Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > S1121 > L270 > ~25281992-T-C > ~24150526-G-A

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
154255
BigY2
154255
FGC
ECCVV
25590340-T-C 23444193-T-C P1_gr1 ***A*
16431842-C-T 14319962-C-T FGC42471 YY+++
3446841-G-A 3578800-G-A FGC42461 +
3209881-T-A 3341840-T-A FGC42460 +
5096743-T-G 5228702-T-G FGC42463 +
5565881-G-A 5697840-G-A FGC42464 +
14375417-CAGAG-C 12254713-CAGAG-C ++**
13824923-C-T 11704217-C-T FGC42468 **+
28499099-C-G 26352952-C-G FGC42478 +
23861738-A-C 21699852-A-C FGC42475 Y+++
21131612-C-T 18969726-C-T FGC42474 YY+++
16973299-C-A 14861419-C-A FGC42472 Y+
4096466-G-A 4228425-G-A FGC42462 +
14844250-G-T 12732316-G-T FGC42470 YY+++
14309969-G-A 12189263-G-A FGC42469 YY+++
9895861-G-A 10058252-G-A FGC42467 Y+++
9448128-C-T 9610519-C-T FGC42465 YY+++
9647965-T-C 9810356-T-C FGC42466 IR3_Prx +++
5355173-CTAGT-C 5487132-CTAGT-C *
3720550-A-G 3852509-A-G ****
27617777-C-T 25471630-C-T FGC42477 P1_Y2 *
22317255-G-T 20155369-G-T DYZ19 ****
7011672-C-A 7143631-C-A **
7093702-G-T 7225661-G-T **
6957086-C-A 7089045-C-A **
8911477-C-A 9043436-C-A **
7138925-C-A 7270884-C-A **
8913015-G-T 9044974-G-T **
7152641-T-C 7284600-T-C **
7199473-C-A 7331432-C-A **
8987767-G-T 9150158-G-T **
7211300-A-G 7343259-A-G **
7234353-A-G 7366312-A-G Y83681 **
7337397-T-C 7469356-T-C **
6948150-C-T 7080109-C-T **
7134779-A-G 7266738-A-G **
7356307-C-T 7488266-C-T **
7340282-C-A 7472241-C-A **
7996000-C-A 8127959-C-A **
8690593-A-G 8822552-A-G **
8649422-G-T 8781381-G-T **
8279956-C-A 8411915-C-A **
8232156-C-A 8364115-C-A **
8216622-T-G 8348581-T-G **
8094653-A-C 8226612-A-C **
7994206-C-A 8126165-C-A **
19085095-T-C 16973215-T-C **
8851029-A-G 8982988-A-G **
7958496-T-C 8090455-T-C **
7764438-C-T 7896397-C-T **
7659700-C-A 7791659-C-A **
7646750-T-C 7778709-T-C **
7381323-G-T 7513282-G-T **
18967665-A-T 16855785-A-T **
7374970-C-A 7506929-C-A **
6646072-C-A 6778031-C-A **
6855375-C-A 6987334-C-A **
21743362-C-T 19581476-C-T **
5116454-C-A 5248413-C-A **
5016052-C-A 5148011-C-A **
4961546-C-T 5093505-C-T **
4961534-C-A 5093493-C-A **
4804656-T-A 4936615-T-A **
4734198-C-A 4866157-C-A **
4626342-AT-A 4758301-AT-A **
5393443-T-C 5525402-T-C **
4472504-C-A 4604463-C-A **
4321081-G-T 4453040-G-T **
4120192-T-A 4252151-T-A **
3869893-A-C 4001852-A-C **
3751829-G-T 3883788-G-T **
3500589-C-A 3632548-C-A **
3489480-G-T 3621439-G-T **
5141975-G-T 5273934-G-T **
5537402-C-A 5669361-C-A **
6822488-C-A 6954447-C-A **
6633126-C-A 6765085-C-A **
6786650-G-T 6918609-G-T **
6729777-C-A 6861736-C-A **
6714468-C-T 6846427-C-T **
6667525-C-A 6799484-C-A **
6647982-C-A 6779941-C-A **
9116668-G-T 9279059-G-T **
6644746-C-A 6776705-C-A **
6537130-C-A 6669089-C-A **
5559282-A-T 5691241-A-T **
6514102-C-A 6646061-C-A **
6509409-C-A 6641368-C-A **
6478670-C-A 6610629-C-A **
6329243-C-A 6461202-C-A IR3_Dst **
6037924-A-C 6169883-A-C **
5858572-G-A 5990531-G-A **
5787289-C-A 5919248-C-A **
9029804-C-A 9192195-C-A **
10683298-C-A **
9144370-C-A 9306761-C-A **
11031993-A-G **
13255481-T-G 11099805-T-G **
13463396-G-T 11307720-G-T **
13224131-C-A 11068455-C-A **
30928-A-C **
13200427-C-A 11044751-C-A **
11032016-C-T **
11031986-C-A **
13322284-C-A 11166608-C-A **
11031976-T-C **
11031949-T-TGAAACA **
11031940-CCTCGA-C **
11031934-C-G **
11031902-T-C **
11031330-C-A **
13316169-C-A 11160493-C-A **
13417444-C-A 11261768-C-A **
13616857-T-C 11461181-T-C **
11677299-C-T **
13939139-G-C 11818433-G-C **
13934353-C-A 11813647-C-A **
13906019-T-C 11785313-T-C **
13859706-G-C 11739000-G-C **
13847085-G-C 11726379-G-C **
13824735-T-C 11704029-T-C **
11669843-T-C **
13393094-A-G 11237418-A-G **
11651698-G-T **
13629231-C-A 11473555-C-A **
13618214-A-T 11462538-A-T **
13597201-A-T 11441525-A-T **
13503962-C-A 11348286-C-A **
13379521-C-A 11223845-C-A **
13393077-A-G 11237401-A-G **
11024914-C-G **
11022255-C-A **
9424327-A-G 9586718-A-G **
10677626-C-A **
10766527-A-G **
10761326-C-A **
10759968-T-G **
10755141-C-T **
10687499-C-G **
3281370-G-T 3413329-G-T **
10660734-C-A **
10780380-T-A **
10654578-C-A **
9857319-G-T 10019710-G-T **
9823511-G-A 9985902-G-A **
9812322-C-A 9974713-C-A **
9810916-G-T 9973307-G-T **
9807892-C-A 9970283-C-A **
10775890-C-A **
10789530-T-A **
11017649-C-T **
10928746-T-C **
11007353-C-A **
10998709-C-A **
14164547-C-T 12043841-C-T **
10987865-A-G **
10986372-T-G **
10943071-C-A **
10918446-A-G **
10839558-A-T **
10889991-G-T **
10880828-C-A **
10879276-T-A **
10855658-C-G **
15638492-T-A 13526612-T-A **
15643115-A-G 13531235-A-G **
10844498-C-A **
3407339-A-G 3539298-A-G **
2785952-C-A 2917911-C-A **
3276063-A-G 3408022-A-G **
5278078-TTG-T 5410037-TTG-T 14×TG**
