Tree Position

R-P312/S116 > Z290 > L21/S145 > DF63/S522 > CTS6919 > A92 > Z16506 > BY674 > ~19755919-G-A > 15829160-T-C

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
113242
FTDNA
113242
13712782-T-C 11557106-T-C A*
16967534-C-A 14855654-C-A YY**+
7031905-C-A 7163864-C-A Y***+
21144411-GCCACTACCACCATC-G 18982525-GCCACTACCACCATC-G +
18388574-TCCTTGTCAAATTTGCTTC-T 16276694-TCCTTGTCAAATTTGCTTC-T P6_Gap **+
8353484-CCAGAG-C 8485443-CCAGAG-C ***+
22887562-C-A 20725676-C-A YY***+
22904820-C-A 20742934-C-A YY***+
18063802-A-G 15951922-A-G F2692 M2239 S20571 YY**+
15693255-C-G 13581375-C-G YY***+
16641386-C-T 14529506-C-T CTS6056 Z1123 YY**+
2687840-C-G 2819799-C-G YY**+
14215340-CACTCCATGT-C 12094634-CACTCCATGT-C **+
17710302-G-A 15598422-G-A YY**+
21929740-TC-T 19767854-TC-T **+
23099749-CATATGTATACATGTGAAA-C 20937863-CATATGTATACATGTGAAA-C **+
14781627-C-T 12669697-C-T YY**+
13199453-G-T 11043777-G-T **+
6905462-GTTATACTGTATTGGTTTTTTATTTGTATT-G 7037421-GTTATACTGTATTGGTTTTTTATTTGTATT-G **+
8769735-GGGTGGCTGAGTTCCTCCACCTCCCTGGCCAAGA-G 8901694-GGGTGGCTGAGTTCCTCCACCTCCCTGGCCAAGA-G +
15565866-C-A 13453986-C-A YY**+
22600770-GAA-G 20438884-GAA-G 12×A*
16051847-T-TA 13939967-T-TA 10×A*
7278757-C-T 7410716-C-T **
7269686-G-T 7401645-G-T **
7317526-C-A 7449485-C-A **
16958198-TG-T 14846318-TG-T **
7224675-C-A 7356634-C-A **
7315864-C-A 7447823-C-A **
7323693-C-A 7455652-C-A **
7293166-C-A 7425125-C-A **
7214700-C-A 7346659-C-A **
7205348-T-A 7337307-T-A **
17002964-C-A 14891084-C-A **
7192360-C-A 7324319-C-A **
16966872-C-A 14854992-C-A **
17073922-C-A 14962042-C-A **
7192219-C-A 7324178-C-A **
17280864-C-A 15168984-C-A **
6816487-A-G 6948446-A-G **
6869476-C-T 7001435-C-T BZ2414 **
6870604-C-A 7002563-C-A **
6871613-C-A 7003572-C-A **
6884865-C-A 7016824-C-A **
17325890-G-T 15214010-G-T **
6898832-C-A 7030791-C-A **
6929881-C-A 7061840-C-A **
6931185-C-A 7063144-C-A **
6932866-G-T 7064825-G-T **
17293147-C-A 15181267-C-A **
6953477-C-A 7085436-C-A **
7187703-C-A 7319662-C-A **
17276028-C-A 15164148-C-A **
17274293-C-A 15162413-C-A **
7020317-C-A 7152276-C-A **
7020324-C-A 7152283-C-A **
7021921-G-A 7153880-G-A **
7030142-C-A 7162101-C-A **
7035610-C-A 7167569-C-A **
17089496-C-A 14977616-C-A **
7352513-C-A 7484472-C-A **
17049623-C-A 14937743-C-A **
17032809-C-A 14920929-C-A **
16881840-C-A 14769960-C-A **
7414994-C-A 7546953-C-A **
7365507-A-G 7497466-A-G **
7934975-C-A 8066934-C-A **
7822302-C-A 7954261-C-A **
16667020-T-A 14555140-T-A **
7856585-C-A 7988544-C-A **
16640078-C-A 14528198-C-A **
7890453-T-C 8022412-T-C **
7899194-C-A 8031153-C-A **
16628606-A-G 14516726-A-G **
7921248-T-A 8053207-T-A **
16609039-C-A 14497159-C-A **
16602065-C-A 14490185-C-A **
7945542-CT-C 8077501-CT-C **
7793353-C-A 7925312-C-A **
16598980-TCAACA-T 14487100-TCAACA-T **
16583425-C-A 14471545-C-A **
16552598-C-A 14440718-C-A **
16515782-C-A 14403902-C-A **
16492272-C-T 14380392-C-T **
8128398-C-A 8260357-C-A **
8172687-CTTTTTTTT-C 8304646-CTTTTTTTT-C 22×T**
16418752-G-A 14306872-G-A **
16414377-C-A 14302497-C-A **
16407458-C-A 14295578-C-A **
8271451-A-G 8403410-A-G **
16705031-A-G 14593151-A-G **
16715966-C-A 14604086-C-A **
7387427-A-T 7519386-A-T **
16784217-A-G 14672337-A-G **
7387437-G-T 7519396-G-T **
7398068-CTTAGCG-C 7530027-CTTAGCG-C **
17366775-A-G 15254895-A-G **
7465805-C-A 7597764-C-A IR1_L **
7473999-C-A 7605958-C-A IR1_L **
7572694-C-A 7704653-C-A **
7581762-A-G 7713721-A-G **
16806787-C-A 14694907-C-A **
7592328-C-G 7724287-C-G **
16800683-T-A 14688803-T-A **
7617686-T-C 7749645-T-C **
7789852-G-T 7921811-G-T **
16769359-TG-T 14657479-TG-T **
16762164-C-A 14650284-C-A **
7637980-C-A 7769939-C-A **
7646419-A-G 7778378-A-G **
7664920-C-A 7796879-C-A **
7681151-C-A 7813110-C-A **
7685466-A-C 7817425-A-C **
7695020-C-A 7826979-C-A **
7703419-C-A 7835378-C-A **
7723535-A-G 7855494-A-G **
7781370-C-A 7913329-C-A **
6810561-G-A 6942520-G-A **
18900-G-T **
6715808-C-A 6847767-C-A **
2767111-C-A 2899070-C-A **
8690251-G-C 8822210-G-C **
4521322-TAAA-T 4653281-TAAA-T 15×A**
17646717-C-A 15534837-C-A **
10747001-TCC-T **
17637195-C-A 15525315-C-A **
17615245-C-A 15503365-C-A **
2738377-C-A 2870336-C-A **
2738970-C-A 2870929-C-A **
2766789-C-A 2898748-C-A **
17613656-C-A 15501776-C-A **
2773718-A-C 2905677-A-C **
22125188-C-A 19963302-C-A **
2796127-C-A 2928086-C-A **
2814877-TAAAA-T 2946836-TAAAA-T 14×A**
2818206-C-A 2950165-C-A **
2818251-C-T 2950210-C-T **
2848611-C-A 2980570-C-A **
2871986-C-A 3003945-C-A **
2877330-C-A 3009289-C-A **
2891191-C-A 3023150-C-A **
17591693-G-T 15479813-G-T **
17568958-G-T 15457078-G-T **
2924067-G-T 3056026-G-T **
56843732-C-A **
28719369-T-C 26573222-T-C **
17547465-C-A 15435585-C-A **
10821914-C-CTTCAG **
5687716-C-A 5819675-C-A **
17831260-A-T 15719380-A-T **
9422913-C-A 9585304-C-A **
17806878-C-A 15694998-C-A **
21084333-A-G 18922447-A-G **
22739716-CAAA-C 20577830-CAAA-C 24×A**
18961514-C-A 16849634-C-A **
17769736-C-T 15657856-C-T **
17641957-CTTT-C 15530077-CTTT-C 25×T**
13488550-C-G 11332874-C-G **
28496961-C-A 26350814-C-A **
17769731-G-C 15657851-G-C **
20201368-T-TG 18039482-T-TG P5_Dst **
21639037-C-A 19477151-C-A **
56843711-G-T **
17719947-C-A 15608067-C-A **
13465954-A-T 11310278-A-T **
17894314-C-A 15782434-C-A **
17705079-C-A 15593199-C-A **
22760886-C-A 20599000-C-A **
10759929-A-G **
14022097-C-A 11901391-C-A **
9725182-C-A 9887573-C-A IR3_Prx **
20201411-T-G 18039525-T-G P5_Dst **
2925975-C-A 3057934-C-A **
3063726-T-TAA 3195685-T-TAA 13×A**
6707397-C-A 6839356-C-A **
6355616-C-T 6487575-C-T **
5473317-G-T 5605276-G-T **
5494779-C-A 5626738-C-A **
5778843-A-T 5910802-A-T **
5796957-GAA-G 5928916-GAA-G 13×A**
5963540-T-C 6095499-T-C **
6001904-C-A 6133863-C-A **
6024018-G-T 6155977-G-T **
6039344-G-T 6171303-G-T **
6040148-C-A 6172107-C-A **
6120377-A-G 6252336-A-G **
6386055-C-A 6518014-C-A **
17506987-G-A 15395107-G-A **
6388934-C-A 6520893-C-A **
6391152-A-T 6523111-A-T **
6399569-G-T 6531528-G-T **
6445941-G-A 6577900-G-A **
6632965-G-T 6764924-G-T **
6654908-A-G 6786867-A-G **
17436493-G-T 15324613-G-T **
16404342-C-A 14292462-C-A **
6697048-C-A 6829007-C-A **
17393845-C-A 15281965-C-A **
6707377-C-A 6839336-C-A **
5420580-C-A 5552539-C-A **
5358427-C-A 5490386-C-A **
3063801-C-G 3195760-C-G **
4009039-G-T 4140998-G-T **
3076069-C-CTT 3208028-C-CTT 25×T**
3092428-C-A 3224387-C-A **
17547452-T-A 15435572-T-A **
3271516-C-T 3403475-C-T **
3274807-C-A 3406766-C-A **
3422125-C-A 3554084-C-A **
3545030-C-A 3676989-C-A **
3578584-A-G 3710543-A-G **
3599381-C-A 3731340-C-A **
3972086-C-A 4104045-C-A **
3997039-C-A 4128998-C-A **
4067250-C-A 4199209-C-A **
