
17127330-C-A **
17050001-C-A **
16460924-C-A **
25663004-C-T 23516857-C-T P1_b3 **
16457612-G-A **
16812848-A-G **
17226686-C-A **
16570778-C-T **
17037610-T-C **
16434499-G-T **
24750728-GGGGCTAAGCA-G 22604581-GGGGCTAAGCA-G P3_b2 **
13804386-GAAGGAA-G 11683680-GAAGGAA-G ****
**
25377489-ACATTTTCCCTGTACTTGAAACATGTACGGTATACCT-A 23231342-ACATTTTCCCTGTACTTGAAACATGTACGGTATACCT-A P2_r2 **
25645011-CTGTTTTTCTTG-C 23498864-CTGTTTTTCTTG-C P1_b3 **
17210589-C-A **
5819675-C-A **
17282179-CTTT-C **
17332128-C-A **
17400646-T-C **
11332874-C-G **
26350814-C-A **
16755517-C-A **
16758085-C-A **
10821914-C-CTTCAG **
16908534-TC-T **
9585304-C-A **
10796116-C-A **
16928711-C-A **
16804376-C-A **
16867489-C-A **
16862501-A-T **
16854984-T-C **
16807069-C-A **
56843711-G-T **
15863733-C-A **
17360775-C-A **
16792301-T-C **
16699671-C-A **
20577830-CAAA-C **
17332380-T-G **
15944280-C-A **
16849634-C-A **
17332293-T-A **
18922447-A-G **
21089442-C-T ***
20900834-C-T ***
13437306-AACAAACTTACTCTTATCTCCCCTTCTCCAC-A ***
21606833-C-A ***
16561389-T-C ***
16554352-A-T ***
16554350-C-A ***
20911331-C-A ***
13557735-C-A ***
21482621-A-G ***
21153053-G-T ***
13608843-C-A ***
21642698-ACAATAAAAAAATG-A ***
21637736-C-A ***
13404912-A-T ***
16566336-C-A ***
21645727-C-A ***
21251670-C-A ***
16693317-C-A ***
16543057-C-A ***
16694398-C-A ***
21687967-C-A ***
21215688-C-A ***
21703064-C-A ***
16810869-C-A ***
16530357-C-CT ***
21848011-C-A ***
13480086-C-A ***
21451220-C-A ***
21262916-C-A ***
21386497-C-T ***
16743049-T-C ***
21268002-C-A ***
13545940-C-A ***
21021787-C-A ***
16690890-C-A ***
16666482-TAA-T ***
21305547-C-A ***
16654160-A-G ***
16641821-C-A ***
21367228-C-A ***
21094141-G-T ***
15511455-G-T ***
21415955-T-A ***
21451355-C-A ***
16778533-C-T ***
16720877-T-TAA ***
21418004-C-T ***
13538209-C-A ***
15501789-C-A ***
13513279-C-A ***
16580074-C-A ***
20965528-CAAAA-C,CAAAAA ***
21445333-C-A ***
20960449-A-T ***
13592483-T-C ***
16796096-C-A ***
17413364-C-A ***
22313004-T-C ***
21859503-G-A ***
15966851-C-A ***
26672641-G-T ***
15925807-C-A ***
12992607-T-C ***
26667641-G-A ***
26659233-T-A ***
13047105-G-A ***
16007427-C-A ***
12975067-A-C ***
16012453-GA-G ***
13084352-C-A ***
26641168-C-T ***
13085784-C-A ***
26637770-C-A ***
13097148-G-T ***
13106295-CT-C ***
12992184-C-A ***
12965331-C-A ***
15740803-C-A ***
12863183-C-A ***
***
12792887-C-T ***
15894540-AGTTTT-A P7_Gap ***
56834210-G-A ***
15832281-C-A ***
12815032-C-A ***
12817726-C-A ***
56833348-T-TTCCAC ***
12944160-C-A ***
56828724-C-G ***
15907631-C-A ***
15826536-C-A ***
12874694-C-T ***
15920308-G-T ***
12906735-C-A ***
12940087-A-G ***
13117485-AAGGAGTTAGGAG-A ***
16105048-C-A ***
15536901-C-A ***
16485110-G-T ***
13336337-TA-T,TAA ***
22286931-G-T ***
22286865-G-T ***
13342724-G-T ***
16460139-C-T ***
22269849-C-A ***
15567042-C-A ***
13319004-C-A ***
22224420-C-A ***
15537129-A-G ***
16488864-A-T ***
22209482-C-T ***
13350642-C-A ***
13358488-C-A ***
21949894-C-A P3_b1 ***
15657691-G-A ***
16434812-C-A ***
26533271-T-C ***
25844563-AGGTAGGAGAGTAG-A P1_Y2 ***
16139820-C-A ***
16156059-C-A ***
26462611-C-A ***
13230987-C-A ***
26454836-ATT-A,ATTT ***
13237269-C-A ***
13260276-A-G ***
25693043-GTT-G P1_Y2 ***