15325063-G-GA 13213181-G-GA 9×A**
19345115-T-A 17233235-T-A **
14295163-CTTT-C 12174457-CTTT-C 13×T**
10660117-T-TTTCCA **
25333890-C-A 23187743-C-A P2_r1 **
10763075-C-G **
13859377-A-AT 11738671-A-AT **
10800822-C-T **
14787792-ATG-A 12675862-ATG-A **
19436770-GAA-G 17324890-GAA-G **
5603545-C-A 5735504-C-A **
7243794-C-A 7375753-C-A **
18249986-TA-T 16138106-TA-T 10×A**
4597224-C-CA 4729183-C-CA 12×A**
10756660-A-ATTTTAATCCG **
10800819-C-T **
10800851-A-T **
2740471-C-A 2872430-C-A **
13487739-T-TAG 11332063-T-TAG **
7475286-G-T 7607245-G-T IR1_L **
56835459-C-A **
10924740-T-C **
15412771-CTTTT-C 13300891-CTTTT-C 15×T**
19892868-GTTT-G 17780988-GTTT-G P5_Prx 31×T**
13235011-C-A 11079335-C-A **
20840343-C-A 18678457-C-A P4_Gap **
10800852-T-C **
11032012-A-G **
14451178-C-A 12330451-C-A **
11034877-G-A **
10812516-C-A **
13859417-A-G 11738711-A-G **
7100792-C-A 7232751-C-A **
6644771-ATT-A 6776730-ATT-A 11×T**
11672575-C-A **
8911463-C-A 9043422-C-A **
10767748-A-C **
9986376-C-A 10148767-C-A **
10959261-CTCCAT-C **
23065013-A-G 20903127-A-G **
15995603-C-A 13883723-C-A **
11034852-TCCA-T **
11034851-T-TCTG **
14522153-C-A 12410354-C-A **
5905890-CA-C 6037849-CA-C 27×A**
14391874-T-TA 12271170-T-TA 15×A**
13885857-CTTTTT-C 11765151-CTTTTT-C 19×T**
13466058-G-T 11310382-G-T **
5985930-G-GA 6117889-G-GA 12×A**
58890989-CCCACT-C 56699873-ATGGAG-A **
19319834-GTATATATATATATA-G 17207954-GTATATATATATATA-G 23×TA**
58999529-C-G 56853382-C-G **
9738274-CACA-C 9900665-CACA-C IR3_Prx **
11031622-A-G **
10763070-C-CCGCTT **
17301238-C-CA 15189358-C-CA 23×A**
13859414-G-A 11738708-G-A **
10878260-A-AC **
11031998-C-A **
11031983-G-A **
18454947-CTT-C 16343067-CTT-C P6_Dst **
10766286-CCATTT-C **
10766276-G-C **
11022943-A-T **
28506063-C-CT 26359916-C-CT 11×T**
16515869-C-A 14403989-C-A **
10655106-CTCCAT-C **
10809010-G-T **
21603905-C-A 19442019-C-A **
21269328-G-GA 19107442-G-GA 9×A**
16760884-CAAA-C 14649004-CAAA-C 16×A**
10800832-C-T **
10845690-C-A **
8049590-C-A 8181549-C-A **
10767752-C-T **
3073886-T-G 3205845-T-G **
18346524-TAC-T 16234644-TAC-T P6_Prx **
14253759-C-A 12133053-C-A **
10986506-C-A **
18737562-C-A 16625682-C-A **
10652207-C-A **
3501004-C-A 3632963-C-A **
28570353-C-A 26424206-C-A **
10781560-C-A **
28496872-C-A 26350725-C-A **
16530944-C-A 14419064-C-A **
22352475-G-T 20190589-G-T DYZ19 **
15323479-C-A 13211597-C-A **
16760144-G-A 14648264-G-A **
17334006-A-G 15222126-A-G **
17860071-G-T 15748191-G-T **
14506953-C-A 12395158-C-A **
7040297-C-A 7172256-C-A **
7705624-C-A 7837583-C-A **
10895769-T-G **
22079487-G-T 19917601-G-T MF2165 **
3073880-T-C 3205839-T-C **
2986147-A-G 3118106-A-G **
2900871-C-T 3032830-C-T **
2803887-A-G 2935846-A-G **
2795554-T-C 2927513-T-C **
14023028-T-G 11902322-T-G **
14697129-C-A 12585195-C-A **
13856004-C-A 11735298-C-A **
2852398-C-A 2984357-C-A **
15137863-A-G 13025950-A-G **
11031935-CT-C **
13902732-C-A 11782026-C-A **
5524758-C-A 5656717-C-A **
7217235-C-A 7349194-C-A **
10671784-C-T **
17426249-C-A 15314369-C-A **
10958249-C-A **
11022940-T-C **
16292701-C-A 14180821-C-A **
27824065-T-TG 25677918-T-TG P1_Y2 **
5199634-C-A 5331593-C-A **
14356944-C-A 12236239-C-A **
15581089-A-T 13469209-A-T **
10879242-G-A **
16292743-A-AT 14180863-A-AT **
10984054-G-T **
22797769-G-T 20635883-G-T **
19293767-T-A 17181887-T-A Y104306 **
24386304-T-A 22240157-T-A **
23345561-C-A 21183675-C-A **
20832479-C-A 18670593-C-A P4_Gap **
23801940-C-A 21640054-C-A **
56836088-T-C **
17128535-CTTTT-C 15016655-CTTTT-C 25×T**
13856263-G-T 11735557-G-T **
28772861-C-A 26626714-C-A **
4616723-C-A 4748682-C-A **
10654619-C-A **
25938207-G-T 23792060-G-T P1_Y1 **
14735275-C-A 12623343-C-A **
14038342-C-A 11917636-C-A **
15581093-C-T 13469213-C-T 16×T**
22360197-T-G 20198311-T-G DYZ19 **
22360226-G-T 20198340-G-T DYZ19 **
22360397-G-T 20198511-G-T DYZ19 **
11031994-C-G **
10693346-C-A **
17673074-C-A 15561194-C-A **
7939310-C-A 8071269-C-A 14×A**
2773691-TAAAAA-T 2905650-TAAAAA-T 19×A**
22997465-AT-A 20835579-AT-A 8×T**
20557621-CTGTG-C 18395735-CTGTG-C P5_Dst 19×TG**
16577081-C-A 14465201-C-A **
22683678-C-T 20521792-C-T **
13952668-C-A 11831962-C-A **
10975994-C-A **
14033851-C-A 11913145-C-A **
18848211-G-A 16736331-G-A **
7453565-CAG-C 7585524-CAG-C IR1_L **
9524019-G-GTA 9686410-G-GTA 21×TA**
10091676-G-GAATT 10254067-G-GAATT **
19075431-T-A 16963551-T-A **
19022365-T-G 16910485-T-G **
14059400-A-T 11938694-A-T **
13485804-C-G 11330128-C-G **
19314713-T-C 17202833-T-C **
13485813-G-C 11330137-G-C **
18819558-T-G 16707678-T-G **
22127973-TTC-T 19966087-TTC-T **
18794325-C-A 16682445-C-A **
18767847-G-T 16655967-G-T **
18738305-G-T 16626425-G-T **
