Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > Y22986

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B59838
BigY2
B59838
16257326-T-A 14145446-T-A FGC51727 YY++
16730900-G-A 14619020-G-A FGC51729 YY++
17290585-G-A 15178705-G-A FGC51733 YY++
17667708-G-GCTGTC 15555828-G-GCTGTC ++
8257396-A-G 8389355-A-G FGC51717 YY++
17667714-G-GGCTTACCC 15555834-G-GGCTTACCC ++
17960862-G-A 15848982-G-A FGC51738 YY++
16773967-G-T 14662087-G-T FGC51730 YY++
12068-T-C +
22302964-G-T 20141078-G-T DYZ19 ****
13255236-A-G 11099560-A-G **
11666456-T-A **
10991383-A-G **
11019822-A-T **
13194772-C-A 11039096-C-A **
13209412-C-A 11053736-C-A **
13944770-G-A 11824064-G-A **
13937431-AT-A 11816725-AT-A **
13935582-C-A 11814876-C-A **
13922536-C-A 11801830-C-A **
13899301-T-A 11778595-T-A **
13895209-A-G 11774503-A-G **
13866870-G-T 11746164-G-T **
11653717-G-T **
13290424-A-G 11134748-A-G **
11649657-G-GGAATGGAATGGAATGGAATC **
11648276-A-T **
11642911-A-G **
13226176-C-A 11070500-C-A **
13572783-C-A 11417107-C-A **
13571094-A-G 11415418-A-G **
13526464-C-A 11370788-C-A **
13509795-C-A 11354119-C-A **
13491070-C-A 11335394-C-A **
13489342-G-A 11333666-G-A **
13486850-G-T 11331174-G-T **
13482964-CAG-C 11327288-CAG-C **
13465111-C-A 11309435-C-A **
13612483-A-G 11456807-A-G **
30628-C-A **
10906273-C-A **
15122289-C-G 13010376-C-G **
14880355-C-A 12768425-C-A **
14953548-C-A 12841622-C-A **
15034694-C-A 12922782-C-A **
15034926-C-A 12923014-C-A **
15060849-G-A 12948941-G-A **
15122180-A-G 13010267-A-G **
15126894-C-A 13014981-C-A **
14660320-G-T 12548385-G-T **
15193702-C-A 13081788-C-A **
15210741-C-A 13098827-C-A **
15394410-C-A 13282530-C-A **
15401371-C-A 13289491-C-A **
15424762-C-T 13312882-C-T **
15664075-C-A 13552195-C-A **
14754102-T-C 12642171-T-C **
14569985-A-G 12458185-A-G **
13960899-C-A 11840193-C-A **
14188116-C-A 12067410-C-A **
13982869-C-A 11862163-C-A **
14100396-C-A 11979690-C-A **
14102594-C-A 11981888-C-A **
14142433-T-G 12021727-T-G **
14143973-T-C 12023267-T-C **
14146768-C-A 12026062-C-A **
14229783-C-A 12109077-C-A **
14544295-G-T 12432496-G-T **
14283322-C-A 12162616-C-A **
14313540-C-T 12192834-C-T **
14356213-G-A 12235508-G-A **
14390045-T-C 12269341-T-C **
14396641-C-A 12275937-C-A **
14428749-T-C 12308024-T-C **
14509468-C-A 12397673-C-A **
10973583-A-T **
10820758-C-A **
10883586-T-A **
7093158-C-G 7225117-C-G **
8043959-C-A 8175918-C-A **
7969857-G-T 8101816-G-T **
7862073-T-C 7994032-T-C **
7664172-A-T 7796131-A-T **
7489216-G-A 7621175-G-A IR1_L **
7461123-T-A 7593082-T-A IR1_L **
7387770-C-G 7519729-C-G **
7346627-C-A 7478586-C-A **
7340401-G-T 7472360-G-T **
7221776-T-A 7353735-T-A **
7218376-G-T 7350335-G-T **
7140400-G-T 7272359-G-T **
7115354-C-T 7247313-C-T **
7078376-A-C 7210335-A-C **
8149179-C-A 8281138-C-A **
6981139-CA-C 7113098-CA-C **
6981139-C-T 7113098-C-T **
6981130-C-T 7113089-C-T **
6981122-C-T 7113081-C-T **