13298343-C-A ***
15662365-C-A ***
13262813-C-A ***
16287333-C-A P6_Gap ***
16301057-A-G P6_Gap ***
13271121-C-A ***
13292449-GAA-G,GA ***
12738305-C-A ***
20872407-CTT-C,CTTT ***
16897540-C-A ***
16842058-C-A ***
19198274-C-A ***
15348469-G-T ***
19271841-C-A ***
19266372-G-T ***
19266361-T-C ***
19260692-C-A ***
14701195-G-A ***
15327814-C-A ***
14706824-AT-A ***
14739027-C-A ***
19291114-C-A ***
17268861-G-A ***
14744202-C-A ***
14744424-C-A ***
19179502-C-A ***
19178616-A-G ***
17280898-GT-G,GTT ***
17288213-G-T ***
14777582-G-A ***
19165600-G-T ***
14665475-A-G ***
15355769-AC-A ***
14787925-C-A ***
17160002-C-A ***
17157669-C-A ***
15272482-ATT-A 13160571-ATT-A ***
19529668-CT-C,CTT ***
19529023-CAAA-C,CAA ***
19501376-TAAA-T,TA ***
19490855-C-A ***
19454299-C-A ***
14500245-G-GTC ***
14521339-C-A ***
19306439-C-A ***
17175100-T-C ***
19394521-G-A ***
14555544-C-A ***
19366781-C-A ***
19356769-AC-A ***
14604764-C-A ***
14605793-G-A ***
14618123-GAA-G,GAAA ***
19315355-C-A ***
19139286-C-A ***
19132798-TCC-T ***
19545771-C-A ***
15079900-G-A ***
15022675-G-T ***
15238101-C-A ***
15223279-C-A ***
17405166-C-A ***
15047479-C-A ***
15217514-G-T ***
17407714-CA-C,CAA ***
15054890-TC-T ***
15084032-C-A ***
15000827-C-A ***
15203886-C-A ***
15141690-C-A ***
15184908-G-A ***
15182472-C-T ***
15144403-T-C ***
18025550-C-A P5_Dst ***
17889998-G-A P5_Prx ***
15182210-C-A ***
15182207-C-A ***
15022346-C-A ***
18890863-G-A ***
14815111-G-A ***
17338016-C-A ***
19104428-C-A ***
15290863-C-A ***
15286410-C-A ***
14849351-C-A ***
14850800-TC-T ***
19099920-C-T ***
19082447-A-G ***
14897837-CTGA-C ***
15256729-C-A ***
19056239-C-A ***
18929795-C-A ***
15243537-TC-T ***
17342017-C-A ***
19007656-A-C ***
18999642-C-A ***
18997539-G-C ***
17370594-TC-T ***
14982329-C-A ***
17398615-A-G ***
18952070-C-A ***
15383943-C-A ***
19557582-C-CT ***
13608989-C-A ***
15482736-A-G ***
13907977-C-A ***
15498460-G-A ***
20397395-G-A ***
20393038-C-A ***
20350169-A-G DYZ19 ***
20325282-A-G DYZ19 ***
14058316-C-A ***
14064552-C-A ***
20312395-A-G DYZ19 ***
13887521-C-A ***
20303826-GTTACAGCACTTAAAGGT-G DYZ19 ***
20302824-G-T DYZ19 ***
20300919-C-A DYZ19 ***
17008295-C-A ***
17025135-A-G ***
20194617-G-T DYZ19 ***
20154606-C-A DYZ19 ***
14080366-C-A ***
14105375-G-C ***
20495464-A-G ***
13881250-C-A ***
14114466-C-T ***
13757459-A-G ***
13610529-C-A ***
20751001-T-A ***
20743140-C-A ***
20739809-C-A ***
16886534-T-A ***
20698461-C-A ***
17411899-C-A ***
13699114-T-C ***
20671031-C-A ***
13770412-C-A ***
16966505-TATTA-T ***
20658170-C-A ***
20644599-C-A ***
20640747-C-A ***
20632184-C-A ***
13801543-C-A ***
20575345-CAAAA-C,CAAA ***
20573436-G-T ***
20560069-C-A ***
20549206-C-A ***
14107252-G-A ***
17042600-C-A ***
19595912-C-A ***
19723314-C-A ***
19817639-C-A ***
17109327-G-A ***
14332796-C-A ***
17132102-C-T ***
17138544-C-A ***
19754130-G-T ***
14346745-C-A ***
14372788-CA-C ***
19722276-G-C ***
19825951-C-A ***
15845966-C-A ***
14393553-C-A ***
19700477-C-A ***
14413673-C-A ***
14426259-C-A ***
15416032-C-A ***
17156691-C-A ***
19611804-TGAGCAAATAATAATAATAATAAAATTG-T ***
19595962-C-A ***
14295796-C-A ***
19833211-TA-T ***
15470521-G-A ***
19936654-C-A ***
20001128-TA-T ***
19979447-C-A ***