18682904-C-A 16571024-C-A **
19295002-C-A 17183122-C-A **
21830202-AGTC-A 19668316-AGTC-A **
18650533-G-T 16538653-G-T **
21090227-C-A 18928341-C-A **
21381687-G-T 19219801-G-T **
21360359-G-T 19198473-G-T **
21162445-C-A 19000559-C-A **
21116768-C-A 18954882-C-A **
13859403-T-C 11738697-T-C **
21104481-G-T 18942595-G-T **
21077298-C-A 18915412-C-A **
19414882-T-C 17303002-T-C **
21071013-C-A 18909127-C-A **
20596397-G-T 18434511-G-T P5_Dst **
20557673-A-G 18395787-A-G P5_Dst **
19709569-G-C 17597689-G-C P5_Prx **
19575844-T-C 17463964-T-C P5_Prx **
19522641-G-T 17410761-G-T **
19517377-T-G 17405497-T-G **
18654832-C-A 16542952-C-A **
18648725-C-G 16536845-C-G **
21382134-T-G 19220248-T-G **
15768996-C-A 13657116-C-A **
17518536-T-C 15406656-T-C **
17490927-T-C 15379047-T-C **
17453231-C-A 15341351-C-A **
24407288-C-T 22261141-C-T **
17448580-C-A 15336700-C-A **
17366778-A-C 15254898-A-C **
17360996-T-A 15249116-T-A **
17576174-G-T 15464294-G-T **
18953003-AAAAG-A 16841123-AAAAG-A 4×AAAG**
17334020-C-T 15222140-C-T **
17333998-T-C 15222118-T-C **
17326765-C-G 15214885-C-G **
17313744-C-A 15201864-C-A **
17289634-C-A 15177754-C-A **
17284656-C-A 15172776-C-A **
17548723-C-A 15436843-C-A **
17581780-C-A 15469900-C-A **
18634936-C-A 16523056-C-A **
17926683-T-G 15814803-T-G **
13218966-C-A 11063290-C-A 21×A**
18564345-T-C 16452465-T-C **
18549252-C-A 16437372-C-A **
18328869-C-T 16216989-C-T P6_Prx **
18192573-A-G 16080693-A-G **
18053434-T-C 15941554-T-C **
18034671-C-A 15922791-C-A **
17870748-G-A 15758868-G-A **
17637860-C-A 15525980-C-A **
17812039-TA-T 15700159-TA-T **
17802128-A-T 15690248-A-T **
17799015-C-A 15687135-C-A **
17729944-C-A 15618064-C-A **
3319786-ATC-A 3451745-ATC-A 8×TC**
5459363-G-A 5591322-G-A **
7562124-C-A 7694083-C-A **
21382089-T-A 19220203-T-A **
21433291-C-G 19271405-C-G **
17279372-A-G 15167492-A-G **
13689724-A-AGGAAT 11534048-A-AGGAAT **
28485793-C-T 26339646-C-T **
27862652-G-T 25716505-G-T P1_Y2 **
27859411-A-ATAAG 25713264-A-ATAAG P1_Y2 **
26025311-G-T 23879164-G-T P1_Y1 **
25934585-T-TG 23788438-T-TG P1_Y1 **
24517962-T-C 22371815-T-C **
23360428-G-GTATTAT 21198542-G-GTATTAT 12×TAT********
16860784-G-A 14748904-G-A **
24459329-C-A 22313182-C-A **
24421888-T-C 22275741-T-C **
24408863-G-T 22262716-G-T **
13859407-A-G 11738701-A-G **
24002996-C-T 21856849-C-T **
23491123-A-G 21329237-A-G **
23387546-C-A 21225660-C-A **
28500014-G-T 26353867-G-T **
28798952-C-G 26652805-C-G **
58848115-C-G 56742756-G-C **
21491080-G-T 19329194-G-T ****
22861-C-G **
56871459-T-C **
56858123-C-T **
56847407-G-T **
56845800-G-T **
56843807-G-C **
17334015-C-T 15222135-C-T ****
56835223-C-CCATTA **
28506098-T-C 26359951-T-C **
22421587-AG-A 20259701-AG-A DYZ19 **
22421632-CTACA-C 20259746-CTACA-C DYZ19 **
56707175-A-G **
28760745-C-A 26614598-C-A **
28722391-A-T 26576244-A-T **
27341129-G-T 25194982-G-T P1_g3 **
28612339-T-G 26466192-T-G **
23343755-G-T 21181869-G-T **
23340929-G-A 21179043-G-A **
21456044-C-A 19294158-C-A **
21884663-C-A 19722777-C-A **
22166737-C-T 20004851-C-T **
22155284-C-A 19993398-C-A **
22041043-A-T 19879157-A-T **
21958210-C-T 19796324-C-T **
21947202-T-A 19785316-T-A **
21885861-T-C 19723975-T-C **
21880901-A-C 19719015-A-C **
22613812-C-A 20451926-C-A **
21824500-C-A 19662614-C-A M7061 **
21708343-T-C 19546457-T-C **
59007972-A-C 56861825-A-C **
22360196-C-A 20198310-C-A DYZ19 **
13445362-CAAAA-C 11289686-CAAAA-C 15×A**
13257353-C-T 11101677-C-T **
21545363-T-A 19383477-T-A **
22253019-G-C 20091133-G-C DYZ19 **
22614339-T-C 20452453-T-C **
23337029-A-G 21175143-A-G **
23097181-A-G 20935295-A-G **
23276395-C-A 21114509-C-A **
23275970-G-T 21114084-G-T **
13258251-G-T 11102575-G-T **
13258227-G-C 11102551-G-C **
23200426-G-T 21038540-G-T **
23188590-C-A 21026704-C-A **
23142546-C-A 20980660-C-A **
23058529-C-T 20896643-C-T **
22653262-C-A 20491376-C-A **
23005297-C-T 20843411-C-T **
13394165-A-ATT 11238489-A-ATT **
22996853-C-A 20834967-C-A **
22916952-A-G 20755066-A-G **
13257342-C-T 11101666-C-T **
22902037-C-A 20740151-C-A **
22810231-C-A 20648345-C-A **
17279418-T-C 15167538-T-C **
18925663-T-G 16813783-T-G **
17165475-C-A 15053595-C-A **
14949171-C-A 12837245-C-A **
15171307-C-A 13059393-C-A **
15171299-A-G 13059385-A-G **
15169483-C-A 13057569-C-A **
14993822-C-A 12881907-C-A **
13466058-GC-G 11310382-GC-G **
14966565-G-T 12854640-G-T **
14816074-G-A 12704145-G-A **
15288955-A-C 13177054-A-C **
14816071-C-T 12704142-C-T **
14807349-G-A 12695420-G-A **
14807348-T-G 12695419-T-G **
14807346-C-A 12695417-C-A **
22011415-G-A 19849529-G-A **
14807341-A-C 12695412-A-C **
15209334-C-T 13097420-C-T **
15298023-C-A 13186122-C-A A19294 **