5108088-T-C 5240047-T-C **
4136834-T-C 4268793-T-C **
4257129-C-A 4389088-C-A **
17547431-C-A 15435551-C-A **
4471548-G-T 4603507-G-T **
4562855-G-T 4694814-G-T **
4626750-C-A 4758709-C-A **
4780682-C-T 4912641-C-T **
4872347-C-A 5004306-C-A **
17532507-C-A 15420627-C-A **
4901693-C-G 5033652-C-G **
4931884-T-C 5063843-T-C **
17400877-G-A 15288997-G-A **
16344392-C-T 14232512-C-T **
8310913-G-T 8442872-G-T **
13833476-G-T 11712770-G-T **
13681425-C-A 11525749-C-A **
13703965-G-A 11548289-G-A **
15344541-C-A 13232660-C-A **
13720487-G-T 11564811-G-T Z38492 **
11643309-C-A **
11655685-A-G **
11655686-C-G **
11655691-G-T **
13804874-A-G 11684168-A-G **
13808106-G-T 11687400-G-T **
15335964-G-A 13224082-G-A **
13585886-G-T 11430210-G-T **
15313448-C-A 13201553-C-A **
13855595-C-A 11734889-C-A **
15263869-C-A 13151959-C-A **
13899749-C-A 11779043-C-A **
13941293-C-A 11820587-C-A **
15234479-A-T 13122565-A-T **
15232834-C-A 13120920-C-A **
14024298-C-A 11903592-C-A **
15222785-C-A 13110871-C-A **
15220267-T-C 13108353-T-C **
13605350-C-A 11449674-C-A **
13485780-G-C 11330104-G-C **
14115524-C-A 11994818-C-A **
13453753-C-A 11298077-C-A **
11011537-A-G **
11014492-C-TGGTAG **
11020825-C-A **
13205233-C-A 11049557-C-A **
13220445-G-T 11064769-G-T **
13226201-G-A 11070525-G-A **
13236885-C-A 11081209-C-A **
13253879-T-C 11098203-T-C **
13254021-TC-T 11098345-TC-T **
15455713-C-A 13343833-C-A **
13453756-TC-T 11298080-TC-T **
13485733-G-C 11330057-G-C **
13453775-T-A 11298099-T-A **
15412806-C-A 13300926-C-A **
13463448-C-A 11307772-C-A **
13466847-T-C 11311171-T-C **
15391184-A-G 13279304-A-G **
15375852-C-A 13263972-C-A Y93656 **
13471239-G-T 11315563-G-T **
13473567-G-A 11317891-G-A **
13482853-C-A 11327177-C-A **
15372507-C-A 13260627-C-A **
13485715-A-T 11330039-A-T **
14071354-CTTTTTT-C 11950648-CTTTTTT-C 25×T**
15202594-C-A 13090680-C-A **
10944114-C-T **
14858666-A-ATTT 12746732-A-ATTT 19×T**
14426347-C-A 12305622-C-A **
14430969-C-A 12310242-C-A **
14452193-C-A 12331466-C-A **
14453226-A-T 12332499-A-T **
14453685-AC-A 12332958-AC-A **
14476617-C-A 12355886-C-A **
14484497-A-T 12363766-A-T **
14905353-C-CT 12793420-C-CT 8×T**
14861482-C-A 12749548-C-A **
14508838-C-A 12397043-C-A **
14550239-T-A 12438440-T-A **
14406822-C-A 12286120-C-A **
14569944-ATTTAAAG-A 12458144-ATTTAAAG-A **
14571337-C-A 12459537-C-A **
14578140-C-A 12466340-C-A **
14858254-C-A 12746320-C-A **
14815082-A-T 12703153-A-T **
14764228-C-A 12652297-C-A **
14621108-C-A 12509306-C-A **
14626904-C-A 12514972-C-A **
14651843-C-A 12539908-C-A **
14654118-C-A 12542183-C-A **
14415683-C-A 12294980-C-A **
15007045-C-A 12895130-C-A **
14116761-G-T 11996055-G-T **
15136042-C-A 13024129-C-A **
14139862-C-A 12019156-C-A **
14152902-C-A 12032196-C-A **
14185350-C-A 12064644-C-A **
14200423-C-A 12079717-C-A **
14206248-C-A 12085542-C-A **
14206291-C-A 12085585-C-A **
15158994-C-A 13047080-C-A **
14213237-C-A 12092531-C-A **
15145014-C-A 13033101-C-A **
14226719-C-A 12106013-C-A **
14237985-G-T 12117279-G-T **
15068854-A-T 12956945-A-T **
14237986-A-G 12117280-A-G **
14238417-A-G 12117711-A-G **
14240620-C-A 12119914-C-A **
14248565-T-C 12127859-T-C **
14266756-G-T 12146050-G-T **
14281863-C-A 12161157-C-A **
14281902-C-A 12161196-C-A **
14310543-C-T 12189837-C-T **
14324531-C-A 12203825-C-A **
14327211-C-T 12206505-C-T **
14329522-C-A 12208816-C-A **
11011524-A-G **
10888390-TC-T **
8317132-C-A 8449091-C-A **
8720804-C-A 8852763-C-A **
16184730-C-A 14072850-C-A **
8631459-A-T 8763418-A-T **
8631470-A-T 8763429-A-T **
16094260-C-A 13982380-C-A **
16076584-A-G 13964704-A-G **
8669419-C-A 8801378-C-A **
16057490-C-A 13945610-C-A **
8676826-C-A 8808785-C-A **
8706740-C-A 8838699-C-A **
16008756-A-G 13896876-A-G **
15986811-C-A 13874931-C-A **
8595031-C-A 8726990-C-A **
15976150-C-A 13864270-C-A **
15912647-C-A 13800767-C-A **
15901422-C-A 13789542-C-A **
8837437-A-G 8969396-A-G **
8838621-C-T 8970580-C-T **
8842530-G-T 8974489-G-T **
8853401-G-T 8985360-G-T **
8865746-C-A 8997705-C-A **
8867049-C-A 8999008-C-A **
8893711-G-T 9025670-G-T **
16191807-C-A 14079927-C-A **
8589975-C-A 8721934-C-A **
15803903-A-T 13692023-A-T **
8441707-C-A 8573666-C-A **
8339693-A-G 8471652-A-G **
8350296-T-A 8482255-T-A **
8352396-C-A 8484355-C-A **
8397826-C-A 8529785-C-A **
8402852-C-A 8534811-C-A **
8407211-C-A 8539170-C-A **
8407788-C-A 8539747-C-A **
16340416-C-A 14228536-C-A **
16338201-C-A 14226321-C-A **
16321765-G-A 14209885-G-A **
8443155-C-T 8575114-C-T **
8585600-C-T 8717559-C-T **
16312033-C-A 14200153-C-A **
8481084-A-T 8613043-A-T **
8481097-A-T 8613056-A-T **
8481095-TTA-T 8613054-TTA-T **
16294390-C-A 14182510-C-A **
8497722-G-A 8629681-G-A M9612 V2139 **
16240596-C-T 14128716-C-T **
16233330-T-C 14121450-T-C **
16231790-C-A 14119910-C-A **
8540645-C-A 8672604-C-A **
8540721-C-A 8672680-C-A **
15821571-C-T 13709691-C-T **
8978693-A-G 9141084-A-G **
10837846-CA-C **
10625036-C-A **
15550172-C-A 13438292-C-A **
9889281-G-A 10051672-G-A **
9925913-C-A 10088304-C-A **
9927790-C-A 10090181-C-A **
9948905-G-A 10111296-G-A **
15530378-A-G 13418498-A-G **
15500764-G-A 13388884-G-A **
10015805-C-A 10178196-C-A **
15482884-GC-G 13371004-GC-G **
15476426-A-G 13364546-A-G **
10626563-G-T **
9873159-C-A 10035550-C-A **
10627402-CCA-C **
10667012-TC-T **
10671030-C-A **
10677243-C-A **
10694121-G-T **
10755010-T-A **
10768873-C-G **
10772409-T-G **
10816518-G-T **
10816533-A-T **
15476399-C-A 13364519-C-A **
15587838-ACAGAGGTTGCAGTG-A 13475958-ACAGAGGTTGCAGTG-A **
15611810-C-T 13499930-C-T **
15791261-T-C 13679381-T-C **
9438969-C-A 9601360-C-A **
9018249-C-A 9180640-C-A **
15770052-C-A 13658172-C-A **
15724236-T-A 13612356-T-A **
9083564-CT-C 9245955-CT-C **
15723882-C-A 13612002-C-A **
9104444-G-A 9266835-G-A **
15715701-G-T 13603821-G-T **
9371480-A-ATG 9533871-A-ATG **
9427388-C-A 9589779-C-A **
15708008-C-A 13596128-C-A **
15706894-C-A 13595014-C-A **
9839380-A-G 10001771-A-G **
9462152-G-T 9624543-G-T **
9489603-C-A 9651994-C-A **
9491113-C-A 9653504-C-A **
15690181-C-A 13578301-C-A **
15683875-C-A 13571995-C-A **
9606611-G-T 9769002-G-T IR3_Prx **
15678588-C-A 13566708-C-A **
9763954-G-T 9926345-G-T **
9776263-C-A 9938654-C-A **
15615701-C-A 13503821-C-A **
15614509-C-A 13502629-C-A **
17631803-C-A 15519923-C-A **
2835607-C-A 2967566-C-A 16×T**
16102031-TTG-T 13990151-TTG-T P8_Prx **
22125626-C-T 19963740-C-T **
22443093-G-C 20281207-G-C DYZ19 **
22439851-G-T 20277965-G-T DYZ19 **
22297968-C-A 20136082-C-A DYZ19 **
22257991-C-A 20096105-C-A DYZ19 **
22200691-C-A 20038805-C-A **
22130192-G-T 19968306-G-T **
22127964-G-A 19966078-G-A **
22031568-C-A 19869682-C-A **