19979375-T-A ***
14198523-C-G ***
17047088-C-T ***
15455257-C-A ***
14200188-GAAAAA-G,GAAA ***
15443313-C-A ***
19957772-C-A ***
19907837-TTCTTAAAGA-T ***
19833217-C-A ***
19906346-C-A ***
19879147-CACCA-C ***
14258768-CAAAA-C ***
14273758-T-TTA ***
14275137-C-A ***
19869398-C-A ***
14289448-C-A ***
19862268-C-A ***
17078401-C-A ***
19711648-TC-T ***
13457122-T-C 11301446-T-C ***
12735617-G-T ***
18064849-G-T 15952969-G-T ******
18405795-C-A 16293915-C-A P6_Gap ***
18336305-TTATTA-T 16224425-TTATTA-T P6_Prx ***
18115221-C-A 16003341-C-A ******
18107157-AGAATAAATAAATGCAGTGAGATGAGTG-A 15995277-AGAATAAATAAATGCAGTGAGATGAGTG-A ******
18075056-A-C 15963176-A-C ***
18066632-G-T 15954752-G-T ***
18033991-C-A 15922111-C-A ***
18559563-G-T 16447683-G-T ***
17996296-AACAGAAATCAGCCCACCTTTCCATCAAGAGGAACCAGATGTTGGAAAT-A 15884416-AACAGAAATCAGCCCACCTTTCCATCAAGAGGAACCAGATGTTGGAAAT-A P7_Gap ***
17888619-CCAG-C 15776739-CCAG-C ***
17874590-GTCTGAGGGTGGCAGAGTAAACATTA-G 15762710-GTCTGAGGGTGGCAGAGTAAACATTA-G ***
17743254-GA-G 15631374-GA-G ***
17689033-TCTC-T 15577153-TCTC-T ***
17585095-G-T 15473215-G-T ***
17509127-G-T 15397247-G-T ******
18538032-G-T 16426152-G-T ***
18661935-G-A 16550055-G-A ***
17446661-G-T 15334781-G-T ******
19053869-G-T 16941989-G-T ***
19344075-TTGG-T 17232195-TTGG-T ***
19318940-C-A 17207060-C-A ***
19274228-TGTAAA-T 17162348-TGTAAA-T ******
19195307-G-T 17083427-G-T ******
19158800-CAGGA-C 17046920-CAGGA-C ***
19136846-AT-A 17024966-AT-A ***
19131882-AAC-A 17020002-AAC-A ***
18999833-TTAAGG-T 16887953-TTAAGG-T ***
18679353-CTAAA-C 16567473-CTAAA-C ***
18999149-C-A 16887269-C-A ***
18986593-C-T 16874713-C-T ***
18931358-C-A 16819478-C-A ***
18824133-G-A 16712253-G-A ***
18779647-GCTGGAATACA-G 16667767-GCTGGAATACA-G ***
18697100-ACC-A 16585220-ACC-A ***
18695422-C-T 16583542-C-T ***
17464108-TTTCTAAGATACC-T 15352228-TTTCTAAGATACC-T ***
17255418-C-A 15143538-C-A ***
19359274-CACACATG-C 17247394-CACACATG-C ***
15997971-AGTCTTCTTCATTTATATCAAGTT-A 13886091-AGTCTTCTTCATTTATATCAAGTT-A ***
16329177-G-T 14217297-G-T ***
16301493-CACTTGGGGAGG-C 14189613-CACTTGGGGAGG-C ***
16293802-A-G 14181922-A-G ***
16254311-CAGAT-C 14142431-CAGAT-C ***
16222797-AGTTTGACAAT-A 14110917-AGTTTGACAAT-A ******
16133815-C-A 14021935-C-A ***
16047512-G-T 13935632-G-T ***
15992954-G-T 13881074-G-T ***
16434967-GCAGTAT-G 14323087-GCAGTAT-G ***
15965875-T-G 13853995-T-G ***
15922115-G-T 13810235-G-T ***
15916048-G-A 13804168-G-A ***
15881429-C-A 13769549-C-A ***
15859649-C-A 13747769-C-A FGC45603 ***
15817674-TATGTTTTACCTGGATATGTAAAATAC-T 13705794-TATGTTTTACCTGGATATGTAAAATAC-T ***
15736210-GAAATCATAAGACTGATAAAACAT-G 13624330-GAAATCATAAGACTGATAAAACAT-G ***
16390261-C-A 14278381-C-A ***
16437639-AAAAAAGAAACTC-A 14325759-AAAAAAGAAACTC-A ***
17191203-C-A 15079323-C-A ***
16919491-ATATTGCTTGGATGATTATGGCT-A 14807611-ATATTGCTTGGATGATTATGGCT-A ***
17144483-TATCATTTG-T 15032603-TATCATTTG-T ***
17140117-CA-C 15028237-CA-C ***
17119295-C-T 15007415-C-T ***
17089268-GTA-G 14977388-GTA-G ***
16965262-TATTAACAGC-T 14853382-TATTAACAGC-T ***
16958167-A-T 14846287-A-T ***
16956025-CT-C 14844145-CT-C ***
16877317-CA-C 14765437-CA-C ***
16487023-T-G 14375143-T-G ***
16796258-G-T 14684378-G-T ***
16763752-A-AAC 14651872-A-AAC ***