58903863-A-T 56687008-T-A **
15648971-T-G 13537091-T-G **
15911579-G-T 13799699-G-T **
15832246-A-G 13720366-A-G **
15789743-C-T 13677863-C-T **
15786137-A-G 13674257-A-G **
15656824-C-A 13544944-C-A **
15650434-G-A 13538554-G-A **
15593232-C-A 13481352-C-A **
15403566-C-A 13291686-C-A **
15581152-C-A 13469272-C-A **
9409608-C-T 9571999-C-T **
15527652-C-A 13415772-C-A **
15479505-C-A 13367625-C-A **
6725184-T-C 6857143-T-C **
15410650-A-AT 13298770-A-AT **
15410467-C-A 13298587-C-A **
14807334-G-A 12695405-G-A **
14807327-A-G 12695398-A-G **
15971630-C-A 13859750-C-A **
9032740-C-G 9195131-C-G **
14464406-C-A 12343679-C-A **
14136298-C-A 12015592-C-A **
14361561-G-A 12240856-G-A **
14174681-C-A 12053975-C-A **
14325044-A-G 12204338-A-G **
14324287-A-G 12203581-A-G **
14313570-A-T 12192864-A-T **
14519601-C-A 12407802-C-A **
14245071-C-A 12124365-C-A **
14250061-C-A 12129355-C-A **
14272467-C-A 12151761-C-A **
14298747-G-A 12178041-G-A **
7567866-G-A 7699825-G-A **
14278851-G-T 12158145-G-T **
6722135-G-A 6854094-G-A **
14471790-T-G 12351059-T-G **
14519618-C-A 12407819-C-A **
3313072-G-A 3445031-G-A **
14627307-C-A 12515375-C-A **
3313109-A-T 3445068-A-T **
14781122-C-A 12669192-C-A **
3786556-G-T 3918515-G-T **
14734940-C-A 12623008-C-A **
14704674-A-G 12592740-A-G **
14704653-A-G 12592719-A-G **
4728779-G-T 4860738-G-T **
5811988-T-A 5943947-T-A **
14627283-G-A 12515351-G-A **
14614445-C-A 12502643-C-A **
5009622-A-G 5141581-A-G **
14611518-C-A 12499724-C-A **
14587799-G-T 12475999-G-T **
14107652-C-A 11986946-C-A **
14551592-C-A 12439793-C-A **
9434013-T-C 9596404-T-C **
14295190-A-C 12174484-A-C **
28818236-C-T 26672089-C-T **
16747493-C-A 14635613-C-A **
16790985-T-A 14679105-T-A **
16292670-G-T 14180790-G-T **
16292716-A-G 14180836-A-G **
16760163-C-T 14648283-C-T **
16760161-C-CAT 14648281-C-CAT **
16292757-T-C 14180877-T-C **
16295739-T-C 14183859-T-C **
16760154-GTA-G 14648274-GTA-G **
16760132-C-CA 14648252-C-CA **
16355002-G-A 14243122-G-A **
16733698-AAAT-A 14621818-AAAT-A **
16292668-C-T 14180788-C-T **
14100828-C-A 11980122-C-A **
16469012-C-A 14357132-C-A **
16653228-C-A 14541348-C-A **
9424598-GAAA-G 9586989-GAAA-G 16×A**
16648409-G-A 14536529-G-A **
58860497-C-A 56730374-G-T FGC42760 **
16492948-G-T 14381068-G-T **
16516267-G-T 14404387-G-T **
16540352-G-T 14428472-G-T A12004 **
16576877-C-A 14464997-C-A **
16576884-A-C 14465004-A-C **
16866059-C-A 14754179-C-A **
13535639-GTATA-G 11379963-GTATA-G 21×TA**
16292640-G-A 14180760-G-A **
16948443-C-A 14836563-C-A **
17159559-C-A 15047679-C-A **
9429040-T-C 9591431-T-C **
16196316-C-A 14084436-C-A **
16247741-C-A 14135861-C-A **
16084328-C-A 13972448-C-A **
16278541-C-A 14166661-C-A **
16998459-T-C 14886579-T-C **
17018807-C-A 14906927-C-A **
16060031-G-C 13948151-G-C **
16933279-C-A 14821399-C-A **
16905837-C-A 14793957-C-A **
16874814-T-C 14762934-T-C **
16874370-G-T 14762490-G-T **
16292638-A-G 14180758-A-G Y31617 **
16007428-C-A 13895548-C-A **
16199766-T-A 14087886-T-A **
13462335-ACACTCC-CAACACA 11306659-ACACTCC-CAACACA ***
13545359-G-GAAAA 11389683-G-GAAAA ***
13600609-C-A 11444933-C-A ***
13489557-TTGGGAGCAGCCG-GTGGAAACACCCT 11333881-TTGGGAGCAGCCG-GTGGAAACACCCT ***
28468253-CTTTT-C 26322106-CTTTT-C 13×T***
27810273-A-AAAGG 25664126-A-AAAGG P1_Y2 16×AAGG***
13471880-CGGT-TGGG 11316204-CGGT-TGGG ***
13976083-CA-C,CAA 11855377-CA-C,CAA 15×A***
58856413-ATCCT-CA 56734454-AGGAT-TG ***
13462346-TCCCCCGGCCT-CCCCACAGCCG 11306670-TCCCCCGGCCT-CCCCACAGCCG ***
56832881-C-A ***
28549708-CAGGT-GAGGG 26403561-CAGGT-GAGGG ***
28549768-CCAAGGCAGGGCCAGGGCCGG-C 26403621-CCAAGGCAGGGCCAGGGCCGG-C ***
13471776-CCG-TCA 11316100-CCG-TCA ***
58856430-TCAT-CGAG 56734438-ATGA-CTCG ***
58884357-CCC-TCA 56706512-GGG-TGA ***
13836802-C-A 11716096-C-A ***
13466719-GAGCA-ATGCG 11311043-GAGCA-ATGCG ***
58899937-GCATTC-G 56690904-AAATGG-A 5×CATTC***
58980039-CGCCATTCCA-TTCCTTTACT 56833892-CGCCATTCCA-TTCCTTTACT ***
26707123-CTT-C 24560976-CTT-C P1_g2 13×T***
13468395-CCTGGAG-TCTAGAC 11312719-CCTGGAG-TCTAGAC ***
13466755-TCCC-GCCT 11311079-TCCC-GCCT ***
13471723-GGGC-TGGT 11316047-GGGC-TGGT ***
17124174-GCAAAC-TTAAAT 15012294-GCAAAC-TTAAAT ***
26463197-TCCA-CCCC 24317050-TCCA-CCCC P1_Y1 ***
22229664-CAC-GTG 20067778-CAC-GTG DYZ19 ***
22311214-GTGTGCAGAG-TTCTCCTGAC 20149328-GTGTGCAGAG-TTCTCCTGAC DYZ19 ***
22311205-CC-AA 20149319-CC-AA DYZ19 ***
22293340-AATTTG-CGTTT 20131454-AATTTG-CGTTT DYZ19 ***
22281867-TG-T 20119981-TG-T DYZ19 ***
22274121-GTGTCCAGAA-ATGTATAGAG 20112235-GTGTCCAGAA-ATGTATAGAG DYZ19 ***
14761143-T-TAGATAGAC 12649212-T-TAGATAGAC ***
14825838-TTTTTG-T 12713905-TTTTTG-T ***
15308832-C-CAA 13196936-C-CAA ***
15410633-CAAAAAAAAA-C 13298753-CAAAAAAAAA-C 28×A***