22536773-T-C 20374887-T-C **
22025390-C-A 19863504-C-A **
22018880-C-A 19856994-C-A **
21976076-G-T 19814190-G-T **
21975227-A-G 19813341-A-G **
21969589-T-A 19807703-T-A **
21945519-C-A 19783633-C-A **
21827846-C-A 19665960-C-A **
22479875-C-A 20317989-C-A DYZ19 **
22554767-C-A 20392881-C-A **
21775446-C-A 19613560-C-A **
22969096-C-A 20807210-C-A **
23128869-G-T 20966983-G-T **
23117667-C-A 20955781-C-A **
23080595-C-A 20918709-C-A **
23054586-G-A 20892700-G-A **
23043225-T-A 20881339-T-A **
23025669-C-A 20863783-C-A **
22997358-T-A 20835472-T-A **
22916123-T-C 20754237-T-C **
22613592-C-A 20451706-C-A **
22890090-C-A 20728204-C-A **
22887209-C-A 20725323-C-A **
22845812-T-C 20683926-T-C **
22821559-C-A 20659673-C-A **
22773274-G-T 20611388-G-T **
22682296-G-A 20520410-G-A **
22653167-C-A 20491281-C-A **
21788486-C-CT 19626600-C-CT 12×T**
15406847-G-A 13294967-G-A **
23138494-T-A 20976608-T-A **
20994205-A-G 18832319-A-G P4_Dst **
20085098-C-T 17973218-C-T P5_Dst **
20211217-C-G 18049331-C-G FGC17237 P5_Dst **
20533025-AAAAATAACTACAAGAT-A 18371139-AAAAATAACTACAAGAT-A P5_Dst **
20891878-C-A 18729992-C-A P4_Dst **
20839666-C-A 18677780-C-A P4_Gap **
20839138-C-A 18677252-C-A P4_Gap **
20933421-CCCCA-C 18771535-CCCCA-C P4_Dst **
20994211-A-AAG 18832325-A-AAG P4_Dst **
21140571-C-A 18978685-C-A **
20822740-C-A 18660854-C-A P4_Gap **
20808458-CTATATTCT-C 18646572-CTATATTCT-C P4_Gap **
20659348-T-A 18497462-T-A P4_Prx **
20560612-G-T 18398726-G-T P5_Dst **
20497377-T-TC 18335491-T-TC P5_Dst **
19997550-C-A 17885670-C-A P5_Prx **
19926976-T-A 17815096-T-A P5_Prx **
21032327-C-A 18870441-C-A **
21141538-C-A 18979652-C-A **
21705745-C-G 19543859-C-G **
18515710-TTTTCTTC-T 16403830-TTTTCTTC-T P6_Dst **
21697097-C-A 19535211-C-A **
21569939-G-A 19408053-G-A SK2369 **
21551241-C-A 19389355-C-A **
18019174-C-A 15907294-C-A ****
21455790-GA-G 19293904-GA-G **
21436641-C-A 19274755-C-A **
21406971-C-A 19245085-C-A **
21357822-C-G 19195936-C-G **
21145345-C-A 18983459-C-A **
21332802-C-A 19170916-C-A **
21330327-C-A 19168441-C-A **
21316962-C-A 19155076-C-A **
21282089-T-A 19120203-T-A **
21238815-C-A 19076929-C-A **
21210392-C-A 19048506-C-A **
21204984-C-A 19043098-C-A **
23136152-G-T 20974266-G-T **
23147411-C-A 20985525-C-A **
19533267-C-A 17421387-C-A **
28700289-C-A 26554142-C-A **
28747543-C-A 26601396-C-A **
28746944-C-A 26600797-C-A **
28722146-G-A 26575999-G-A **
28722124-C-A 26575977-C-A **
17302675-AAT-A 15190795-AAT-A **
28701814-C-A 26555667-C-A **
24415767-TA-T 22269620-TA-T **
28617237-G-T 26471090-G-T **
28747622-G-C 26601475-G-C **
28587309-C-A 26441162-C-A **
28046633-TTAAAAAA-T 25900486-TTAAAAAA-T P1_Y2 **
28046587-G-T 25900440-G-T P1_Y2 **
27618169-CTT-C 25472022-CTT-C P1_Y2 14×T**
13465969-A-T 11310293-A-T **
27521989-G-A 25375842-G-A P1_Y2 **
27477630-TAAATAAATA-T 25331483-TAAATAAATA-T P1_Y2 **
13692828-C-T 11537152-C-T **
9963864-C-T 10126255-C-T **
26500461-C-T 24354314-C-T P1_Y1 **
28802459-A-G 26656312-A-G **
13883-G-C **
19926979-G-T 17815099-G-T P5_Prx **
28818761-TAGGG-T 26672614-TAGGG-T **
21542988-G-A 19381102-G-A CTS416Z29628 **
4447773-C-G 4579732-C-G Z4781 **
7545969-C-A 7677928-C-A M619 F989 V1190 ****
14471488-TG-T 12350757-TG-T **
15271994-C-G 13160083-C-G M2320 F287 V2864 **
9963863-T-C 10126254-T-C **
17641985-C-T 15530105-C-T **
18945240-C-T 16833360-C-T CTS9515 M744 ****
28790685-TGAATGGAAAAAATGGAATCCAATG-T 26644538-TGAATGGAAAAAATGGAATCCAATG-T **
28788130-A-G 26641983-A-G **
5669623-C-A 5801582-C-A **
28783831-C-A 26637684-C-A **
28763060-C-A 26616913-C-A **
27378213-T-C 25232066-T-C P1_g3 **
25937895-A-G 23791748-A-G P1_Y1 **
23153078-C-A 20991192-C-A **
23480265-C-A 21318379-C-A **
23732095-C-A 21570209-C-A **
23655500-A-G 21493614-A-G **
23627583-C-A 21465697-C-A **
23624503-C-A 21462617-C-A **
23609944-G-T 21448058-G-T **
23596643-C-A 21434757-C-A **
23482865-C-A 21320979-C-A **
23449950-C-A 21288064-C-A **
23789103-C-A 21627217-C-A **
23439272-C-A 21277386-C-A **
23379135-C-T 21217249-C-T **
23343902-C-A 21182016-C-A **
23315599-C-A 21153713-C-A **
23279594-C-A 21117708-C-A **
23272465-C-T 21110579-C-T **
23249309-T-C 21087423-T-C **
23779197-C-A 21617311-C-A **
23830229-C-A 21668343-C-A **
25335816-C-A 23189669-C-A P2_r1 **
24406572-T-C 22260425-T-C **
24637480-G-GTA 22491333-G-GTA P3_t2 **
24634006-C-T 22487859-C-T P3_t2 **
24620531-C-A 22474384-C-A P3_t2 **
24600403-C-T 22454256-C-T P3_t2 **
24469700-C-A 22323553-C-A **
24433321-C-A 22287174-C-A **
24420867-A-T 22274720-A-T **
24378309-C-A 22232162-C-A **
21753264-T-TC **
24360655-G-T 22214508-G-T **
24357970-C-A 22211823-C-A **
24342205-C-A 22196058-C-A P3_t1 **
24270917-ATTTTTT-A 22124770-ATTTTTT-A P3_b1 19×T**
7429086-C-T 7561045-C-T *****
24052434-C-A 21906287-C-A P3_b1 **
24007119-C-A 21860972-C-A **
23994966-CT-C 21848819-CT-C **
19682203-A-T 17570323-A-T P5_Prx **
14748086-C-T 12636155-C-T **
19512526-T-C 17400646-T-C **
27149220-G-T 25003073-G-T P1_g3 **
24750728-GGGGCTAAGCA-G 22604581-GGGGCTAAGCA-G P3_b2 **
18249311-C-T 16137431-C-T **
18174357-C-A 16062477-C-A **
25663004-C-T 23516857-C-T P1_b3 **
18153633-T-G 16041753-T-G **
18136291-C-A 16024411-C-A **
19239210-C-A 17127330-C-A **
27005356-TA-T 24859209-TA-T P1_r4 **
27150102-AAAAATACTTTTTGTGATTACCATCAGTTT-A 25003955-AAAAATACTTTTTGTGATTACCATCAGTTT-A P1_g3 **
18269808-C-A 16157928-C-A **
18056160-C-A 15944280-C-A **
19268488-TA-T 17156608-TA-T **
17975613-C-A 15863733-C-A **
13804386-GAAGGAA-G 11683680-GAAGGAA-G ****
17947225-C-T 15835345-C-T **
25377489-ACATTTTCCCTGTACTTGAAACATGTACGGTATACCT-A 23231342-ACATTTTCCCTGTACTTGAAACATGTACGGTATACCT-A P2_r2 **
25645011-CTGTTTTTCTTG-C 23498864-CTGTTTTTCTTG-C P1_b3 **
28001595-ATTGTTACC-A 25855448-ATTGTTACC-A P1_Y2 **
28005545-ACAAC-A 25859398-ACAAC-A P1_Y2 **
19183411-C-G 17071531-C-G **
19161881-C-A 17050001-C-A **
19338566-C-A 17226686-C-A **
18682658-C-T 16570778-C-T **
18869965-C-A 16758085-C-A **
18916256-C-A 16804376-C-A **
18867397-C-A 16755517-C-A **
18918949-C-A 16807069-C-A **
18811551-C-A 16699671-C-A **
18924728-A-G 16812848-A-G **
22457981-G-A 20296095-G-A DYZ19 *****
18966864-T-C 16854984-T-C **
18974381-A-T 16862501-A-T **
18979369-C-A 16867489-C-A **
18546379-G-T 16434499-G-T **
18629570-C-A 16517690-C-A **
19020414-TC-T 16908534-TC-T **
19040591-C-A 16928711-C-A **
19108523-C-A 16996643-C-A **
19119597-C-A 17007717-C-A **
18572804-C-A 16460924-C-A **
19119619-C-A 17007739-C-A **
18569492-G-A 16457612-G-A ZS10896 **
19149490-T-C 17037610-T-C **
19322469-C-A 17210589-C-A **
18904181-T-C 16792301-T-C **
13488245-G-T 11332569-G-T **
17909432-C-A 15797552-C-A **
19444173-T-A 17332293-T-A **