16715604-CAGATGAACACA-C 14603724-CAGATGAACACA-C ***
16714397-C-A 14602517-C-A ***
16641271-G-T 14529391-G-T ******
16595242-T-TA 14483362-T-TA ***
16567178-C-T 14455298-C-T ***
19358841-T-C 17246961-T-C ***
19378397-CA-C 17266517-CA-C ***
15544362-C-A 13432482-C-A ***
22272473-C-T 20110587-C-T DYZ19 ***
22363810-G-C 20201924-G-C DYZ19 ***
22363390-C-T 20201504-C-T DYZ19 ***
22362856-A-T 20200970-A-T DYZ19 ***
22357649-G-T 20195763-G-T DYZ19 ***
22345751-G-T 20183865-G-T DYZ19 ***
22272717-TCCAGA-T 20110831-TCCAGA-T DYZ19 ***
22243916-A-C 20082030-A-C DYZ19 ***
22443088-C-T 20281202-C-T DYZ19 ***
22238276-G-A 20076390-G-A DYZ19 ***
22235745-C-G 20073859-C-G DYZ19 ***
22232924-G-A 20071038-G-A DYZ19 ***
22232130-C-T 20070244-C-T DYZ19 ***
22232129-G-C 20070243-G-C DYZ19 ***
22220127-T-A 20058241-T-A DYZ19 ***
22217362-T-G 20055476-T-G DYZ19 ***
22363824-G-C 20201938-G-C DYZ19 ***
22446605-A-C 20284719-A-C DYZ19 ***
22094047-G-T 19932161-G-T ***
22676247-AT-A 20514361-AT-A ***
22842630-T-C 20680744-T-C ***
22824135-CTGTG-C 20662249-CTGTG-C ***
22823713-G-T 20661827-G-T ***
22805887-G-A 20644001-G-A ******
22730991-ATC-A 20569105-ATC-A ***
22705581-CCCTGA-C 20543695-CCCTGA-C ***
22701464-TTTCTAGAAACAATAGGAAC-T 20539578-TTTCTAGAAACAATAGGAAC-T ***
22663834-T-A 20501948-T-A ***
22455257-T-A 20293371-T-A DYZ19 ***
22655942-TCAAGTAAAGAAAA-T 20494056-TCAAGTAAAGAAAA-T ***
22508568-T-A 20346682-T-A DYZ19 ***
22480423-G-A 20318537-G-A DYZ19 ***
22463765-G-T 20301879-G-T DYZ19 ***
22463734-G-T 20301848-G-T DYZ19 ***
22455369-A-T 20293483-A-T DYZ19 ***
22455287-G-A 20293401-G-A DYZ19 ***
22206176-CAGAGTAAGA-C 20044290-CAGAGTAAGA-C ***
22061166-G-T 19899280-G-T ***
19531092-A-G 17419212-A-G ***
21070270-T-A 18908384-T-A ***
21382365-G-A 19220479-G-A ***
21354607-CAATACAGATATACATT-C 19192721-CAATACAGATATACATT-C ***
21340688-CCTT-C 19178802-CCTT-C ***
21313130-CA-C 19151244-CA-C ***
21266426-G-T 19104540-G-T ***
21215507-AC-A 19053621-AC-A ***
21176684-C-T 19014798-C-T ***
21066817-G-A 18904931-G-A ***
21416045-C-T 19254159-C-T ***
21034092-C-T 18872206-C-T ***
20860854-C-T 18698968-C-T P4_Dst ***
20784630-AAGGATTAATC-A 18622744-AAGGATTAATC-A P4_Prx ***
20736156-G-T 18574270-G-T P4_Prx ***
19909805-C-T 17797925-C-T P5_Prx ***
19679424-TC-T 17567544-TC-T P5_Prx ***
19539357-C-A 17427477-C-A ***
21390467-GCTGCTTCTGCAAACATAGCAGAAGAGTCAGAGA-G 19228581-GCTGCTTCTGCAAACATAGCAGAAGAGTCAGAGA-G ***
21434099-CAAGAGAGCATAT-C 19272213-CAAGAGAGCATAT-C ***
22007775-C-A 19845889-C-A ***
21692363-C-A 19530477-C-A ******
21994213-G-A 19832327-G-A ******
21963473-CT-C 19801587-CT-C ***
21909313-CTATTTCTGCTA-C 19747427-CTATTTCTGCTA-C ***
21901697-G-T 19739811-G-T ***
21838016-C-T 19676130-C-T ***
21827528-C-G 19665642-C-G ***
21780866-TTATGCTCTATGCTCATGCTGTTA-T 19618980-TTATGCTCTATGCTCATGCTGTTA-T ***
21664523-C-A 19502637-C-A ***
21460487-C-A 19298601-C-A ***
21648649-GATAGAA-G 19486763-GATAGAA-G ******
21647299-GAGACCCTGTCTC-G 19485413-GAGACCCTGTCTC-G ***
21645355-C-A 19483469-C-A ***
21514871-C-T 19352985-C-T Y18522 ***
21487785-TTACATTCTATTTTGTCAGA-T 19325899-TTACATTCTATTTTGTCAGA-T ***
21478531-C-A 19316645-C-A ***
21467079-G-T 19305193-G-T ***
15575386-TCCA-T 13463506-TCCA-T ***