22322295-CT-AC 20160409-CT-AC DYZ19 ***
15963774-T-TG 13851894-T-TG ***
20815408-C-CATATAT 18653522-C-CATATAT P4_Gap 22×AT***
16282397-TCAAA-T 14170517-TCAAA-T ***
19084996-G-GA 16973116-G-GA 10×A***
16344410-C-CTTCTTA 14232530-C-CTTCTTA ***
16533223-TTGTATATTATGTATACATATA-T 14421343-TTGTATATTATGTATACATATA-T ***
18738827-GTATA-G 16626947-GTATA-G 10×TA***
17124166-TGTC-CATT 15012286-TGTC-CATT ***
18465463-CCTACAG-TCTAAAA 16353583-CCTACAG-TCTAAAA P6_Dst ***
22311295-GACAG-TACAC 20149409-GACAG-TACAC DYZ19 ***
14632089-TGAAGT-AGTAGC 12520158-TGAAGT-AGTAGC ***
13545361-A-AAGAG 11389685-A-AAGAG ***
22434804-CC-TA 20272918-CC-TA DYZ19 ***
24447134-A-AGAAG 22300987-A-AGAAG ***
24387441-CCA-C 22241294-CCA-C ***
13596214-GC-G 11440538-GC-G ***
22503088-ATTT-TTTG 20341202-ATTT-TTTG DYZ19 ***
17474945-C-CT 15363065-C-CT 15×T***
22434884-CGGTC-AGGTA 20272998-CGGTC-AGGTA DYZ19 ***
22434855-CA-AC 20272969-CA-AC DYZ19 ***
13616931-TA-T 11461255-TA-T 11×A***
13623931-T-TATAG 11468255-T-TATAG ***
22322313-GGCAT-AGCAC 20160427-GGCAT-AGCAC DYZ19 ***
22360397-GC-TT 20198511-GC-TT DYZ19 ***
22360196-CT-AG 20198310-CT-AG DYZ19 ***
22360134-TT-G 20198248-TT-G DYZ19 ***
22359993-GTTATGTCCAGTGTTTGTTCCTTCAGATG-TTTA 20198107-GTTATGTCCAGTGTTTGTTCCTTCAGATG-TTTA DYZ19 ***
13730055-GAATTGACTCGAAAGA-G 11574379-GAATTGACTCGAAAGA-G ***
22352974-GTGT-CTGA 20191088-GTGT-CTGA DYZ19 ***
14159505-TGTG-T 12038799-TGTG-T ***
22342658-CTCA-TTCT 20180772-CTCA-TTCT DYZ19 ***
22322323-GG-AT 20160437-GG-AT DYZ19 ***
22229673-AAAACTCTGGAC-CGAACACAGGAT 20067787-AAAACTCTGGAC-CGAACACAGGAT DYZ19 ***
10987723-T-A ***
28598753-C-A 26452606-C-A ***
19477675-C-A 17365795-C-A ***
8104996-C-A 8236955-C-A ***
22113181-C-T 19951295-C-T Y77778 ***
18925712-C-A 16813832-C-A ***
19068964-C-A 16957084-C-A ***
19201367-A-G 17089487-A-G ***
8536138-G-T 8668097-G-T ***
8908175-GC-G 9040134-GC-G ***
2768019-G-T 2899978-G-T ***
16278714-C-A 14166834-C-A ***
15922240-A-G 13810360-A-G ***
9023124-A-G 9185515-A-G ***
9678528-C-A 9840919-C-A IR3_Prx ***
7636584-C-A 7768543-C-A ***
21265096-C-A 19103210-C-A ***
5449598-G-T 5581557-G-T ***
9777507-CAA-C,CA 9939898-CAA-C,CA 17×A***
15423474-CAAAAA-C,CAA 13311594-CAAAAA-C,CAA 16×A***
18908016-G-GCA 16796136-G-GCA ***
18817072-C-A 16705192-C-A ***
10693792-T-C ***
10808611-C-CTTTCT ***
17283113-GT-G,GTT 15171233-GT-G,GTT 13×T***
17041931-G-T 14930051-G-T ***
6144677-G-T 6276636-G-T IR3_Dst ***
3815140-G-T 3947099-G-T ***
16760940-A-G 14649060-A-G ***
6693756-C-A 6825715-C-A ***
6881658-C-A 7013617-C-A ***
16647917-C-A 14536037-C-A ***
10826461-T-A ***
17850888-C-G 15739008-C-G ***
16595919-CT-C,CTT 14484039-CT-C,CTT 17×T***
6663251-C-A 6795210-C-A ***
15365925-G-T 13254045-G-T ***
7356251-G-T 7488210-G-T ***
7374805-T-C 7506764-T-C ***
16702971-C-A 14591091-C-A ***
13466723-A-G 11311047-A-G ***
15338745-C-A 13226863-C-A ***
18901316-C-A 16789436-C-A ***
28598654-C-A 26452507-C-A ***
22204199-C-A 20042313-C-A ***
10687561-TTTCCA-T ***
23378997-C-A 21217111-C-A ***
21295229-A-G 19133343-A-G ***
23772695-G-T 21610809-G-T ***
14555823-C-A 12444024-C-A ***
13196365-A-C 11040689-A-C ***
7518513-G-A 7650472-G-A ***
13319544-C-A 11163868-C-A ***
13489468-G-T 11333792-G-T ***
10808620-C-T ***
10670998-CTCCAT-C ***
24278183-C-CAAGA,CAAGAAAGA 22132036-C-CAAGA,CAAGAAAGA P3_b1 22×AAGA***
10685784-CTCCAT-C ***
2855305-CTT-C,CT 2987264-CTT-C,CT 16×T***
10821874-C-CTCTAT ***
13461046-T-A,C 11305370-T-A,C ***
10875752-G-GTTCCA ***
23359106-C-A 21197220-C-A ***
2960062-CAA-C,CA 3092021-CAA-C,CA 17×A***
21604335-C-A 19442449-C-A ***
17960966-CTTTTT-C 15849086-CTTTTT-C 18×T***
11651853-C-A ***
21624230-C-A 19462344-C-A ***
5635214-G-T 5767173-G-T ***
21766562-A-G 19604676-A-G ***
4444474-G-T 4576433-G-T ***
10826463-CTCTGT-C,CTCCAT ***
10808638-C-G ***
14881758-C-A 12769826-C-A ***
6120234-CATAT-C,CAT 6252193-CATAT-C,CAT 14×AT***
14778744-C-A 12666814-C-A ***
10660789-C-A ***
10868943-C-T ***
22660351-CT-C 20498465-CT-C ***
22797830-A-G 20635944-A-G ***
10935601-CCATTCCATTCCATTCCATTCCATTC-C,CCATTCCATTCCATTCCATTCCATTA ***
13462300-TG-CA 11306624-TG-CA ***
23011181-G-T 20849295-G-T ***
11014304-T-C ***
13462324-GCCCA-ACCCT 11306648-GCCCA-ACCCT ***
59004463-AAAAG-A 56858316-AAAAG-A 15×AAAG***
13456023-C-CCATTG 11300347-C-CCATTG ***
58884472-C-A 56706399-G-T ***
4100699-A-T 4232658-A-T ***
3791828-G-T 3923787-G-T ***
3451911-G-T 3583870-G-T ***
2758710-T-A 2890669-T-A ***
2758601-T-A 2890560-T-A ***
2758582-T-A 2890541-T-A ***
13462339-T-A 11306663-T-A ***
14738429-T-G 12626497-T-G ***
4548113-G-T 4680072-G-T ***
22356841-C-T 20194955-C-T DYZ19 ***
16068862-A-G 13956982-A-G ***
3963833-C-A 4095792-C-A 22×A***