19444008-C-A 17332128-C-A **
19444260-T-G 17332380-T-G **
17873689-AGTAGTAAT-A 15761809-AGTAGTAAT-A **
17856766-C-A 15744886-C-A **
19472655-C-A 17360775-C-A **
14449641-C-A 12328914-C-A **
19394059-CTTT-C 17282179-CTTT-C 37×T**
13485718-T-C 11330042-T-C **
17879817-C-A 15767937-C-A **
6959733-G-GT 7091692-G-GT 9×T**
19436142-C-A 17324262-C-A **
17928892-C-G 15817012-C-G **
26042444-C-A 23896297-C-A P1_Y1 **
10799624-C-A **
19414747-C-A 17302867-C-A **
9480766-C-A 9643157-C-A **
10955458-C-G **
14850239-C-A 12738305-C-A ***
23413556-C-A 21251670-C-A ***
14847551-G-T 12735617-G-T ***
23467433-C-A 21305547-C-A ***
23424802-C-A 21262916-C-A ***
23429888-C-A 21268002-C-A ***
18642237-C-CT 16530357-C-CT ***
18654937-C-A 16543057-C-A ***
15051996-A-G 12940087-A-G ***
23579890-C-T 21418004-C-T ***
18600744-A-T 16488864-A-T ***
17555193-C-A 15443313-C-A ***
18572019-C-T 16460139-C-T ***
17774245-C-A 15662365-C-A ***
23644507-A-G 21482621-A-G ***
17567137-C-A 15455257-C-A ***
15448217-TA-T,TAA 13336337-TA-T,TAA 12×A***
15454604-G-T 13342724-G-T ***
15462522-C-A 13350642-C-A ***
15470368-C-A 13358488-C-A ***
23613241-C-A 21451355-C-A ***
23613106-C-A 21451220-C-A ***
23607219-C-A 21445333-C-A ***
28813788-G-A 26667641-G-A ***
18596990-G-T 16485110-G-T ***
23577841-T-A 21415955-T-A ***
23548383-C-T 21386497-C-T ***
18666230-C-A 16554350-C-A ***
23314939-G-T 21153053-G-T ***
23377574-C-A 21215688-C-A ***
23062720-C-T 20900834-C-T ***
23127414-CAAAA-C,CAAAAA 20965528-CAAAA-C,CAAAAA 24×A***
23122335-A-T 20960449-A-T ***
18806278-C-A 16694398-C-A ***
56834210-G-A ***
23073217-C-A 20911331-C-A ***
15591966-C-A 13480086-C-A ***
18832757-T-TAA 16720877-T-TAA 12×A***
15549186-AACAAACTTACTCTTATCTCCCCTTCTCCAC-A 13437306-AACAAACTTACTCTTATCTCCCCTTCTCCAC-A ***
18854929-T-C 16743049-T-C ***
23034293-CTT-C,CTTT 20872407-CTT-C,CTTT 15×T***
14753532-C-A 12641601-C-A ***
15822-C-A ***
18890413-C-T 16778533-C-T ***
15625159-C-A 13513279-C-A ***
15650089-C-A 13538209-C-A ***
18805197-C-A 16693317-C-A ***
18802770-C-A 16690890-C-A ***
18666232-A-T 16554352-A-T ***
14792520-C-A 12680591-C-A ***
18673269-T-C 16561389-T-C ***
18678216-C-A 16566336-C-A ***
14828024-C-A 12716091-C-A ***
14824642-T-C 12712709-T-C ***
23256027-G-T 21094141-G-T ***
28818788-G-T 26672641-G-T ***
23251328-C-T 21089442-C-T ***
15516792-A-T 13404912-A-T ***
18691954-C-A 16580074-C-A ***
23183673-C-A 21021787-C-A ***
14775916-C-A 12663985-C-A ***
18753701-C-A 16641821-C-A ***
18766040-A-G 16654160-A-G ***
56828724-C-G ***
18778362-TAA-T 16666482-TAA-T 12×A***
15430884-C-A 13319004-C-A ***
23804584-ACAATAAAAAAATG-A 21642698-ACAATAAAAAAATG-A ***
15410223-C-A 13298343-C-A ***
15197698-C-A 13085784-C-A ***
18032188-G-T 15920308-G-T ***
15159019-G-A 13047105-G-A ***
17648781-C-A 15536901-C-A ***
14929661-C-A 12817726-C-A ***
18037687-C-A 15925807-C-A ***
15196266-C-A 13084352-C-A ***
27990710-AGGTAGGAGAGTAG-A 25844563-AGGTAGGAGAGTAG-A P1_Y2 ***
18006420-AGTTTT-A 15894540-AGTTTT-A P7_Gap 5×GTTTT***
28787315-C-T 26641168-C-T ***
18078731-C-A 15966851-C-A ***
17623335-G-T 15511455-G-T ***
14926967-C-A 12815032-C-A ***
15209062-G-T 13097148-G-T ***
18119307-C-A 16007427-C-A ***
18019511-C-A 15907631-C-A ***
28600983-ATT-A,ATTT 26454836-ATT-A,ATTT 17×T***
18124333-GA-G 16012453-GA-G ***
17678922-C-A 15567042-C-A ***
15056068-C-A 12944160-C-A ***
17769571-G-A 15657691-G-A ***
14986626-C-T 12874694-C-T ***
17938416-C-A 15826536-C-A ***
15077241-C-A 12965331-C-A ***
14975108-C-A 12863183-C-A ***
15086977-A-C 12975067-A-C ***
28608758-C-A 26462611-C-A ***
17944161-C-A 15832281-C-A ***
15104096-C-A 12992184-C-A ***
17649009-A-G 15537129-A-G ***
17957846-C-A 15845966-C-A ***
28679418-T-C 26533271-T-C ***
28783917-C-A 26637770-C-A ***
15104519-T-C 12992607-T-C ***
15218209-CT-C 13106295-CT-C ***
17613669-C-A 15501789-C-A ***
23768719-C-A 21606833-C-A ***
23807613-C-A 21645727-C-A ***
15372156-A-G 13260276-A-G ***
23994158-C-A 21848011-C-A ***
18412937-A-G 16301057-A-G P6_Gap ***
23864950-C-A 21703064-C-A ***
23849853-C-A 21687967-C-A ***
15374693-C-A 13262813-C-A ***
28805380-T-A 26659233-T-A ***
24005650-G-A 21859503-G-A ***
15018646-C-A 12906735-C-A ***
23799622-C-A 21637736-C-A ***
15383001-C-A 13271121-C-A ***
17582401-G-A 15470521-G-A ***
18546692-C-A 16434812-C-A ***
15404329-GAA-G,GA 13292449-GAA-G,GA 13×A***
17594616-A-G 15482736-A-G ***
15349150-C-A 13237269-C-A ***
15229399-AAGGAGTTAGGAG-A 13117485-AAGGAGTTAGGAG-A ***
24370567-C-A 22224420-C-A ***
17852683-C-A 15740803-C-A ***
24459151-T-C 22313004-T-C ***
24433078-G-T 22286931-G-T ***
24433012-G-T 22286865-G-T ***
24415996-C-A 22269849-C-A ***
18216928-C-A 16105048-C-A ***
15657820-C-A 13545940-C-A ***
18399213-C-A 16287333-C-A P6_Gap ***
14904820-C-T 12792887-C-T ***
24355629-C-T 22209482-C-T ***
17610340-G-A 15498460-G-A ***
14722390-C-A 12610458-C-A ***
15342868-C-A 13230987-C-A ***
24096041-C-A 21949894-C-A P3_b1 ***
18267939-C-A 16156059-C-A ***
18251700-C-A 16139820-C-A ***
22806485-C-A 20644599-C-A ***
15669615-C-A 13557735-C-A ***
16730003-GAA-G,GAAA 14618123-GAA-G,GAAA 17×A***
21340502-A-G 19178616-A-G ***
19268571-C-A 17156691-C-A ***
16716644-C-A 14604764-C-A ***
17355417-TC-T 15243537-TC-T ***
21327486-G-T 19165600-G-T ***
17349981-C-A 15238101-C-A ***
16717673-G-A 14605793-G-A ***
21301172-C-A 19139286-C-A ***
21294684-TCC-T 19132798-TCC-T ***
17368609-C-A 15256729-C-A ***
19269549-C-A 17157669-C-A ***
21266314-C-A 19104428-C-A ***
21261806-C-T 19099920-C-T ***
21244333-A-G 19082447-A-G ***
17335159-C-A 15223279-C-A ***
16777355-A-G 14665475-A-G ***
21218125-C-A 19056239-C-A ***
19271882-C-A 17160002-C-A ***
21360160-C-A 19198274-C-A ***
16667424-C-A 14555544-C-A ***
21169542-A-C 19007656-A-C ***
21477241-C-A 19315355-C-A ***
16505433-C-A 14393553-C-A ***
19190281-C-A 17078401-C-A ***
16525553-C-A 14413673-C-A ***
16538139-C-A 14426259-C-A ***
21556407-G-A 19394521-G-A ***
17398290-C-A 15286410-C-A ***
21528667-C-A 19366781-C-A ***
21518655-AC-A 19356769-AC-A ***
21468325-C-A 19306439-C-A ***
19250424-C-A 17138544-C-A ***
19221207-G-A 17109327-G-A ***
16612125-G-GTC 14500245-G-GTC 8×TC***
21453000-C-A 19291114-C-A ***
19243982-C-T 17132102-C-T ***
16633219-C-A 14521339-C-A ***
21433727-C-A 19271841-C-A ***
21428258-G-T 19266372-G-T ***
21428247-T-C 19266361-T-C ***
21422578-C-A 19260692-C-A ***
17329394-G-T 15217514-G-T ***
21161528-C-A 18999642-C-A ***
16484668-CA-C 14372788-CA-C ***
19523779-C-A 17411899-C-A ***
19453897-C-A 17342017-C-A ***
20137430-C-A 18025550-C-A P5_Dst ***
17009717-CTGA-C 14897837-CTGA-C ***
20001878-G-A 17889998-G-A P5_Prx ***
17256283-T-C 15144403-T-C ***
19482474-TC-T 17370594-TC-T ***