15438007-CAATCTGGCTT-C 13326127-CAATCTGGCTT-C ***
22897583-C-A 20735697-C-A ******
7152257-AAAG-A 7284216-AAAG-A ***
7592189-C-A 7724148-C-A ***
7590049-GGCCCTTCTGA-G 7722008-GGCCCTTCTGA-G ***
7569075-C-A 7701034-C-A ***
7427375-A-C 7559334-A-C ***
7334576-AT-A 7466535-AT-A ***
7207917-G-T 7339876-G-T ***
7129238-AT-A 7261197-AT-A ***
7696059-G-T 7828018-G-T ***
7064492-AAG-A 7196451-AAG-A ***
6898213-G-T 7030172-G-T ***
6851079-TGCCA-T 6983038-TGCCA-T ***
6836184-TTAATCA-T 6968143-TTAATCA-T ***
6756895-T-A 6888854-T-A ***
6702656-G-T 6834615-G-T ***
6653744-TAAATGTTATTA-T 6785703-TAAATGTTATTA-T ***
7658823-C-A 7790782-C-A ***
7739939-ATGCACTGTAAG-A 7871898-ATGCACTGTAAG-A ***
5851577-AT-A 5983536-AT-A ***
8280600-TCCTTGTAA-T 8412559-TCCTTGTAA-T ***
8589306-G-T 8721265-G-T ******
8552104-C-A 8684063-C-A ***
8483207-GC-G 8615166-GC-G ***
8461261-GGCTCTACCTGTACCATTTTCCA-G 8593220-GGCTCTACCTGTACCATTTTCCA-G ***
8389922-G-A 8521881-G-A ***
8346883-ATTATTAATTT-A 8478842-ATTATTAATTT-A ***
8342308-C-A 8474267-C-A ***
8243408-G-T 8375367-G-T ***
7783283-G-T 7915242-G-T ***
8237921-AATTACT-A 8369880-AATTACT-A ***
8127825-C-A 8259784-C-A ***
8123305-CT-C 8255264-CT-C ***
8032921-G-A 8164880-G-A ******
7883148-CA-C 8015107-CA-C ***
7818047-CTTCT-C 7950006-CTTCT-C ***
7789374-G-T 7921333-G-T ***
6125684-G-A 6257643-G-A ***
5800076-C-A 5932035-C-A ***
8639106-TC-T 8771065-TC-T ***
14780417-A-G 12668487-A-G Z1956 M2034 CTS3266 ***
13660806-T-G 11505130-T-G FGC24719 ***
7661156-G-T 7793115-G-T Y19837 ***
28160822-CTT-C 26014675-CTT-C P1_b4 22×T***
22486512-A-C 20324626-A-C DYZ19 ***
22463753-G-T 20301867-G-T DYZ19 ***
21700267-G-A 19538381-G-A M5544 PF1821 ******
20835461-C-G 18673575-C-G Z4928 P4_Gap ***
9383960-T-C 9546351-T-C F1529 ***
14039742-C-A 11919036-C-A ***
21230509-TAA-T 19068623-TAA-T 14×A***
7552880-AT-A 7684839-AT-A 10×T***
13711678-G-T 11556002-G-T ***
13688027-G-T 11532351-G-T ***
8516929-A-G 8648888-A-G ***
10004730-T-C 10167121-T-C ***
23379254-A-G 21217368-A-G CTS11948 FGC54 ***
13676196-T-A 11520520-T-A ***
14789655-C-T 12677726-C-T ***
4899417-CAATTACCCCTCAAAGTTGA-C 5031376-CAATTACCCCTCAAAGTTGA-C ***
18804474-AAGAG-A,AAG 16692594-AAGAG-A,AAG 26×AG***
4352119-AATAT-A 4484078-AATAT-A ***
4262082-GA-G 4394041-GA-G ***
3621887-G-T 3753846-G-T ***
2850721-G-T 2982680-G-T ***
2835506-GT-G 2967465-GT-G ***
2833656-GGAAAGAAAA-G 2965615-GGAAAGAAAA-G ***
2714886-CCCTGTGAATTTTTAAGT-C 2846845-CCCTGTGAATTTTTAAGT-C ***
22455323-G-C 20293437-G-C DYZ19 ***
22425940-C-G 20264054-C-G DYZ19 ***
15899855-G-A 13787975-G-A ***
22474930-T-G 20313044-T-G Z3484 DYZ19 ***
22262262-G-A 20100376-G-A DYZ19 ***
14469656-GT-G 12348925-GT-G 10×T***
22463728-T-C 20301842-T-C DYZ19 ***
22232098-T-C 20070212-T-C DYZ19 ***
23792286-GTAT-G 21630400-GTAT-G 5×TAT***
8592597-CCT-C 8724556-CCT-C ***
8654695-G-T 8786654-G-T ***
15420567-G-A 13308687-G-A ***
14148542-G-T 12027836-G-T ***
14485113-GCCTCAGGAGGAACCAGCCC-G 12364382-GCCTCAGGAGGAACCAGCCC-G ***
14482668-C-T 12361937-C-T ***
14454147-CTGAGGGTATTAAAATGCTCCTT-C 12333420-CTGAGGGTATTAAAATGCTCCTT-C ***
14415572-AAAAATAT-A,AAATATAT 12294869-AAATATAT-A ***
14379581-A-G 12258877-A-G ***
14348923-TTCCTTGG-T 12228218-TTCCTTGG-T ******
14346084-C-A 12225379-C-A ***