58916072-G-C 56674799-C-G ***
13466712-G-T 11311036-G-T ***
22422749-G-T 20260863-G-T DYZ19 ***
58899845-C-G 56691026-G-C ***
4158610-T-G 4290569-T-G ***
4727373-T-C 4859332-T-C ***
58828130-T-G 56762741-A-C ***
6197367-T-C 6329326-T-C IR3_Dst ***
8002783-G-T 8134742-G-T ***
7483059-A-T 7615018-A-T IR1_L ***
7175493-C-T 7307452-C-T ***
6566581-A-T 6698540-A-T ***
6365903-G-A 6497862-G-A ***
6279248-C-G 6411207-C-G IR3_Dst ***
6226236-C-A 6358195-C-A IR3_Dst ***
6197271-T-C 6329230-T-C IR3_Dst ***
4738354-T-A 4870313-T-A ***
6156972-T-C 6288931-T-C IR3_Dst ***
6018474-T-G 6150433-T-G ***
5954644-G-C 6086603-G-C ***
5785650-T-A 5917609-T-A ***
5785605-T-A 5917564-T-A ***
5303575-T-G 5435534-T-G ***
5115487-C-A 5247446-C-A ***
4759209-C-T 4891168-C-T ***
18161185-G-GTT 16049305-G-GTT 16×T***
58828075-T-C 56762796-A-G ***
8075934-G-T 8207893-G-T ***
22321010-C-G 20159124-C-G DYZ19 ***
22349262-G-T 20187376-G-T DYZ19 ***
22237261-C-A 20075375-C-A DYZ19 ***
13729613-G-T 11573937-G-T ***
22262577-ATGT-GTGC 20100691-ATGT-GTGC DYZ19 ***
13471842-TGGG-GGGT 11316166-TGGG-GGGT ***
58850490-A-G 56740381-T-C ***
22321021-T-A 20159135-T-A DYZ19 ***
22320991-C-T 20159105-C-T DYZ19 ***
13737205-T-A 11581529-T-A ***
22320984-A-T 20159098-A-T DYZ19 ***
22320979-T-A 20159093-T-A DYZ19 ***
20084831-A-T 17972951-A-T P5_Dst ***
13742278-T-C 11586602-T-C ***
22450320-G-T 20288434-G-T DYZ19 ***
28620602-G-GT 26474455-G-GT ***
22282092-G-C 20120206-G-C DYZ19 ***
24595412-A-T 22449265-A-T P3_t2 ***
5109180-AT-A 5241139-AT-A 11×T***
13936208-G-GAAAA 11815502-G-GAAAA ***
58887728-C-A 56703143-G-T FGC44073 ***
13454823-A-ATTCCC 11299147-A-ATTCCC ***
13454818-A-ATTCCC 11299142-A-ATTCCC ***
9429040-TTGCA-CTGCG 9591431-TTGCA-CTGCG ***
27528888-T-A 25382741-T-A P1_Y2 ***
22308079-A-G 20146193-A-G DYZ19 ***
58903424-C-G 56687447-G-C ***
15047302-T-TA 12935393-T-TA ***
22287097-G-T 20125211-G-T DYZ19 ***
22325190-G-C 20163304-G-C DYZ19 ***
8218013-TTTTCTTTCTTTC-T 8349972-TTTTCTTTCTTTC-T 15×TTTC***
22481525-C-G 20319639-C-G DYZ19 ***
13466740-CCCCCGGTAA-TCTCCAGTAG 11311064-CCCCCGGTAA-TCTCCAGTAG ***
25207815-T-C 23061668-T-C P2_r1 ***
22499903-T-C 20338017-T-C DYZ19 ***
22499902-T-A 20338016-T-A DYZ19 ***
22321002-C-A 20159116-C-A DYZ19 ***
22320998-T-C 20159112-T-C DYZ19 ***
8002786-T-A 8134745-T-A ***
9308067-G-T 9470458-G-T ***
16757043-AT-A 14645163-AT-A 27×T***
14632103-A-G 12520172-A-G ***
15374465-A-T 13262585-A-T ***
14963154-C-T 12851229-C-T ***
14739933-G-T 12628001-G-T ***
14739856-A-T 12627924-A-T ***
14634284-C-G 12522353-C-G ***
14632143-G-A 12520212-G-A ***
14632114-T-C 12520183-T-C ***
14632075-T-C 12520144-T-C ***
15837518-A-C 13725638-A-C ***
14632065-G-T 12520134-G-T ***
14620604-C-T 12508802-C-T ***
14391332-T-A 12270628-T-A ***
14156883-C-T 12036177-C-T ***
13924963-T-C 11804257-T-C ***
13744319-C-T 11588643-C-T ***
13726834-G-T 11571158-G-T ***
15450073-C-T 13338193-C-T 15×T***
15837567-A-T 13725687-A-T ***
13597041-A-C 11441365-A-C ***
16728722-G-T 14616842-G-T ***
17124175-C-T 15012295-C-T ***
17124174-G-T 15012294-G-T ***
17124169-C-T 15012289-C-T ***
17124167-G-A 15012287-G-A ***
17124166-T-C 15012286-T-C ***
16915048-A-C 14803168-A-C ***
16834660-T-A 14722780-T-A ***
16381405-A-C 14269525-A-C ***
15884283-C-A 13772403-C-A ***
16319232-G-A 14207352-G-A ***
16113841-T-C 14001961-T-C P8_Prx ***
16068913-A-C 13957033-A-C ***
16068847-T-C 13956967-T-C ***
16065711-C-A 13953831-C-A ***
15884513-A-G 13772633-A-G ***
15884496-A-G 13772616-A-G ***
15884495-C-T 13772615-C-T ***
13726649-A-G 11570973-A-G ***
13585688-G-A 11430012-G-A ***
9326789-A-G 9489180-A-G ***
9706130-T-A 9868521-T-A IR3_Prx ***
13257912-G-A 11102236-G-A ***
13223167-A-G 11067491-A-G ***
13222373-G-C 11066697-G-C ***
10024385-T-C 10186776-T-C ***
9975592-C-T 10137983-C-T ***
9803155-G-T 9965546-G-T ***
9781311-C-T 9943702-C-T ***
9673388-G-T 9835779-G-T IR3_Prx ***
13307251-G-A 11151575-G-A ***
9670363-C-T 9832754-C-T IR3_Prx ***
9664586-A-C 9826977-A-C IR3_Prx ***
9651435-G-T 9813826-G-T IR3_Prx ***
9596131-G-T 9758522-G-T IR3_Prx ***
9533572-A-G 9695963-A-G IR3_Prx ***
9533488-A-T 9695879-A-T IR3_Prx ***
9338165-G-C 9500556-G-C ***
13267557-C-A 11111881-C-A ***
13329962-C-T 11174286-C-T ***
13489718-C-T 11334042-C-T ***
13475006-C-T 11319330-C-T ***
13489638-A-T 11333962-A-T ***
13489611-G-T 11333935-G-T ***
13489610-T-A 11333934-T-A ***
13489605-C-T 11333929-C-T ***
13489566-G-C 11333890-G-C ***
13489507-G-A 11333831-G-A ***
13488453-G-A 11332777-G-A ***
13468384-G-C 11312708-G-C ***
13344903-C-A 11189227-C-A ***
13466719-G-A 11311043-G-A ***
13462352-G-A 11306676-G-A ***
13462350-C-A 11306674-C-A ***
13462341-C-A 11306665-C-A ***