19510495-A-G 17398615-A-G FGC1724 Y5325 ***
19525244-C-A 17413364-C-A ***
17094209-C-A 14982329-C-A ***
16962680-TC-T 14850800-TC-T ***
17112707-C-A 15000827-C-A ***
17134226-C-A 15022346-C-A ***
17134555-G-T 15022675-G-T ***
17159359-C-A 15047479-C-A ***
17166770-TC-T 15054890-TC-T ***
17191780-G-A 15079900-G-A ***
17195912-C-A 15084032-C-A ***
19519594-CA-C,CAA 17407714-CA-C,CAA 14×A***
17253570-C-A 15141690-C-A ***
19449896-C-A 17338016-C-A ***
16961231-C-A 14849351-C-A ***
21159425-G-C 18997539-G-C ***
21052749-G-A 18890863-G-A ***
19286980-T-C 17175100-T-C ***
16813075-G-A 14701195-G-A 15×CA***
16818704-AT-A 14706824-AT-A ***
16850907-C-A 14739027-C-A ***
21113956-C-A 18952070-C-A ***
16856082-C-A 14744202-C-A ***
21091681-C-A 18929795-C-A ***
16856304-C-A 14744424-C-A ***
19380741-G-A 17268861-G-A ***
17294087-C-A 15182207-C-A ***
19392778-GT-G,GTT 17280898-GT-G,GTT 12×T***
17315766-C-A 15203886-C-A ***
17296788-G-A 15184908-G-A ***
16889462-G-A 14777582-G-A ***
16899805-C-A 14787925-C-A ***
19400093-G-T 17288213-G-T ***
17294352-C-T 15182472-C-T ***
16926991-G-A 14815111-G-A ***
17294090-C-A 15182210-C-A ***
21616185-C-A 19454299-C-A ***
21652741-C-A 19490855-C-A ***
22912887-T-A 20751001-T-A ***
22462805-C-A 20300919-C-A DYZ19 ***
15869339-A-G 13757459-A-G ***
22512055-A-G 20350169-A-G DYZ19 ***
22487168-A-G 20325282-A-G DYZ19 ***
15882292-C-A 13770412-C-A ***
22474281-A-G 20312395-A-G DYZ19 ***
22465712-GTTACAGCACTTAAAGGT-G 20303826-GTTACAGCACTTAAAGGT-G DYZ19 ***
15913423-C-A 13801543-C-A ***
22464710-G-T 20302824-G-T DYZ19 ***
15993130-C-A 13881250-C-A ***
22559281-G-A 20397395-G-A ***
15999401-C-A 13887521-C-A ***
18998414-T-A 16886534-T-A ***
19009420-C-A 16897540-C-A ***
22356503-G-T 20194617-G-T DYZ19 ***
16019857-C-A 13907977-C-A ***
22316492-C-A 20154606-C-A DYZ19 ***
19078385-TATTA-T 16966505-TATTA-T ***
22163014-TA-T 20001128-TA-T ***
22554924-C-A 20393038-C-A ***
18953938-C-A 16842058-C-A ***
16170196-C-A 14058316-C-A ***
19517046-C-A 17405166-C-A ***
22905026-C-A 20743140-C-A ***
22901695-C-A 20739809-C-A ***
18907976-C-A 16796096-C-A ***
15704363-T-C 13592483-T-C ***
22860347-C-A 20698461-C-A ***
22832917-C-A 20671031-C-A ***
17527912-C-A 15416032-C-A ***
22820056-C-A 20658170-C-A ***
22802633-C-A 20640747-C-A ***
22657350-A-G 20495464-A-G ***
15720723-C-A 13608843-C-A ***
15720869-C-A 13608989-C-A ***
22794070-C-A 20632184-C-A ***
15722409-C-A 13610529-C-A ***
18922749-C-A 16810869-C-A ***
22737231-CAAAA-C,CAAA 20575345-CAAAA-C,CAAA 18×A***
22735322-G-T 20573436-G-T ***
22721955-C-A 20560069-C-A ***
22711092-C-A 20549206-C-A ***
22141333-C-A 19979447-C-A ***
16176432-C-A 14064552-C-A ***
16444676-C-A 14332796-C-A FGC63406 Y31985 ***
17439694-C-A 15327814-C-A ***
21916016-G-T 19754130-G-T ***
21885200-C-A 19723314-C-A ***
21884162-G-C 19722276-G-C ***
21873534-TC-T 19711648-TC-T ***
21862363-C-A 19700477-C-A ***
19158968-C-T 17047088-C-T ***
16385638-T-TTA 14273758-T-TTA ***
17460349-G-T 15348469-G-T ***
21757848-C-A 19595962-C-A ***
17467649-AC-A 15355769-AC-A ***
16387017-C-A 14275137-C-A ***
21757798-C-A 19595912-C-A ***
16401328-C-A 14289448-C-A ***
21719468-C-CT 19557582-C-CT 8×T***
21707657-C-A 19545771-C-A ***
16407676-C-A 14295796-C-A ***
17402743-C-A 15290863-C-A ***
21690909-CAAA-C,CAA 19529023-CAAA-C,CAA 14×A***
21663262-TAAA-T,TA 19501376-TAAA-T,TA 15×A***
19154480-C-A 17042600-C-A ***
16312068-GAAAAA-G,GAAA 14200188-GAAAAA-G,GAAA 15×A***
22141261-T-A 19979375-T-A ***
22068232-C-A 19906346-C-A ***
9645027-G-A 9807418-G-A IR3_Prx ***
16192246-C-A 14080366-C-A ***
22119658-C-A 19957772-C-A ***
16217255-G-C 14105375-G-C ***
16219132-G-A 14107252-G-A ***
22098540-C-A 19936654-C-A ***
16226346-C-T 14114466-C-T ***
22069723-TTCTTAAAGA-T 19907837-TTCTTAAAGA-T ***
22041033-CACCA-C 19879147-CACCA-C ***
19137015-A-G 17025135-A-G ***
22031284-C-A 19869398-C-A ***
19120175-C-A 17008295-C-A ***
22024154-C-A 19862268-C-A ***
17469990-C-A 15358110-C-A ***
21995103-C-A 19833217-C-A ***
21995097-TA-T 19833211-TA-T ***
21987837-C-A 19825951-C-A ***
16310403-C-G 14198523-C-G ***
21979525-C-A 19817639-C-A ***
21773690-TGAGCAAATAATAATAATAATAAAATTG-T 19611804-TGAGCAAATAATAATAATAATAAAATTG-T ***
26594842-C-A 24448695-C-A P1_g2 ***
14659444-CAAA-C 12547509-CAAA-C 13×A***
17464108-TTTCTAAGATACC-T 15352228-TTTCTAAGATACC-T ***
17888619-CCAG-C 15776739-CCAG-C ***
17874590-GTCTGAGGGTGGCAGAGTAAACATTA-G 15762710-GTCTGAGGGTGGCAGAGTAAACATTA-G ***
17743254-GA-G 15631374-GA-G ***
17689033-TCTC-T 15577153-TCTC-T ***
17585095-G-T 15473215-G-T ***
17509127-G-T 15397247-G-T ******
17446661-G-T 15334781-G-T ******
18033991-C-A 15922111-C-A ***
17255418-C-A 15143538-C-A ***
17239326-T-A 15127446-T-A 6741578-C-GZS7458 ******
17191203-C-A 15079323-C-A ***
17144483-TATCATTTG-T 15032603-TATCATTTG-T ***
17140117-CA-C 15028237-CA-C ***
17119295-C-T 15007415-C-T ***
17089268-GTA-G 14977388-GTA-G ***
17996296-AACAGAAATCAGCCCACCTTTCCATCAAGAGGAACCAGATGTTGGAAAT-A 15884416-AACAGAAATCAGCCCACCTTTCCATCAAGAGGAACCAGATGTTGGAAAT-A P7_Gap ***
18064849-G-T 15952969-G-T ******
16958167-A-T 14846287-A-T ***
18679353-CTAAA-C 16567473-CTAAA-C ***
18999149-C-A 16887269-C-A ***
18986593-C-T 16874713-C-T ***
18931358-C-A 16819478-C-A ***
18824133-G-A 16712253-G-A ***
18779647-GCTGGAATACA-G 16667767-GCTGGAATACA-G ***
18697100-ACC-A 16585220-ACC-A ***
18695422-C-T 16583542-C-T ***
18661935-G-A 16550055-G-A ***
18066632-G-T 15954752-G-T ***
18559563-G-T 16447683-G-T ***
18538032-G-T 16426152-G-T ***
18405795-C-A 16293915-C-A P6_Gap ***
18336305-TTATTA-T 16224425-TTATTA-T P6_Prx ***
18115221-C-A 16003341-C-A ******
18107157-AGAATAAATAAATGCAGTGAGATGAGTG-A 15995277-AGAATAAATAAATGCAGTGAGATGAGTG-A ******
18075056-A-C 15963176-A-C ***
16965262-TATTAACAGC-T 14853382-TATTAACAGC-T ***
16956025-CT-C 14844145-CT-C ***
19053869-G-T 16941989-G-T ***
15817674-TATGTTTTACCTGGATATGTAAAATAC-T 13705794-TATGTTTTACCTGGATATGTAAAATAC-T ***
15992954-G-T 13881074-G-T ***
15965875-T-G 13853995-T-G ***
15922115-G-T 13810235-G-T ***
15916048-G-A 13804168-G-A ***
15881429-C-A 13769549-C-A ***
15859649-C-A 13747769-C-A FGC45603 ***
15736210-GAAATCATAAGACTGATAAAACAT-G 13624330-GAAATCATAAGACTGATAAAACAT-G ***
16047512-G-T 13935632-G-T ***
15575386-TCCA-T 13463506-TCCA-T ***
15544362-C-A 13432482-C-A ***
15438007-CAATCTGGCTT-C 13326127-CAATCTGGCTT-C ***
15420567-G-A 13308687-G-A ***
15332681-C-A 13220799-C-A ***
15319530-AACTTAGAACTCACACAGT-A 13207636-AACTTAGAACTCACACAGT-A ***
15239268-G-T 13127354-G-T ******
15997971-AGTCTTCTTCATTTATATCAAGTT-A 13886091-AGTCTTCTTCATTTATATCAAGTT-A ***
16133815-C-A 14021935-C-A ***
16919491-ATATTGCTTGGATGATTATGGCT-A 14807611-ATATTGCTTGGATGATTATGGCT-A ***