6981120-C-A 7113079-C-A Y83086 **
6981109-C-T 7113068-C-T **
6981105-T-C 7113064-T-C **
6981104-A-G 7113063-A-G **
6981093-C-CGA 7113052-C-CGA **
6918531-G-C 7050490-G-C **
6858620-GA-G 6990579-GA-G **
6854424-C-A 6986383-C-A **
6825400-G-C 6957359-G-C **
6772121-C-A 6904080-C-A **
8056111-T-C 8188070-T-C **
8181430-C-CAG 8313389-C-CAG **
10883514-C-A **
10760359-C-CTT **
10878229-C-A **
10844290-C-A **
10826688-C-T **
15739411-AGCTAAAC-A 13627531-AGCTAAAC-A **
10818779-T-A **
10818714-T-C **
10817724-C-A **
10800430-C-A **
10795209-C-A **
10787154-A-G **
10767733-CT-C **
10760406-A-C **
10760383-T-C **
10760382-C-G **
10760356-A-AATC **
8353739-G-A 8485698-G-A FGC51718 **
10760354-C-G **
10692079-C-T **
10692074-T-C **
10684490-G-T **
10667002-TCC-T **
10032226-C-A 10194617-C-A **
9928100-T-C 10090491-T-C **
9928098-A-C 10090489-A-C **
9823512-C-T 9985903-C-T **
9499050-C-A 9661441-C-A **
9461385-C-A 9623776-C-A **
9074055-T-A 9236446-T-A **
8852152-C-A 8984111-C-A **
8669920-T-G 8801879-T-G **
15725933-G-C 13614053-G-C **
16015110-C-G 13903230-C-G **
15769297-A-G 13657417-A-G **
21553436-G-C 19391550-G-C **
22642109-A-G 20480223-A-G **
22489444-C-A 20327558-C-A DYZ19 **
22441942-C-A 20280056-C-A DYZ19 **
22205561-C-A 20043675-C-A **
22176822-C-T 20014936-C-T **
22170349-G-T 20008463-G-T **
22134120-A-G 19972234-A-G **
22080703-C-A 19918817-C-A **
22079539-C-A 19917653-C-A **
22048496-A-G 19886610-A-G **
21924004-T-A 19762118-T-A **
21629970-C-A 19468084-C-A **
21553437-TTGCA-T 19391551-TTGCA-T **
21553431-T-G 19391545-T-G **
22765786-A-G 20603900-A-G **
21527089-C-T 19365203-C-T **
21302563-C-A 19140677-C-A **
21234856-C-A 19072970-C-A **
21128979-C-A 18967093-C-A **
20803021-C-A 18641135-C-A P4_Gap **
20736828-G-C 18574942-G-C P4_Prx **
20736806-T-C 18574920-T-C P4_Prx **
20587870-T-C 18425984-T-C P5_Dst **
20352674-T-TA 18190788-T-TA P5_Dst **
19811687-G-C 17699807-G-C P5_Prx **
19675478-C-A 17563598-C-A P5_Prx **
19642964-G-T 17531084-G-T P5_Prx **
19642959-G-T 17531079-G-T P5_Prx **
19610457-C-A 17498577-C-A P5_Prx **
22760816-T-C 20598930-T-C **
22810679-G-T 20648793-G-T **
19463594-G-T 17351714-G-T **
26098631-T-C 23952484-T-C P1_Y1 **
56850737-G-T **
28812369-C-A 26666222-C-A **
28746426-C-A 26600279-C-A **
28700372-C-A 26554225-C-A **
28699923-C-A 26553776-C-A **
28643726-C-A 26497579-C-A **
28619597-G-A 26473450-G-A **
28617645-A-G 26471498-A-G **
28581111-C-A 26434964-C-A **
28506867-C-A 26360720-C-A **
28468705-T-C 26322558-T-C **
28006786-G-T 25860639-G-T P1_Y2 **
27990647-A-G 25844500-A-G P1_Y2 **
26834980-C-A 24688833-C-A P1_g2 **
25937197-T-TA 23791050-T-TA P1_Y1 **
22868614-C-A 20706728-C-A **
24424235-C-A 22278088-C-A **
24381361-C-T 22235214-C-T **
24363885-C-A 22217738-C-A **
24013914-G-T 21867767-G-T **
23991869-A-G 21845722-A-G **
23773503-A-G 21611617-A-G **
23564658-C-A 21402772-C-A **
23491109-C-A 21329223-C-A **