14117692-G-T 11996986-G-T ***
14548999-G-T 12437200-G-T ******
14094952-AATGGTTT-A 11974246-AATGGTTT-A ***
14063207-G-GATAA 11942501-G-GATAA ***
14061979-T-A 11941273-T-A ***
14031267-C-T 11910561-C-T ***
13863925-C-A 11743219-C-A ***
13859833-T-A 11739127-T-A ***
13839634-TGGAATGGAATGGATTCGACG-T 11718928-TGGAATGGAATGGATTCGACG-T ***
14494124-C-A 12382321-C-A ***
14572170-G-T 12460370-G-T ***
13834566-A-C 11713860-A-C ***
15072011-CCTCCCCCACATAATATATTCCACCTGCA-C 12960102-CCTCCCCCACATAATATATTCCACCTGCA-C ***
15332681-C-A 13220799-C-A ***
15319530-AACTTAGAACTCACACAGT-A 13207636-AACTTAGAACTCACACAGT-A ***
15239268-G-T 13127354-G-T ******
15203803-A-G 13091889-A-G ***
15134927-GT-G 13023014-GT-G ***
15129452-AGCT-A 13017539-AGCT-A ******
15073667-ACCT-A 12961757-ACCT-A ***
14995008-A-G 12883093-A-G ***
14583927-CTCTTCCTGATGAAGGTGGGTGCCAGAGAGTATGATATTCCCA-C 12472127-CTCTTCCTGATGAAGGTGGGTGCCAGAGAGTATGATATTCCCA-C ***
14955990-G-T 12844065-G-T ***
14886450-ACAT-A 12774516-ACAT-A ***
14869794-C-A 12757864-C-A ***
14820098-CTTG-C 12708165-CTTG-C ***
14708707-C-A 12596773-C-A ******
14703199-A-C 12591265-A-C ***
14596789-C-A 12484989-C-A ***
13834567-C-G 11713861-C-G ***
13818259-ACTT-A 11697553-ACTT-A ***
8714908-G-T 8846867-G-T ***
9446774-G-T 9609165-G-T ***
13141501-TATAG-T 10630987-TATAG-T ***
9988475-G-T 10150866-G-T ***
9988472-T-A 10150863-T-A ***
9979797-G-A 10142188-G-A ***
9879779-AAAAT-A 10042170-AAAAT-A ***
9788876-G-T 9951267-G-T ***
9759305-GTA-G 9921696-GTA-G ***
9444184-G-T 9606575-G-T ******
13313311-C-T 11157635-C-T ***
9167095-GCTAGC-G 9329486-GCTAGC-G ***
9089588-C-A 9251979-C-A ***
9069634-C-A 9232025-C-A ***
8998774-TA-T 9161165-TA-T ***
8898538-C-T 9030497-C-T ***
8833105-G-A 8965064-G-A ***
8751098-G-A 8883057-G-A ******
13232197-CCTATGAGGCTGACACTAGCAGGTACT-C 11076521-CCTATGAGGCTGACACTAGCAGGTACT-C ***
13409391-C-T 11253715-C-T ***
13731516-G-T 11575840-G-T ***
13661465-G-T 11505789-G-T ***
13722944-C-G 11567268-C-G ***
13714020-T-C 11558344-T-C ***
13702348-AAATGGAGTCGAATAGAGTGGCATCAAAAGGAATGG-A,AAATGCAGTCGAATAGAGTGGCATCAAAAGG 11546672-AAATGGAGTCGAATAGAGTGGCATCAAAAGGAATGG-A,AAATGCAGTCGAATAGAGTGGCATCAAAAGG ***
13695972-G-T 11540296-G-T ***
13695584-T-C 11539908-T-C ***
13686628-TTA-T 11530952-TTA-T ***
13680400-TG-T 11524724-TG-T ***
13661460-G-A 11505784-G-A ***
13457113-A-T 11301437-A-T ***
13660805-G-C 11505129-G-C ***
13660795-G-GGGTTTATACAAATA 11505119-G-GGGTTTATACAAATA ***
13631649-CCCCCAG-C 11475973-CCCCCAG-C ***
13564701-C-T 11409025-C-T ***
13476612-G-A 11320936-G-A ***
13469131-C-A 11313455-C-A ***
13457149-A-T 11301473-A-T ***
22860501-G-T 20698615-G-T ***
22938168-CCACCCA-C 20776282-CCACCCA-C ***
12716091-C-A ***
8969325-A-G ***
9205853-C-A ***
9184307-C-CA ***
9156470-C-A ***
9124877-G-A ***
9045167-C-A ***
8998378-C-G ***
8950245-C-A ***
9262498-CTTT-C,CTTTT ***
8901870-C-T ***
8899465-C-A ***
8897291-G-T ***
8896954-C-CT ***
8886369-C-A ***
8885550-C-A ***
8840768-C-A ***
9254881-C-A ***
9268063-C-A ***
8816831-T-A ***
9809225-CAAGT-C IR3_Prx ***
10046642-C-A ***
10045228-C-A ***
10020335-G-A ***
9968178-C-A ***
9961451-C-T ***
9914538-G-T ***
9852823-C-T IR3_Prx ***
9807418-G-A IR3_Prx ***
9290038-C-A ***
9804967-C-A IR3_Prx ***