16567178-C-T 14455298-C-T ***
16877317-CA-C 14765437-CA-C ***
16796258-G-T 14684378-G-T ***
16763752-A-AAC 14651872-A-AAC ***
16715604-CAGATGAACACA-C 14603724-CAGATGAACACA-C ***
16714397-C-A 14602517-C-A ***
16641271-G-T 14529391-G-T ******
16595242-T-TA 14483362-T-TA ***
16487023-T-G 14375143-T-G ***
16222797-AGTTTGACAAT-A 14110917-AGTTTGACAAT-A ******
16437639-AAAAAAGAAACTC-A 14325759-AAAAAAGAAACTC-A ***
16434967-GCAGTAT-G 14323087-GCAGTAT-G ***
16390261-C-A 14278381-C-A ***
16329177-G-T 14217297-G-T ***
16301493-CACTTGGGGAGG-C 14189613-CACTTGGGGAGG-C ***
16293802-A-G 14181922-A-G ***
16254311-CAGAT-C 14142431-CAGAT-C ***
18999833-TTAAGG-T 16887953-TTAAGG-T ***
19131882-AAC-A 17020002-AAC-A ***
15134927-GT-G 13023014-GT-G ***
22206176-CAGAGTAAGA-C 20044290-CAGAGTAAGA-C ***
22235745-C-G 20073859-C-G A19299 FGC69774 DYZ19 ***
22232924-G-A 20071038-G-A DYZ19 ***
22232130-C-T 20070244-C-T DYZ19 ***
22232129-G-C 20070243-G-C DYZ19 ***
22220127-T-A 20058241-T-A DYZ19 ***
22217362-T-G 20055476-T-G DYZ19 ***
22094047-G-T 19932161-G-T ***
22243916-A-C 20082030-A-C DYZ19 ***
22061166-G-T 19899280-G-T ***
22007775-C-A 19845889-C-A ***
21994213-G-A 19832327-G-A ******
21963473-CT-C 19801587-CT-C ***
21909313-CTATTTCTGCTA-C 19747427-CTATTTCTGCTA-C ***
21901697-G-T 19739811-G-T ***
21838016-C-T 19676130-C-T ***
22238276-G-A 20076390-G-A DYZ19 ***
22248023-G-C 20086137-G-C DYZ19 ***
21780866-TTATGCTCTATGCTCATGCTGTTA-T 19618980-TTATGCTCTATGCTCATGCTGTTA-T ***
22363824-G-C 20201938-G-C DYZ19 ***
22463734-G-T 20301848-G-T DYZ19 ***
22455369-A-T 20293483-A-T DYZ19 ***
22455287-G-A 20293401-G-A DYZ19 ***
22455257-T-A 20293371-T-A DYZ19 ***
22446605-A-C 20284719-A-C DYZ19 ***
22444940-G-T 20283054-G-T DYZ19 ***
22443088-C-T 20281202-C-T DYZ19 ***
22363810-G-C 20201924-G-C DYZ19 ***
22249273-T-C 20087387-T-C DYZ19 ***
22363390-C-T 20201504-C-T DYZ19 ***
22362856-A-T 20200970-A-T DYZ19 ***
22357649-G-T 20195763-G-T DYZ19 ***
22345751-G-T 20183865-G-T DYZ19 ***
22315611-A-C 20153725-A-C DYZ19 ***
22272717-TCCAGA-T 20110831-TCCAGA-T DYZ19 ***
22272473-C-T 20110587-C-T DYZ19 ***
21827528-C-G 19665642-C-G ***
21692363-C-A 19530477-C-A ******
19136846-AT-A 17024966-AT-A ***
19531092-A-G 17419212-A-G ***
21034092-C-T 18872206-C-T ***
20860854-C-T 18698968-C-T P4_Dst ***
20784630-AAGGATTAATC-A 18622744-AAGGATTAATC-A P4_Prx ***
20736156-G-T 18574270-G-T P4_Prx ***
19909805-C-T 17797925-C-T P5_Prx ***
19679424-TC-T 17567544-TC-T P5_Prx ***
19539357-C-A 17427477-C-A ***
19378397-CA-C 17266517-CA-C ***
21070270-T-A 18908384-T-A ***
19359274-CACACATG-C 17247394-CACACATG-C ***
19358841-T-C 17246961-T-C ***
19344075-TTGG-T 17232195-TTGG-T ***
19318940-C-A 17207060-C-A ***
19274228-TGTAAA-T 17162348-TGTAAA-T ******
19195307-G-T 17083427-G-T ******
19158800-CAGGA-C 17046920-CAGGA-C ***
21066817-G-A 18904931-G-A ***
21176684-C-T 19014798-C-T ***
21664523-C-A 19502637-C-A ***
21460487-C-A 19298601-C-A ***
21648649-GATAGAA-G 19486763-GATAGAA-G ******
21647299-GAGACCCTGTCTC-G 19485413-GAGACCCTGTCTC-G ***
21645355-C-A 19483469-C-A ***
21514871-C-T 19352985-C-T Y18522 ***
21487785-TTACATTCTATTTTGTCAGA-T 19325899-TTACATTCTATTTTGTCAGA-T ***
21478531-C-A 19316645-C-A ***
21467079-G-T 19305193-G-T ***
21434099-CAAGAGAGCATAT-C 19272213-CAAGAGAGCATAT-C ***
21215507-AC-A 19053621-AC-A ***
21416045-C-T 19254159-C-T ***
21390467-GCTGCTTCTGCAAACATAGCAGAAGAGTCAGAGA-G 19228581-GCTGCTTCTGCAAACATAGCAGAAGAGTCAGAGA-G ***
21382365-G-A 19220479-G-A ***
21354607-CAATACAGATATACATT-C 19192721-CAATACAGATATACATT-C ***
21340688-CCTT-C 19178802-CCTT-C ***
21313130-CA-C 19151244-CA-C ***
21266426-G-T 19104540-G-T ***
15203803-A-G 13091889-A-G ***
15129452-AGCT-A 13017539-AGCT-A ******
22480423-G-A 20318537-G-A DYZ19 ***
6836184-TTAATCA-T 6968143-TTAATCA-T ***
7207917-G-T 7339876-G-T ***
7152257-AAAG-A 7284216-AAAG-A ***
7129238-AT-A 7261197-AT-A ***
7064492-AAG-A 7196451-AAG-A ***
6898213-G-T 7030172-G-T ***
6851079-TGCCA-T 6983038-TGCCA-T ***
6756895-T-A 6888854-T-A ***
7427375-A-C 7559334-A-C ***
6702656-G-T 6834615-G-T ***
6653744-TAAATGTTATTA-T 6785703-TAAATGTTATTA-T ***
6125684-G-A 6257643-G-A ***
5851577-AT-A 5983536-AT-A ***
5800076-C-A 5932035-C-A ***
4899417-CAATTACCCCTCAAAGTTGA-C 5031376-CAATTACCCCTCAAAGTTGA-C ***
4352119-AATAT-A 4484078-AATAT-A ***
7334576-AT-A 7466535-AT-A ***
7569075-C-A 7701034-C-A ***
3621887-G-T 3753846-G-T ***
8032921-G-A 8164880-G-A ******
8346883-ATTATTAATTT-A 8478842-ATTATTAATTT-A ***
8342308-C-A 8474267-C-A ***
8280600-TCCTTGTAA-T 8412559-TCCTTGTAA-T ***
8243408-G-T 8375367-G-T ***
8237921-AATTACT-A 8369880-AATTACT-A ***
8127825-C-A 8259784-C-A ***
8123305-CT-C 8255264-CT-C ***
7883148-CA-C 8015107-CA-C ***
7590049-GGCCCTTCTGA-G 7722008-GGCCCTTCTGA-G ***
7818047-CTTCT-C 7950006-CTTCT-C ***
7789374-G-T 7921333-G-T ***
7783283-G-T 7915242-G-T ***
7739939-ATGCACTGTAAG-A 7871898-ATGCACTGTAAG-A ***
7696059-G-T 7828018-G-T ***
7658823-C-A 7790782-C-A ***
7592189-C-A 7724148-C-A ***
4262082-GA-G 4394041-GA-G ***
2850721-G-T 2982680-G-T ***
8461261-GGCTCTACCTGTACCATTTTCCA-G 8593220-GGCTCTACCTGTACCATTTTCCA-G ***
14780417-A-G 12668487-A-G Z1956 M2034 CTS3266 ***
7661156-G-T 7793115-G-T Y19837 ***
28160822-CTT-C 26014675-CTT-C P1_b4 22×T***
22486512-A-C 20324626-A-C DYZ19 ***
22463753-G-T 20301867-G-T DYZ19 ***
21700267-G-A 19538381-G-A M5544 PF1821 ******
20835461-C-G 18673575-C-G Z4928 BY26415 P4_Gap ***
9383960-T-C 9546351-T-C F1529 ***
14039742-C-A 11919036-C-A ***
21230509-TAA-T 19068623-TAA-T 14×A***
7552880-AT-A 7684839-AT-A 10×T***
13711678-G-T 11556002-G-T ***
13688027-G-T 11532351-G-T ***
10004730-T-C 10167121-T-C ***
13349739-A-C 11194063-A-C ***
13457122-T-C 11301446-T-C ***
13676196-T-A 11520520-T-A ***
14430916-CCA-C 12310189-CCA-C ***
2835506-GT-G 2967465-GT-G ***
22474930-T-G 20313044-T-G FGC12059Z3484 DYZ19 ***
2833656-GGAAAGAAAA-G 2965615-GGAAAGAAAA-G ***
2714886-CCCTGTGAATTTTTAAGT-C 2846845-CCCTGTGAATTTTTAAGT-C ***
22424742-T-A 20262856-T-A DYZ19 ***
13676515-T-A 11520839-T-A ***
17919692-A-AG 15807812-A-AG FGC22503 8×G***
22455323-G-C 20293437-G-C DYZ19 ***
15899855-G-A 13787975-G-A ***
7534812-CAA-C 7666771-CAA-C 13×A***
14789655-C-T 12677726-C-T ***
22454757-A-T 20292871-A-T DYZ19 ***
14469656-GT-G 12348925-GT-G 10×T***
22463728-T-C 20301842-T-C BY23022 DYZ19 ***
22422569-G-T 20260683-G-T DYZ19 ***
22232098-T-C 20070212-T-C DYZ19 ***
22425940-C-G 20264054-C-G DYZ19 ***
15982125-C-A 13870245-C-A ***
8389922-G-A 8521881-G-A ***
8483207-GC-G 8615166-GC-G ***
15073667-ACCT-A 12961757-ACCT-A ***
13863925-C-A 11743219-C-A ***
14148542-G-T 12027836-G-T ***
14117692-G-T 11996986-G-T ***