23420679-T-C 21258793-T-C **
23319215-C-CT 21157329-C-CT **
23199649-A-G 21037763-A-G **
23061724-C-A 20899838-C-A **
22979387-C-A 20817501-C-A **
22938945-C-A 20777059-C-A **
19559800-A-G 17447920-A-G **
19450036-C-A 17338156-C-A **
15835146-A-T 13723266-A-T **
16344957-GTTC-G 14233077-GTTC-G **
17210984-T-C 15099104-T-C **
17085692-G-T 14973812-G-T **
16968391-A-G 14856511-A-G **
16932178-CT-C 14820298-CT-C **
16931211-T-A 14819331-T-A **
16896640-TGAAGAAAATATGG-T 14784760-TGAAGAAAATATGG-T **
16842100-C-G 14730220-C-G **
16692757-GAAAAAAAA-G 14580877-GAAAAAAAA-G 27×A**
16601631-ATATATATATATAT-A 14489751-ATATATATATATAT-A **
16588100-C-T 14476220-C-T **
16442454-C-A 14330574-C-A **
16437994-C-A 14326114-C-A **
16425008-G-A 14313128-G-A **
16355251-G-T 14243371-G-T **
16211155-T-C 14099275-T-C **
17210999-A-G 15099119-A-G **
16211129-G-T 14099249-G-T **
16146490-A-AGCAC 14034610-A-AGCAC P8_Dst **
16115196-TTTA-T 14003316-TTTA-T P8_Prx **
16095424-A-G 13983544-A-G **
16091282-GATCC-G 13979402-GATCC-G **
16063814-C-T 13951934-C-T **
16062941-A-T 13951061-A-T **
16028983-C-T 13917103-C-T **
16027695-A-G 13915815-A-G **
16022453-C-A 13910573-C-A **
6626952-C-A 6758911-C-A **
16002350-G-A 13890470-G-A **
15988076-G-T 13876196-G-T **
15946793-A-G 13834913-A-G **
17210994-T-G 15099114-T-G **
17425170-C-A 15313290-C-A **
19433274-C-T 17321394-C-T **
18256202-A-G 16144322-A-G **
19373932-C-T 17262052-C-T FGC42688 **
19296725-G-C 17184845-G-C **
19283707-G-T 17171827-G-T **
19126403-C-A 17014523-C-A **
19122127-C-G 17010247-C-G **
19065171-T-C 16953291-T-C **
19053129-C-T 16941249-C-T **
19000017-C-A 16888137-C-A **
18976700-T-A 16864820-T-A **
18847239-C-A 16735359-C-A **
18739539-TA-T 16627659-TA-T **
18636583-C-G 16524703-C-G **
18395840-A-G 16283960-A-G P6_Gap **
18384240-C-A 16272360-C-A P6_Gap **
18185246-C-A 16073366-C-A FGC65029 **
17534575-C-A 15422695-C-A **
18159852-G-C 16047972-G-C **
18159709-A-G 16047829-A-G **
18150690-T-A 16038810-T-A **
18102121-A-G 15990241-A-G **
17952700-A-T 15840820-A-T **
17928685-C-A 15816805-C-A **
17889899-T-A 15778019-T-A **
17884479-G-T 15772599-G-T **
17883729-A-G 15771849-A-G **
17840835-G-A 15728955-G-A FGC51736 **
17730493-A-G 15618613-A-G **
17718417-T-TG 15606537-T-TG **
17602390-C-A 15490510-C-A **
17537927-A-G 15426047-A-G **
6765592-G-A 6897551-G-A **
7115450-T-G 7247409-T-G **
6626920-C-A 6758879-C-A **
13963322-C-A 11842616-C-A **
15503486-C-A 13391606-C-A **
10673827-C-T **
3033115-T-C 3165074-T-C **
6622272-G-T 6754231-G-T **
9013244-C-A 9175635-C-A **
11013556-G-T **
56847258-G-A **
56847220-C-G **
56847210-T-A **
10012750-C-A 10175141-C-A **
14062008-TACAAA-T 11941302-TACAAA-T **
7330269-C-A 7462228-C-A **
15776772-C-A 13664892-C-A **
23961140-C-A 21814993-C-A **
5873702-C-A 6005661-C-A **
14029452-C-A 11908746-C-A **
7409716-C-A 7541675-C-A **
16667903-C-A 14556023-C-A **
13385798-C-A 11230122-C-A **