13462324-G-A 11306648-G-A ***
13439753-G-A 11284077-G-A ***
13392541-G-A 11236865-G-A ***
13344918-T-A 11189242-T-A ***
22357280-A-T 20195394-A-T DYZ19 ***
22297150-TTTCA-GTACT 20135264-TTTCA-GTACT DYZ19 ***
17124201-T-C 15012321-T-C ***
22349435-C-G 20187549-C-G FGC15913 DYZ19 ***
4819268-T-C 4951227-T-C ***
7053358-AAAAGAAAG-A 7185317-AAAAGAAAG-A 17×AAAG***
58837044-T-G 56753827-A-C ***
22354928-A-C 20193042-A-C DYZ19 ***
22354975-T-A 20193089-T-A DYZ19 ***
9300240-AACACACACACAC-A 9462631-AACACACACACAC-A 20×AC***
19309422-C-CATAT 17197542-C-CATAT 19×AT***
9191017-T-A 9353408-T-A ***
4382449-CA-C 4514408-CA-C 17×A***
13489528-CCGCG-GCGCT 11333852-CCGCG-GCGCT ***
18738827-G-GTATA 16626947-G-GTATA 10×TA***
3606672-G-GT 3738631-G-GT 19×T***
13258251-GAC-TA 11102575-GAC-TA ***
17597506-G-GA 15485626-G-GA 10×A***
58903516-GCATTC-G 56687325-AAATGG-A 5×CATTC***
13292847-C-T 11137171-C-T ***
13728164-T-C 11572488-T-C ***
13728174-CGG-TGA 11572498-CGG-TGA ***
22309502-A-T 20147616-A-T DYZ19 ***
22356858-C-T 20194972-C-T DYZ19 ***
9735605-G-GTT 9897996-G-GTT IR3_Prx 30×T***
9302434-G-T 9464825-G-T ***
22249220-C-T 20087334-C-T DYZ19 ***
22322487-G-A 20160601-G-A DYZ19 ***
22322460-G-C 20160574-G-C DYZ19 ***
22356884-T-G 20194998-T-G DYZ19 ***
22356864-G-A 20194978-G-A DYZ19 ***
22224008-T-C 20062122-T-C DYZ19 ***
58891178-G-T 56699693-C-A ***
22347145-C-A 20185259-C-A DYZ19 ***
9416727-C-T 9579118-C-T ***
4819107-C-A 4951066-C-A ***
9218610-C-A 9381001-C-A ***
58891065-G-A 56699806-C-T ***
22342816-G-T 20180930-G-T DYZ19 ***
58828125-A-T 56762746-T-A ***
22328282-C-G 20166396-C-G DYZ19 ***
25592898-CTC-ATA 23446751-CTC-ATA P1_gr1 ***
13529856-GGCG-TGCA 11374180-GGCG-TGCA ***
26479590-CA-C 24333443-CA-C P1_Y1 16×A***
24107014-C-A 21960867-C-A P3_b1 ***
13737601-C-G 11581925-C-G ***
13729630-A-G 11573954-A-G ***
58982219-A-T 56836072-A-T ***
58982165-C-A 56836018-C-A ***
58978722-T-TC 56832575-T-TC ***
25211591-C-T 23065444-C-T P2_r1 ***
24893858-G-A 22747711-G-A g1 ***
22451131-G-A 20289245-G-A DYZ19 ***
58884940-G-C 56705931-C-G ***
22360741-G-A 20198855-G-A DYZ19 ***
13453084-TG-T 11297408-TG-T ***
9309891-T-G 9472282-T-G ******
6142093-ATGT-A 6274052-ATGT-A IR3_Dst ***
13799174-A-T 11678468-A-T ***
23114014-A-AATAT 20952128-A-AATAT 22×AT***
22282063-C-T 20120177-C-T DYZ19 ***
22503169-T-A 20341283-T-A DYZ19 ***
58845419-A-C 56745452-T-G ***
13222417-CACT-GAAG 11066741-CACT-GAAG ***
13456019-GATTCC-G 11300343-GATTCC-G 11×ATTCC***
13137788-CTTCCATTCCATTCCA-C 10627274-CTTCCATTCCATTCCA-C 12×TTCCA***
22324860-C-T 20162974-C-T DYZ19 ***
13468948-T-A 11313272-T-A ***
6093483-T-G 6225442-T-G ***
58866021-C-CCCATT 56724789-C-CAATGG 12×CCATT***
58884397-TG-AT 56706473-CA-AT ***
13258358-CA-C 11102682-CA-C ***
22361210-C-A 20199324-C-A DYZ19 ***
22360051-C-G 20198165-C-G DYZ19 ***
13258746-G-T 11103070-G-T ***
9199939-A-AT 9362330-A-AT ***
22309582-G-A 20147696-G-A DYZ19 ***
22360103-A-G 20198217-A-G DYZ19 ***
22360098-G-A 20198212-G-A DYZ19 ***
58914614-G-A 56676257-C-T ***
13489617-C-A 11333941-C-A ***
9292826-T-C 9455217-T-C ***
22341704-G-T 20179818-G-T DYZ19 ***
20143886-N-A 18032006-A-. P5_Dst ***
5036583-CAT-C 5168542-CAT-C 27×AT***
3952340-TGAGA-T 4084299-TGAGA-T 20×GA***
58828080-G-C 56762791-C-G ***
22421344-A-G 20259458-A-G DYZ19 ***
22421332-C-T 20259446-C-T DYZ19 ***
22421276-T-A 20259390-T-A DYZ19 ***
22360852-T-C 20198966-T-C DYZ19 ***
22360830-C-G 20198944-C-G DYZ19 ***
13737661-A-T 11581985-A-T ***
22274113-A-C 20112227-A-C DYZ19 ***
21192061-G-GA 19030175-G-GA ***
13446527-CTCCATTCCATTCCATTCCATTCCAT-C 11290851-CTCCATTCCATTCCATTCCATTCCAT-C 16×TCCAT***
22481552-T-A 20319666-T-A DYZ19 ***
22421265-T-G 20259379-T-G DYZ19 ***
22274066-C-A 20112180-C-A DYZ19 ***
22274064-G-T 20112178-G-T DYZ19 ***
21830204-TCA-T 19668318-TCA-T ***
17387292-GTGTA-G 15275412-GTGTA-G ***
3641037-C-CTTTCT 3772996-C-CTTTCT ***
22236268-GAAGG-TAAGA 20074382-GAAGG-TAAGA DYZ19 ***
13529749-T-G 11374073-T-G FGC24549 ***
22297198-A-G 20135312-A-G DYZ19 ***
58840794-T-C 56750077-A-G ***
58828128-G-C 56762743-C-G ***
25207709-G-A 23061562-G-A P2_r1 ***
22361149-T-G 20199263-T-G DYZ19 ***
22360838-C-T 20198952-C-T DYZ19 ***
22309563-T-A 20147677-T-A DYZ19 ***
22297208-G-A 20135322-G-A DYZ19 ***
22297193-A-T 20135307-A-T DYZ19 ***
22293092-GGTT-AGTG 20131206-GGTT-AGTG DYZ19 ***
13729713-C-T 11574037-C-T ***
13223173-A-G 11067497-A-G ***
22321030-A-T 20159144-A-T DYZ19 ***
58980293-TCACT-CCACG 56834146-TCACT-CCACG ***
22421286-GAAC-CAAT 20259400-GAAC-CAAT DYZ19 ***
22421163-TTTC-CTTG 20259277-TTTC-CTTG DYZ19 ***
22421139-GTG-CTA 20259253-GTG-CTA DYZ19 ***
22360838-CTTAA-TTTAC 20198952-CTTAA-TTTAC DYZ19 ***
17323360-TAG-T 15211480-TAG-T ***