14094952-AATGGTTT-A 11974246-AATGGTTT-A ***
14063207-G-GATAA 11942501-G-GATAA ***
14061979-T-A 11941273-T-A ***
14031267-C-T 11910561-C-T ***
13859833-T-A 11739127-T-A ***
14348923-TTCCTTGG-T 12228218-TTCCTTGG-T ******
13839634-TGGAATGGAATGGATTCGACG-T 11718928-TGGAATGGAATGGATTCGACG-T ***
13834567-C-G 11713861-C-G ***
13834566-A-C 11713860-A-C ***
13818259-ACTT-A 11697553-ACTT-A ***
13731516-G-T 11575840-G-T ***
13722944-C-G 11567268-C-G ***
13714020-T-C 11558344-T-C ***
14346084-C-A 12225379-C-A ***
14379581-A-G 12258877-A-G ***
13695972-G-T 11540296-G-T ***
14703199-A-C 12591265-A-C ***
15072011-CCTCCCCCACATAATATATTCCACCTGCA-C 12960102-CCTCCCCCACATAATATATTCCACCTGCA-C ***
14995008-A-G 12883093-A-G ***
14955990-G-T 12844065-G-T ***
14886450-ACAT-A 12774516-ACAT-A ***
14869794-C-A 12757864-C-A ***
14820098-CTTG-C 12708165-CTTG-C ***
14708707-C-A 12596773-C-A ******
14596789-C-A 12484989-C-A ***
14415572-AAAAATAT-A,AAATATAT 12294869-AAATATAT-A ***
14583927-CTCTTCCTGATGAAGGTGGGTGCCAGAGAGTATGATATTCCCA-C 12472127-CTCTTCCTGATGAAGGTGGGTGCCAGAGAGTATGATATTCCCA-C ***
14572170-G-T 12460370-G-T ***
14548999-G-T 12437200-G-T ******
14494124-C-A 12382321-C-A ***
14485113-GCCTCAGGAGGAACCAGCCC-G 12364382-GCCTCAGGAGGAACCAGCCC-G ***
14482668-C-T 12361937-C-T ***
14454147-CTGAGGGTATTAAAATGCTCCTT-C 12333420-CTGAGGGTATTAAAATGCTCCTT-C ***
13702348-AAATGGAGTCGAATAGAGTGGCATCAAAAGGAATGG-A,AAATGCAGTCGAATAGAGTGGCATCAAAAGG 11546672-AAATGGAGTCGAATAGAGTGGCATCAAAAGGAATGG-A,AAATGCAGTCGAATAGAGTGGCATCAAAAGG ***
13695584-T-C 11539908-T-C ***
8552104-C-A 8684063-C-A ***
9069634-C-A 9232025-C-A ***
9879779-AAAAT-A 10042170-AAAAT-A ***
9788876-G-T 9951267-G-T ***
9759305-GTA-G 9921696-GTA-G ***
9446774-G-T 9609165-G-T ***
9444184-G-T 9606575-G-T ******
9167095-GCTAGC-G 9329486-GCTAGC-G ***
9089588-C-A 9251979-C-A ***
8998774-TA-T 9161165-TA-T ***
9988472-T-A 10150863-T-A ***
8898538-C-T 9030497-C-T ***
8833105-G-A 8965064-G-A ***
8714908-G-T 8846867-G-T ***
8654695-G-T 8786654-G-T ***
8639106-TC-T 8771065-TC-T ***
8592597-CCT-C 8724556-CCT-C ***
8589306-G-T 8721265-G-T ******
9979797-G-A 10142188-G-A ***
9988475-G-T 10150866-G-T ***
13693986-C-G 11538310-C-G ***
13660795-G-GGGTTTATACAAATA 11505119-G-GGGTTTATACAAATA ***
13686628-TTA-T 11530952-TTA-T ***
13681982-T-G 11526306-T-G ***
13680400-TG-T 11524724-TG-T ***
13676524-A-G 11520848-A-G ***
13661465-G-T 11505789-G-T ***
13661460-G-A 11505784-G-A ***
13660805-G-C 11505129-G-C ***
13631649-CCCCCAG-C 11475973-CCCCCAG-C ***
13141501-TATAG-T 10630987-TATAG-T ***
13564701-C-T 11409025-C-T ***
13469131-C-A 11313455-C-A ***
13457149-A-T 11301473-A-T ***
13457113-A-T 11301437-A-T ***
13409391-C-T 11253715-C-T ***
13313311-C-T 11157635-C-T ***
13232197-CCTATGAGGCTGACACTAGCAGGTACT-C 11076521-CCTATGAGGCTGACACTAGCAGGTACT-C ***
22463765-G-T 20301879-G-T DYZ19 ***
22508568-T-A 20346682-T-A DYZ19 ***
14656328-C-A 12544393-C-A ***
8703659-ATT-A,AT 8835618-ATT-A,AT 18×T***
8767506-C-A 8899465-C-A ***
8765332-G-T 8897291-G-T ***
8764995-C-CT 8896954-C-CT 10×T***
8754410-C-A 8886369-C-A ***
8753591-C-A 8885550-C-A ***
8708809-C-A 8840768-C-A ***
8684872-T-A 8816831-T-A ***
8818286-C-A 8950245-C-A ***
8672733-C-A 8804692-C-A ***
8644792-C-A 8776751-C-A ***
8644791-C-A 8776750-C-A ***
8640947-GGTGAA-G 8772906-GGTGAA-G ***
8639583-C-A 8771542-C-A ***
8612659-G-T 8744618-G-T ***
8600264-C-A 8732223-C-A ***
8769911-C-T 8901870-C-T ***
8837366-A-G 8969325-A-G ***
8593809-C-A 8725768-C-A ***
9127647-C-A 9290038-C-A ***
9642576-C-A 9804967-C-A IR3_Prx ***
9521169-G-T 9683560-G-T ***
9497346-C-A 9659737-C-A ***
9462911-G-T 9625302-G-T Y65120 ***
9459911-C-A 9622302-C-A ***
9437427-C-A 9599818-C-A ***
9145487-C-A 9307878-C-A ***
9105672-C-A 9268063-C-A ***
8866419-C-G 8998378-C-G ***
9100107-CTTT-C,CTTTT 9262498-CTTT-C,CTTTT 18×T***
9092490-C-A 9254881-C-A ***
9043462-C-A 9205853-C-A ***
9021916-C-CA 9184307-C-CA 8×A***
8994079-C-A 9156470-C-A ***
9124877-G-A ***
8913208-C-A 9045167-C-A ***
8596111-T-A 8728070-T-A ***
8592388-G-A 8724347-G-A ***
9646834-CAAGT-C 9809225-CAAGT-C IR3_Prx ***
7988099-CTTTT-C,CTT 8120058-CTTTT-C,CTT 14×T***
8124477-C-A 8256436-C-A ***
8055970-C-A 8187929-C-A ***
8048506-C-A 8180465-C-A ***
8029991-C-A 8161950-C-A ***
8025155-CAA-C,CA 8157114-CAA-C,CA 14×A***
8008776-G-T 8140735-G-T ***
7984175-A-T 8116134-A-T ***
8201662-C-T 8333621-C-T BY6770 ***
7949872-A-G 8081831-A-G ***
7934542-C-T 8066501-C-T ***
7929881-C-A 8061840-C-A ***
7908870-C-A 8040829-C-A ***
7903187-C-A 8035146-C-A ***
7894052-C-A 8026011-C-A ***
7863647-G-T 7995606-G-T ***
8152891-T-C 8284850-T-C ***
8210273-C-A 8342232-C-A ***
8587521-A-G 8719480-A-G ***
8434239-T-C 8566198-T-C ***
8526724-C-A 8658683-C-A ***
8519391-C-A 8651350-C-A ***
8517217-C-A 8649176-C-A ***
8482049-C-A 8614008-C-A ***
8478522-T-A 8610481-T-A ***
8473587-C-A 8605546-C-A ***
8441970-C-A 8573929-C-A ***
8432767-C-A 8564726-C-A ***
8239318-C-A 8371277-C-A ***
8419707-C-A 8551666-C-A ***
8403377-G-A 8535336-G-A ***
8353660-C-A 8485619-C-A ***
8313863-A-G 8445822-A-G ***
8292712-C-T 8424671-C-T ***
8286960-G-T 8418919-G-T ***
8255295-C-A 8387254-C-A ***
9986439-T-C 10148830-T-C ***
9690432-C-T 9852823-C-T IR3_Prx ***
7814098-C-A 7946057-C-A ***
14233985-C-A 12113279-C-A ***
14343297-C-A 12222592-C-A ***
14338458-C-A 12217753-C-A ***
14334346-C-A 12213641-C-A ***
14326063-G-A 12205357-G-A Y35492 ***
14288820-C-A 12168114-C-A ***
14280657-C-A 12159951-C-A ***
14229365-A-T 12108659-A-T ***
14403537-GGT-G 12282834-GGT-G ***
14214014-C-A 12093308-C-A ***
14210286-A-G 12089580-A-G ***
14210269-T-A 12089563-T-A ***
14200826-C-A 12080120-C-A ***
14200823-C-A 12080117-C-A ***
14115970-C-A 11995264-C-A ***
14072853-A-T 11952147-A-T ***
14399060-C-T 12278356-C-T YP4717 ***
14403806-G-A 12283103-G-A ***
14061965-T-A 11941259-T-A ***
14583094-TTG-T 12471294-TTG-T ***
14654049-C-A 12542114-C-A ***
14610786-T-TG 12498988-T-TG ***
14610781-A-G 12498983-A-G ***
14610780-C-T 12498982-C-T ***
14604590-CTTTTTTTT-C,CTTTTTT 12492792-CTTTTTTTT-C,CTTTTTT 21×T***
14594216-C-A 12482416-C-A ***
14588310-C-A 12476510-C-A ***
14582056-G-A 12470256-G-A ***
14405652-C-T 12284949-C-T ***
14578861-C-A 12467061-C-A ***
14538183-C-CA 12426384-C-CA 9×A***
14495302-G-T 12383499-G-T ***
14488773-CAAA-C,CAA 12368042-CAAA-C,CAA 16×A***
14487656-G-T 12366925-G-T ***
14464799-C-A 12344072-C-A ***
14444817-C-A 12324090-C-A ***
14069306-C-A 11948600-C-A ***
14044896-C-A 11924190-C-A ***
9752147-G-T 9914538-G-T ***
10003807-C-T 10166198-C-T ***
13417294-C-A 11261618-C-A ***
13355405-A-G 11199729-A-G ***
11014366-C-T ***
10835583-A-C ***
10050450-C-A 10212841-C-A ***
10038525-C-T 10200916-C-T ***
10003811-C-A 10166202-C-A ***