10673222-C-T **
10673210-C-T **
10673206-C-CA **
10673202-TC-T **
10673197-T-G **
10673195-T-G **
16116372-CAAAA-C 14004492-CAAAA-C P8_Prx 22×A**
7217368-C-A 7349327-C-A **
14339089-G-T 12218384-G-T **
14445001-C-A 12324274-C-A **
18262526-C-A 16150646-C-A **
15420132-C-A 13308252-C-A 18×A**
15434311-A-C 13322431-A-C **
2649598-C-T 2781557-C-T **
3984667-GA-G 4116626-GA-G 12×A**
14027755-ATG-A 11907049-ATG-A **
10967504-T-TTTCCA **
14143978-G-C 12023272-G-C **
17462037-C-A 15350157-C-A **
13557600-C-A 11401924-C-A **
16428041-G-T 14316161-G-T **
2817700-T-C 2949659-T-C **
16211146-C-A 14099266-C-A **
15353805-C-A 13241924-C-A **
15402436-C-A 13290556-C-A **
14339105-TC-T 12218400-TC-T **
3627351-C-A 3759310-C-A **
14779489-T-C 12667559-T-C **
16829358-C-A 14717478-C-A **
10673137-C-T **
22181819-C-A 20019933-C-A **
19548362-C-A 17436482-C-A **
17561389-C-A 15449509-C-A **
21639035-G-T 19477149-G-T **
20587808-A-AAG 18425922-A-AAG P5_Dst 10×AT**
10844219-A-T **
10692075-C-T **
10673194-A-C **
15926917-C-A 13815037-C-A **
9980479-C-A 10142870-C-A **
19272166-C-T 17160286-C-T **
10673125-TC-T **
28596399-GT-G 26450252-GT-G 16×T**
27861874-C-A 25715727-C-A P1_Y2 **
15201473-C-A 13089559-C-A **
10980821-T-C **
11022899-C-CTCAAT **
4000403-A-AT 4132362-A-AT 14×T**
14065641-C-A 11944935-C-A **
10984552-TGCAATTACAG-T **
4983800-G-T 5115759-G-T **
28545723-T-A 26399576-T-A **
14537769-C-A 12425970-C-A **
17713882-C-T 15602002-C-T **
10673148-G-C **
16876948-T-A 14765068-T-A **
10801662-C-G **
14909133-G-T 12797200-G-T **
19129582-C-A 17017702-C-A **
6858625-A-G 6990584-A-G **
10866391-C-A **
2974390-C-A 3106349-C-A **
20645876-A-G 18483990-A-G P4_Prx **
10844201-T-A **
13941693-ATT-A 11820987-ATT-A 15×T**
16860748-GCA-G 14748868-GCA-G **
18443590-C-CAT 16331710-C-CAT P6_Dst **
14766593-A-T 12654662-A-T **
28788462-T-C 26642315-T-C **
16271130-C-A 14159250-C-A **
16354869-CAAAA-C 14242989-CAAAA-C 13×A**
3179738-G-GT 3311697-G-GT 11×T**
15671136-C-T 13559256-C-T **
16968143-T-C 14856263-T-C **
10744287-C-A **
10744286-C-A **
10878194-C-A **
11013532-C-G **
9123371-G-T **
17092473-C-A 14980593-C-A **
10776353-T-TTTCCA **
20603480-G-T 18441594-G-T P5_Dst **
7397614-C-A 7529573-C-A **
11002022-C-A **
18270249-C-A 16158369-C-A 35×A**
28782264-C-A 26636117-C-A **
18890467-A-C 16778587-A-C F23012 **
10673145-C-T **
10673129-C-G **
10673112-CCTTTG-C **
10673103-C-G **
10673090-T-A **
21409535-C-A 19247649-C-A **
14911006-C-A 12799073-C-A **
17537953-C-A 15426073-C-A **
10804789-C-G **
17589188-C-A 15477308-C-A **
17929007-C-A 15817127-C-A **
28492041-C-A 26345894-C-A **
24244622-TA-T 22098475-TA-T P3_b1 **
3266830-T-C 3398789-T-C **
3960483-T-TA 4092442-T-TA 9×A**
3834747-GT-G 3966706-GT-G **
3737792-G-T 3869751-G-T **
3705341-C-A 3837300-C-A **
13486802-A-AT 11331126-A-AT **
3672903-T-G 3804862-T-G **
3672825-G-A 3804784-G-A **
3790878-GTATATATATATA-G 3922837-GTATATATATATA-G 21×TA**