9683560-G-T ***
9659737-C-A ***
9625302-G-T ***
9622302-C-A ***
9599818-C-A ***
9307878-C-A ***
8835618-ATT-A,AT ***
8804692-C-A ***
10117619-G-T ***
8342232-C-A ***
8535336-G-A ***
8485619-C-A ***
8445822-A-G ***
8424671-C-T ***
8418919-G-T ***
8387254-C-A ***
8371277-C-A ***
8333621-C-T ***
8551666-C-A ***
8284850-T-C ***
8256436-C-A ***
8187929-C-A ***
8180465-C-A ***
8161950-C-A ***
8157114-CAA-C,CA ***
8140735-G-T ***
8549464-CT-C,CTT ***
8564726-C-A ***
8776751-C-A ***
8724347-G-A ***
8776750-C-A ***
8772906-GGTGAA-G ***
8771542-C-A ***
8744618-G-T ***
8732223-C-A ***
8728070-T-A ***
8725768-C-A ***
8719480-A-G ***
8566198-T-C ***
8658683-C-A ***
8651350-C-A ***
8649176-C-A ***
8614008-C-A ***
8610481-T-A ***
8605546-C-A ***
8573929-C-A ***
10048261-C-A ***
10124287-C-A ***
8116134-A-T ***
12222592-C-A ***
12366925-G-T ***
12344072-C-A ***
12324090-C-A ***
12284949-C-T ***
12283103-G-A ***
12282834-GGT-G ***
12278356-C-T ***
12217753-C-A ***
12383499-G-T ***
12213641-C-A ***
12205357-G-A ***
12168114-C-A ***
12159951-C-A ***
12113279-C-A ***
12108659-A-T ***
12093308-C-A ***
12368042-CAAA-C,CAA ***
12426384-C-CA ***
12089563-T-A ***
12542114-C-A ***
12712709-T-C ***
12680591-C-A ***
12663985-C-A ***
12641601-C-A ***
12610458-C-A ***
12547509-CAAA-C ***
12544393-C-A ***
12498988-T-TG ***
12467061-C-A ***
12498983-A-G ***
12498982-C-T ***
12492792-CTTTTTTTT-C,CTTTTTT ***
12482416-C-A ***
12476510-C-A ***
12471294-TTG-T ***
12470256-G-A ***
12089580-A-G ***
12080120-C-A ***
10166198-C-T ***
11261618-C-A ***
11311202-C-A ***
11311160-G-T ***
11301051-C-A ***
11299438-T-A ***
11299429-CACCCT-G ***
11292665-A-ACTCCATTCCACTCCT ***
11292212-T-TTGCATCCCAG ***
11199729-A-G ***
11314966-C-T ***
11014366-C-T ***
10980688-T-C ***
10835583-A-C ***
10747048-CA-C ***
10212841-C-A ***
10200916-C-T ***
10166202-C-A ***
11314221-G-A ***
11323359-A-T ***
12080117-C-A ***
11852762-CTACTGTG-C ***
11995264-C-A ***
11952147-A-T ***
11948600-C-A ***
11941259-T-A ***
11924190-C-A ***
11886264-C-A ***
11870727-C-A ***
11744690-A-G ***
11328286-G-A ***
11718304-C-A ***
11718218-TGGAATGGACTCGAATGGAATGG-T ***
11643241-ATGCAATGG-A ***
11562129-G-T ***
11525430-C-A ***
11445198-C-A ***
11367989-C-A ***
8120058-CTTTT-C,CTT ***
8081831-A-G ***
23022475-CTGTA-C 20860589-CTGTA-C ***
16129871-C-A ***
11332625-A-G ***
10845652-A-C ***
18980948-CAAAA-C ***
8847265-GAAAA-G ***
10965613-CCATTC-C,CCATTA ***
10999845-A-T ***
2959868-CTT-C,CT ***
17156325-C-A ***
26659156-G-A ***
7098902-TAAAA-T 7230861-TAAAA-T 16×A***
14124822-C-A 12004116-C-A ***
8477577-A-AT 8609536-A-AT 10×T***
13451746-C-CTGCAA,T 11296070-C-CTGCAA,T ***
3712567-AAAC-A,AAAT 3844526-AAAC-A,AAAT ******
28724676-CAAAAGG-C 26578529-CAAAAGG-C ***
19489915-C-A ***
16477817-ATT-A,AT ***
14828403-ATTTTTTCATTTTCATTTGCCTCACATATTATATAG-A 12716470-ATTTTTTCATTTTCATTTGCCTCACATATTATATAG-A ******
2898851-C-A ***
3106862-A-T ***
3080535-T-C ***
3042149-G-T ***
3040166-C-A ***
3026042-G-A ***
3014392-C-A ***
2954405-C-A ***
2898549-C-A ***
11555468-G-T ***
2868595-C-A ***
2864195-C-A ***
2838096-G-A ***
11723345-A-C ***
13224825-CAAAA-C ***
20349061-A-T DYZ19 ***
13450823-GA-G,GAA ***
26123537-TTCTAAGTTATCCCTTAGGTCTTTTAAAATAA-T 23977390-TTCTAAGTTATCCCTTAGGTCTTTTAAAATAA-T P1_Y1 ***