9961896-C-A 10124287-C-A ***
13448341-A-ACTCCATTCCACTCCT 11292665-A-ACTCCATTCCACTCCT ***
9955228-G-T 10117619-G-T ***
9885870-C-A 10048261-C-A ***
9884251-C-A 10046642-C-A ***
9882837-C-A 10045228-C-A ***
9857944-G-A 10020335-G-A ***
9805787-C-A 9968178-C-A ***
9799060-C-T 9961451-C-T ***
13447888-T-TTGCATCCCAG 11292212-T-TTGCATCCCAG ***
13455105-CACCCT-G 11299429-CACCCT-G ***
14006970-C-A 11886264-C-A ***
13681106-C-A 11525430-C-A ***
13991433-C-A 11870727-C-A ***
13973468-CTACTGTG-C 11852762-CTACTGTG-C ***
13865396-A-G 11744690-A-G ***
13839010-C-A 11718304-C-A ***
13838924-TGGAATGGACTCGAATGGAATGG-T 11718218-TGGAATGGACTCGAATGGAATGG-T ***
11643241-ATGCAATGG-A ***
13717805-G-T 11562129-G-T ***
13523665-C-A 11367989-C-A ***
13455114-T-A 11299438-T-A ***
13483962-G-A 11328286-G-A ***
13479035-A-T 11323359-A-T ***
13470642-C-T 11314966-C-T ***
13469897-G-A 11314221-G-A ***
13466878-C-A 11311202-C-A ***
13466836-G-T 11311160-G-T ***
13456727-C-A 11301051-C-A ***
7852057-C-T 7984016-C-T ***
7803630-C-A 7935589-C-A ***
22655942-TCAAGTAAAGAAAA-T 20494056-TCAAGTAAAGAAAA-T ***
28789242-G-T 26643095-G-T ***
28724676-CAAAAGG-C 26578529-CAAAAGG-C ***
26123537-TTCTAAGTTATCCCTTAGGTCTTTTAAAATAA-T 23977390-TTCTAAGTTATCCCTTAGGTCTTTTAAAATAA-T P1_Y1 ***
15272482-ATT-A 13160571-ATT-A ***
14828403-ATTTTTTCATTTTCATTTGCCTCACATATTATATAG-A 12716470-ATTTTTTCATTTTCATTTGCCTCACATATTATATAG-A ******
8780390-ATCCTGTGTTTGCAAGATAAT-A 8912349-ATCCTGTGTTTGCAAGATAAT-A ***
28818100-T-A 26671953-T-A ***
28742840-TA-T 26596693-TA-T ***
13451746-C-CTGCAA,T 11296070-C-CTGCAA,T ***
28609800-T-A 26463653-T-A ***
28586290-C-A 26440143-C-A ***
28428933-A-G 26282786-A-G P1_gr2 ***
28099439-CTTAACA-C 25953292-CTTAACA-C P1_Y2 ***
22282882-G-T 20120996-G-T DYZ19 ***
26230787-TAACA-T 24084640-TAACA-T P1_Y1 ***
26167193-TG-T 24021046-TG-T P1_Y1 ***
3712567-AAAC-A,AAAT 3844526-AAAC-A,AAAT ******
13866550-G-T 11745844-G-T FGC7947 ***
25164074-CAT-C 23017927-CAT-C g1 ***
13711144-G-T 11555468-G-T ***
2736636-C-A 2868595-C-A ***
2732236-C-A 2864195-C-A ***
2706137-G-A 2838096-G-A ***
13844051-A-C 11723345-A-C ***
16237221-ATTT-A,ATT 14125341-ATTT-A,ATT 16×T***
22510947-A-T 20349061-A-T DYZ19 ***
15562703-GA-G,GAA 13450823-GA-G,GAA 17×A***
19268205-C-A 17156325-C-A ***
8477577-A-AT 8609536-A-AT 10×T***
21651801-C-A 19489915-C-A ***
21142834-CAAAA-C 18980948-CAAAA-C 16×A***
8715306-GAAAA-G 8847265-GAAAA-G 14×A***
18241751-C-A 16129871-C-A ***
2827909-CTT-C,CT 2959868-CTT-C,CT 17×T***
8528900-CAAA-C 8660859-CAAA-C 15×A***
14124822-C-A 12004116-C-A Y23360 ***
25928518-CATTTGCTGCA-C 23782371-CATTTGCTGCA-C P1_Y1 ***
25035675-CACATTAGCTGA-C 22889528-CACATTAGCTGA-C g1 ***
2766892-C-A 2898851-C-A ***
22842630-T-C 20680744-T-C ***
23064902-A-G 20903016-A-G ***
23023873-C-A 20861987-C-A ***
23022475-CTGTA-C 20860589-CTGTA-C ***
22938168-CCACCCA-C 20776282-CCACCCA-C ***
22897583-C-A 20735697-C-A ******
22860501-G-T 20698615-G-T ***
22824135-CTGTG-C 20662249-CTGTG-C ***
23164758-CTGTATGCAGTATTCAG-C 21002872-CTGTATGCAGTATTCAG-C ***
22823713-G-T 20661827-G-T ***
22805887-G-A 20644001-G-A ******
22730991-ATC-A 20569105-ATC-A ***
22705581-CCCTGA-C 20543695-CCCTGA-C ***
22701464-TTTCTAGAAACAATAGGAAC-T 20539578-TTTCTAGAAACAATAGGAAC-T ***
22676247-AT-A 20514361-AT-A ***
22663834-T-A 20501948-T-A ***
23067639-CTG-C 20905753-CTG-C ***
23191332-G-T 21029446-G-T ***
25025525-TC-T 22879378-TC-T g1 ***
23581443-GAAAGTGTGTAC-G 21419557-GAAAGTGTGTAC-G ***
24874210-AAAAATAAAAT-A 22728063-AAAAATAAAAT-A g1 ***
24496709-C-T 22350562-C-T ***
24480307-TAACCTC-T 22334160-TAACCTC-T ***
24469931-C-A 22323784-C-A ***
24305595-GCTGTTCACACTCT-G 22159448-GCTGTTCACACTCT-G P3_t1 ***
23783420-TATTAGTGAGG-T 21621534-TATTAGTGAGG-T ***
23648542-C-A 21486656-C-A ***
23502413-C-T 21340527-C-T ***
23282344-AAGCCATAACAGATATATT-A 21120458-AAGCCATAACAGATATATT-A ***
23443313-TCCCA-T 21281427-TCCCA-T ***
23423871-G-T 21261985-G-T ***
23415524-G-T 21253638-G-T ***
23367497-AACTCTCATATACTGCTGATGGG-A 21205611-AACTCTCATATACTGCTGATGGG-A ***
23350111-C-T 21188225-C-T ***
23347033-A-G 21185147-A-G ***
23314600-TTCAAGC-T 21152714-TTCAAGC-T ***
2766590-C-A 2898549-C-A ***
2822446-C-A 2954405-C-A ***
7792946-G-T 7924905-G-T ***
7159544-C-A 7291503-C-A ***
7236020-T-C 7367979-T-C ***
7219238-C-A 7351197-C-A ***
7205164-C-A 7337123-C-A ***
7198127-C-A 7330086-C-A ***
7187584-CTTTT-C,CTTT 7319543-CTTTT-C,CTTT 15×T***
7186960-T-C 7318919-T-C ***
7139320-C-A 7271279-C-A YFS3117414 A18720 ***
7251718-C-A 7383677-C-A ***
7131007-C-A 7262966-C-A ***
7126423-TCCCAAAGTGCTGGGATTACAGACATGAGCCACCGCA-T 7258382-TCCCAAAGTGCTGGGATTACAGACATGAGCCACCGCA-T ***
7112094-G-T 7244053-G-T ***
7105496-C-T 7237455-C-T ***
7081127-A-G 7213086-A-G ***
7069937-C-A 7201896-C-A ***
7055429-C-A 7187388-C-A ***
7244112-C-A 7376071-C-A ***
7290069-C-A 7422028-C-A ***
7035384-C-A 7167343-C-A ***
7595235-C-A 7727194-C-A ***
7770479-G-T 7902438-G-T ***
7686954-C-A 7818913-C-A ***
7684440-C-A 7816399-C-A ***
7637475-C-A 7769434-C-A ***
7622610-C-A 7754569-C-A ***
7622178-C-A 7754137-C-A ***
7600098-C-A 7732057-C-A ***
7583420-G-T 7715379-G-T ***
7324287-T-C 7456246-T-C ***
7557643-C-A 7689602-C-A ***
7548851-C-A 7680810-C-A ***
7418073-CAAAA-C,CAAAAA 7550032-CAAAA-C,CAAAAA 22×A***
7406542-C-A 7538501-C-A ***
7397874-C-A 7529833-C-A ***
7350195-C-A 7482154-C-A ***
7339261-C-A 7471220-C-A ***
7047872-C-A 7179831-C-A ***
6991178-C-T 7123137-C-T ***
2882433-C-A 3014392-C-A ***
4889246-T-C 5021205-T-C ***
6660286-C-A 6792245-C-A ***
6653735-AGATTTATATAAATGTTATTAAGGTC-A 6785694-AGATTTATATAAATGTTATTAAGGTC-A ***
6402024-C-T 6533983-C-T ***
6390312-C-A 6522271-C-A ***
6149871-TACACAC-T 6281830-TACACAC-T IR3_Dst 17×AC***
5412294-T-C 5544253-T-C ***
5199838-A-G 5331797-A-G ***
4442604-C-A 4574563-C-A ***
6681934-C-A 6813893-C-A ***
3122731-A-G 3254690-A-G ***
2980997-C-A 3112956-C-A ***
2974903-A-T 3106862-A-T ***
2948576-T-C 3080535-T-C ***
2910190-G-T 3042149-G-T ***
2908207-C-A 3040166-C-A ***
2894083-G-A 3026042-G-A ***
6667636-G-A 6799595-G-A ***
6693905-C-T 6825864-C-T ***
6970875-C-A 7102834-C-A ***
6892899-C-A 7024858-C-A ***
6970614-C-A 7102573-C-A ***
6947603-C-A 7079562-C-A ***
6938586-A-T 7070545-A-T ***
6937820-C-A 7069779-C-A ***
6937812-C-A 7069771-C-A ***
6915492-C-A 7047451-C-A ***
6893454-G-T 7025413-G-T ***
6888339-G-T 7020298-G-T ***
6696686-C-A 6828645-C-A ***
6828215-C-T 6960174-C-T ***
6815058-C-A 6947017-C-A ***
6787149-C-A 6919108-C-A ***
6777220-T-C 6909179-T-C ***
6745598-C-A 6877557-C-A ***
6714999-G-A 6846958-G-A ***
6699582-C-A 6831541-C-A ***
17495823-C-A 15383943-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page