3626914-TA-T 3758873-TA-T **
3321331-C-A 3453290-C-A **
3271303-C-A 3403262-C-A **
3178803-C-A 3310762-C-A **
3987820-A-C 4119779-A-C **
3153001-T-C 3284960-T-C **
3079443-A-G 3211402-A-G **
3051345-C-A 3183304-C-A **
3026283-T-A 3158242-T-A **
15685149-A-AAAC 13573269-A-AAAC 13×AAC**
2968062-G-T 3100021-G-T **
2950361-C-A 3082320-C-A ALK24 **
2926443-A-G 3058402-A-G **
2876878-C-A 3008837-C-A **
2843918-C-A 2975877-C-A **
2814915-T-G 2946874-T-G **
3987780-T-A 4119739-T-A **
3995232-A-C 4127191-A-C **
2669037-G-A 2800996-G-A **
5844537-C-A 5976496-C-A **
6576736-C-T 6708695-C-T **
6514126-A-G 6646085-A-G **
6454496-A-C 6586455-A-C **
6402993-T-A 6534952-T-A **
6381801-ATGTGTG-A 6513760-ATGTGTG-A 16×TG**
6360651-C-A 6492610-C-A **
6063440-G-T 6195399-G-T **
6036736-T-G 6168695-T-G **
5914426-T-C 6046385-T-C **
5907037-T-C 6038996-T-C **
5873462-G-T 6005421-G-T **
5775584-C-A 5907543-C-A **
4226202-T-TG 4358161-T-TG **
5534730-A-T 5666689-A-T **
5191292-G-A 5323251-G-A **
5149650-C-A 5281609-C-A **
4887782-T-A 5019741-T-A **
4860275-G-T 4992234-G-T **
4840184-C-A 4972143-C-A **
4797342-G-T 4929301-G-T **
4747162-C-A 4879121-C-A **
4540179-A-G 4672138-A-G **
4521979-T-A 4653938-T-A **
4356892-A-G 4488851-A-G **
4236397-A-G 4368356-A-G **
2746048-T-C 2878007-T-C **
3046452-C-A 3178411-C-A **
2649634-C-A 2781593-C-A **
23249250-C-A 21087364-C-A **
5773148-T-C 5905107-T-C **
4094970-C-A 4226929-C-A **
5560108-AAAAT-A 5692067-AAAAT-A 5×AAAT**
13323494-C-CAA 11167818-C-CAA 24×A**
13855571-G-C 11734865-G-C **
14143980-A-C 12023274-A-C **
4346565-A-AT 4478524-A-AT 22×T**
28370120-C-A 26223973-C-A P1_gr2 **
16071852-C-A 13959972-C-A A12119 **
10004343-C-A 10166734-C-A **
6918528-T-A 7050487-T-A **
7383679-C-A 7515638-C-A **
13454562-C-A 11298886-C-A **
27263122-T-TTG 25116975-T-TTG P1_g3 21×TG**
3925759-C-A 4057718-C-A **
14994331-G-T 12882416-G-T **
22048507-G-A 19886621-G-A **
22048505-A-C 19886619-A-C **
22048504-A-C 19886618-A-C **
13486840-C-A 11331164-C-A **
27497075-T-TC 25350928-T-TC P1_Y2 **
17597920-G-GAA 15486040-G-GAA 11×A**
6858626-G-GT 6990585-G-GT **
10760381-A-T **
5627496-C-A 5759455-C-A **
16749725-GTTTTT-G 14637845-GTTTTT-G 16×T**
10832441-C-A **
17596479-C-A 15484599-C-A **
7009264-A-T 7141223-A-T **
13494403-C-G 11338727-C-G **
13494390-A-G 11338714-A-G **
7580136-C-A 7712095-C-A **
28581551-C-A 26435404-C-A **
15410621-G-GA 13298741-G-GA **
22088842-C-A 19926956-C-A **
4056690-TA-T 4188649-TA-T 10×A**
13982817-C-A 11862111-C-A **
6828953-A-G 6960912-A-G **
21555460-C-A 19393574-C-A **
18384261-C-A 16272381-C-A P6_Gap **
2767823-C-A 2899782-C-A **
13494397-T-C 11338721-T-C **
21153500-TA-T 18991614-TA-T **
14159486-A-ATG 12038780-A-ATG 16×TG**
7469938-C-A 7601897-C-A IR1_L **
13443530-A-T 11287854-A-T **
13608647-CAA-C 11452971-CAA-C 27×A**
22177679-C-A 20015793-C-A ***
16855372-T-A 14743492-T-A 17×A***