8780390-ATCCTGTGTTTGCAAGATAAT-A 8912349-ATCCTGTGTTTGCAAGATAAT-A ***
3254690-A-G ***
23350111-C-T 21188225-C-T ***
23648542-C-A 21486656-C-A ***
23581443-GAAAGTGTGTAC-G 21419557-GAAAGTGTGTAC-G ***
23502413-C-T 21340527-C-T ***
23443313-TCCCA-T 21281427-TCCCA-T ***
23423871-G-T 21261985-G-T ***
23415524-G-T 21253638-G-T ***
23367497-AACTCTCATATACTGCTGATGGG-A 21205611-AACTCTCATATACTGCTGATGGG-A ***
23347033-A-G 21185147-A-G ***
24305595-GCTGTTCACACTCT-G 22159448-GCTGTTCACACTCT-G P3_t1 ***
23314600-TTCAAGC-T 21152714-TTCAAGC-T ***
23282344-AAGCCATAACAGATATATT-A 21120458-AAGCCATAACAGATATATT-A ***
23191332-G-T 21029446-G-T ***
23164758-CTGTATGCAGTATTCAG-C 21002872-CTGTATGCAGTATTCAG-C ***
23067639-CTG-C 20905753-CTG-C ***
23064902-A-G 20903016-A-G ***
23023873-C-A 20861987-C-A ***
23783420-TATTAGTGAGG-T 21621534-TATTAGTGAGG-T ***
24469931-C-A 22323784-C-A ***
28818100-T-A 26671953-T-A ***
26230787-TAACA-T 24084640-TAACA-T P1_Y1 ***
28789242-G-T 26643095-G-T ***
28742840-TA-T 26596693-TA-T ***
28609800-T-A 26463653-T-A ***
28586290-C-A 26440143-C-A ***
28428933-A-G 26282786-A-G P1_gr2 ***
28099439-CTTAACA-C 25953292-CTTAACA-C P1_Y2 ***
26594842-C-A 24448695-C-A P1_g2 ***
26167193-TG-T 24021046-TG-T P1_Y1 ***
24480307-TAACCTC-T 22334160-TAACCTC-T ***
25928518-CATTTGCTGCA-C 23782371-CATTTGCTGCA-C P1_Y1 ***
25164074-CAT-C 23017927-CAT-C g1 ***
25035675-CACATTAGCTGA-C 22889528-CACATTAGCTGA-C g1 ***
25025525-TC-T 22879378-TC-T g1 ***
24874210-AAAAATAAAAT-A 22728063-AAAAATAAAAT-A g1 ***
24502450-C-A 22356303-C-A ***
24496709-C-T 22350562-C-T ***
3112956-C-A ***
3477853-C-A ***
8066501-C-T ***
7383677-C-A ***
7550032-CAAAA-C,CAAAAA ***
7538501-C-A ***
7529833-C-A ***
7482154-C-A ***
7471220-C-A ***
7456246-T-C ***
7422028-C-A ***
7376071-C-A ***
7689602-C-A ***
7367979-T-C ***
7351197-C-A ***
7337123-C-A ***
7330086-C-A ***
7319543-CTTTT-C,CTTT ***
7318919-T-C ***
7291503-C-A ***
7680810-C-A ***
7715379-G-T ***
7262966-C-A ***
7935589-C-A ***
8061840-C-A ***
8040829-C-A ***
8035146-C-A ***
8026011-C-A ***
7995606-G-T ***
7984016-C-T ***
7946057-C-A ***
7924905-G-T ***
7727194-C-A ***
7902438-G-T ***
7818913-C-A ***
7816399-C-A ***
7769434-C-A ***
7754569-C-A ***
7754137-C-A ***
7732057-C-A ***
7271279-C-A ***
7258382-TCCCAAAGTGCTGGGATTACAGACATGAGCCACCGCA-T ***
4574563-C-A ***
6799595-G-A ***
6909179-T-C ***
6877557-C-A ***
6846958-G-A ***
6831541-C-A ***
6828645-C-A ***
6825864-C-T ***
6813893-C-A ***
6792245-C-A ***
6947017-C-A ***
6785694-AGATTTATATAAATGTTATTAAGGTC-A ***
6533983-C-T ***
6522271-C-A ***
6281830-TACACAC-T IR3_Dst ***
5544253-T-C ***
5331797-A-G ***
5021205-T-C ***
6919108-C-A ***
6960174-C-T ***
7244053-G-T ***
7102834-C-A ***
7237455-C-T ***
7213086-A-G ***
7201896-C-A ***
7187388-C-A ***
7179831-C-A ***
7167343-C-A ***
7123137-C-T ***
7102573-C-A ***
7020298-G-T ***
7079562-C-A ***
7070545-A-T ***
7069779-C-A ***
7069771-C-A ***
7047451-C-A ***
7025413-G-T ***
7024858-C-A ***
15358110-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 113242932772466453246697553
Kit: 113242773923964005536388424
Used in age calculations932772466453246697553
Counts of SNPs1211
Variant counts last updated 2017-12-16 19:32:00.



Big Tree Main Page