24845826-G-A 22699679-G-A P3_b2 ***
58979593-A-ATCATT 56833446-A-ATCATT ***
17644522-C-A 15532642-C-A ***
9654339-GA-G 9816730-GA-G IR3_Prx ***
10958285-A-G ***
22812763-C-A 20650877-C-A ***
28720341-G-A 26574194-G-A ***
17054894-C-T 14943014-C-T ***
56828428-C-A ***
19128055-CTT-C 17016175-CTT-C 14×T***
56830822-C-CTCTAG ***
9177949-G-T 9340340-G-T ***
19226188-AATAGATAGATAGATAG-A 17114308-AATAGATAGATAGATAG-A 14×ATAG***
22204566-G-T 20042680-G-T ***
13735727-A-C 11580051-A-C ***
9654345-A-T 9816736-A-T IR3_Prx ***
22222513-T-C 20060627-T-C DYZ19 ***
56835806-CGACTC-A,CCACTC ***
22099785-C-A 19937899-C-A ***
22890055-ATT-A,AT 20728169-ATT-A,AT 12×T***
58978566-C-A 56832419-C-A ***
23187811-C-A 21025925-C-A ***
56835398-CTCCAGTACATTCCACTCCACTCCAC-C,CTCCATTCCAGTCCATTCCAG ***
17054866-A-AATATAT 14942986-A-AATATAT 13×AT***
19948181-CCTTT-C 17836301-CCTTT-C P5_Prx 21×CTTT***
56832172-A-T ***
58983675-T-A 56837528-T-A ***
22423256-C-T 20261370-C-T DYZ19 ***
15739252-G-A 13627372-G-A ***
21209984-A-G 19048098-A-G ***
10815279-T-A ***
5022220-C-A 5154179-C-A ***
4063989-C-A 4195948-C-A ***
22123145-C-A 19961259-C-A ***
6712495-G-T 6844454-G-T ***
13451993-C-A 11296317-C-A ***
13225977-C-A 11070301-C-A A13786 ***
56835155-A-T ***
10973588-A-G ***
10760027-T-C,TGGCTC ***
10956634-C-T ***
10946709-C-A ***
10918244-T-C ***
10801703-A-ACTGAA,G ***
14073038-C-A 11952332-C-A ***
2984682-C-A 3116641-C-A ***
9516891-G-T 9679282-G-T ***
9461285-G-A 9623676-G-A ***
8865715-G-A 8997674-G-A ***
8806287-G-T 8938246-G-T ***
8778985-C-A 8910944-C-A ***
8409366-A-G 8541325-A-G ***
8048554-G-A 8180513-G-A ***
7420426-C-A 7552385-C-A ***
7315849-AGT-A 7447808-AGT-A ***
3640682-CTCCTTCCTTCCT-C 3772641-CTCCTTCCTTCCT-C 14×TCCT***
5393294-GGAAGAAGAA-G 5525253-GGAAGAAGAA-G 10×GAA***
6922736-C-A 7054695-C-A Y82881 ***
17012893-C-A 14901013-C-A ***
7221798-C-A 7353757-C-A ***
21207125-C-A 19045239-C-A ***
17066021-G-T 14954141-G-T ***
20833700-C-A 18671814-C-A P4_Gap ***
10781676-A-AATTCC ***
10987808-C-CGGGTT ***
10805165-T-TATTCC ***
19416388-T-C 17304508-T-C ***
19415804-C-A 17303924-C-A ***
10987805-A-C ***
10673936-TCCATTGCACC-T,TCCATT ***
10987813-C-A ***
10673894-A-G,T ***
18709001-C-A 16597121-C-A ***
18589678-TTTTATTTTATTTTATTTTATTTTTTTTTTTTTTTTTTG-T 16477798-TTTTATTTTATTTTATTTTATTTTTTTTTTTTTTTTTTG-T ***
18923982-AG-A,AA 16812102-AG-A,AA ***
13483439-A-AG 11327763-A-AG ***
14264317-C-A 12143611-C-A ***
16930718-T-C 14818838-T-C ***
16915152-C-A 14803272-C-A ***
16554862-CAATA-C 14442982-CAATA-C ***
19498143-C-A 17386263-C-A ***
10807265-T-A,G ***
3594040-C-A 3725999-C-A ***
15733054-C-A 13621174-C-A ***
7703921-C-A 7835880-C-A ***
15352206-C-A 13240325-C-A ***
10987854-C-A ***
14825824-CTTTTTTT-C,CTTTT 12713891-CTTTTTTT-C,CTTTT 18×T***
14559019-C-T 12447220-C-T ***
14313496-C-A 12192790-C-A ***
58978327-C-T 56832180-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page