13267505-C-T 11111829-C-T ***
13307318-CTG-ATA 11151642-CTG-ATA ***
10091675-A-G 10254066-A-G ***
13293053-G-A 11137377-G-A ***
13288012-T-C 11132336-T-C ***
13267992-G-A 11112316-G-A ***
13267641-C-T 11111965-C-T ***
13264002-T-A 11108326-T-A ***
13258252-AC-A 11102576-AC-A ***
13252781-CA-C 11097105-CA-C ***
6473292-T-G 6605251-T-G ***
22258034-C-G 20096148-C-G DYZ19 ***
5462523-CCA-C 5594482-CCA-C ***
13746568-ACC-TCG 11590892-ACC-TCG ***
22235628-A-T 20073742-A-T A3936 DYZ19 ***
22235625-A-T 20073739-A-T A3935 DYZ19 ***
13746554-C-G 11590878-C-G ***
13746532-A-C 11590856-A-C ***
22480710-C-A 20318824-C-A DYZ19 ***
13489477-G-T 11333801-G-T ***
22422771-G-A 20260885-G-A DYZ19 ***
13267777-C-G 11112101-C-G ***
58905820-T-A 56685051-A-T ***
22342635-C-A 20180749-C-A DYZ19 ***
22342544-A-G 20180658-A-G DYZ19 ***
22322368-C-T 20160482-C-T DYZ19 ***
22356801-G-C 20194915-G-C DYZ19 ***
22341554-C-G 20179668-C-G DYZ19 ***
9293379-C-G 9455770-C-G ***
22356837-T-C 20194951-T-C DYZ19 ***
58879543-T-G 56711328-A-C ***
28628398-T-TTA 26482251-T-TTA 17×TA***
22360966-AAT-CAA 20199080-AAT-CAA DYZ19 ***
13737641-CA-TT 11581965-CA-TT ***
20332069-T-A 18170183-T-A P5_Dst ***
2957323-CT-C 3089282-CT-C 15×T***
59033650-G-T 56887503-G-T ***
59033610-C-A 56887463-C-A ***
58998216-G-A 56852069-G-A ***
58820079-A-C 56770792-T-G ***
17124179-C-T 15012299-C-T ***
17162716-T-A 15050836-T-A ***
13456020-A-ATTCCG 11300344-A-ATTCCG ***
27060104-T-A 24913957-T-A P1_r4 ***
27230122-C-T 25083975-C-T P1_g3 ***
27213079-A-T 25066932-A-T P1_g3 ***
27185920-A-T 25039773-A-T P1_g3 ***
27185312-A-G 25039165-A-G P1_g3 ***
27161850-C-A 25015703-C-A P1_g3 ***
27132193-G-A 24986046-G-A P1_g3 ***
27060112-T-A 24913965-T-A P1_r4 ***
27060094-T-A 24913947-T-A P1_r4 ***
27322037-G-A 25175890-G-A P1_g3 ***
26993030-C-T 24846883-C-T P1_r4 ***
26906479-T-A 24760332-T-A P1_r3 ***
26810319-G-C 24664172-G-C P1_g2 ***
26759661-C-A 24613514-C-A P1_g2 ***
26741218-C-A 24595071-C-A P1_g2 ***
26629850-C-T 24483703-C-T P1_g2 ***
26629607-T-C 24483460-T-C P1_g2 ***
27263806-A-T 25117659-A-T P1_g3 ***
27508232-T-A 25362085-T-A P1_Y2 ***
26629582-A-T 24483435-A-T P1_g2 ***
27861962-A-T 25715815-A-T P1_Y2 ***
28213043-C-A 26066896-C-A P1_b4 ***
28186344-T-C 26040197-T-C P1_b4 ***
28098873-C-T 25952726-C-T P1_Y2 ***
28089822-T-A 25943675-T-A P1_Y2 ***
27971293-T-A 25825146-T-A P1_Y2 ***
27915547-A-T 25769400-A-T P1_Y2 ***
27915521-G-A 25769374-G-A P1_Y2 ***
27843058-A-T 25696911-A-T P1_Y2 ***
27526773-G-C 25380626-G-C P1_Y2 ***
27843023-A-T 25696876-A-T P1_Y2 ***
27824187-C-A 25678040-C-A P1_Y2 ***
27814492-G-A 25668345-G-A P1_Y2 ***
27633329-G-A 25487182-G-A P1_Y2 ***
27586161-A-T 25440014-A-T P1_Y2 ***
27583025-T-G 25436878-T-G P1_Y2 ***
27558330-G-A 25412183-G-A P1_Y2 ***
27549149-T-A 25403002-T-A P1_Y2 ***
26629587-T-A 24483440-T-A P1_g2 ***
26597192-G-T 24451045-G-T P1_g2 ***
28336565-A-G 26190418-A-G P1_b4 ***
25505241-G-T 23359094-G-T P1_gr1 ***
25794361-C-A 23648214-C-A P1_b3 ***
25749438-A-T 23603291-A-T P1_b3 ***
25716822-C-A 23570675-C-A P1_b3 ***
25716812-C-A 23570665-C-A P1_b3 ***
25647646-G-C 23501499-G-C P1_b3 ***
25628489-A-G 23482342-A-G P1_b3 ***
25560225-C-A 23414078-C-A P1_gr1 ***
25303613-A-G 23157466-A-G P2_r1 ***
25966548-A-C 23820401-A-C P1_Y1 ***
25273489-G-T 23127342-G-T P2_r1 ***
25207711-T-C 23061564-T-C P2_r1 ***
25207703-G-A 23061556-G-A P2_r1 ***
25201146-G-A 23054999-G-A g1 ***
25066014-A-G 22919867-A-G g1 ***
25029289-G-T 22883142-G-T g1 ***
25027996-C-A 22881849-C-A g1 ***
25963725-A-T 23817578-A-T P1_Y1 ***
25990771-A-C 23844624-A-C P1_Y1 ***
26571094-C-A 24424947-C-A P1_g2 ***
26369045-G-A 24222898-G-A P1_Y1 ***
26571031-G-A 24424884-G-A P1_g2 ***
26553288-C-T 24407141-C-T P1_g2 ***
26553287-T-C 24407140-T-C P1_g2 ***
26499040-C-T 24352893-C-T P1_Y1 ***
26376348-T-A 24230201-T-A P1_Y1 ***
26376270-C-A 24230123-C-A P1_Y1 ***
26376161-C-A 24230014-C-A P1_Y1 ***
26351734-C-T 24205587-C-T P1_Y1 ***
26055081-A-T 23908934-A-T P1_Y1 ***
26320165-T-C 24174018-T-C P1_Y1 ***
26311038-G-T 24164891-G-T P1_Y1 ***
26310978-A-T 24164831-A-T P1_Y1 ***
26310945-G-T 24164798-G-T P1_Y1 ***
26265363-T-A 24119216-T-A P1_Y1 ***
26135380-C-A 23989233-C-A P1_Y1 ***
26102306-C-A 23956159-C-A P1_Y1 ***
26101278-C-A 23955131-C-A P1_Y1 ***
28246155-C-A 26100008-C-A P1_b4 ***
28336622-T-A 26190475-T-A P1_b4 ***
24862225-T-G 22716078-T-G P3_b2 ***
58980048-A-T 56833901-A-T ***
21346975-T-TTATATATA 19185089-T-TTATATATA 29×TA***
9913042-A-AT 10075433-A-AT 14×T***
4447029-C-CGT 4578988-C-CGT 12×GT***
17914218-G-GTATA 15802338-G-GTATA 15×TA***
13267978-G-CC 11112302-G-CC ***
16365147-G-GATAC 14253267-G-GATAC ***
59033488-C-A 56887341-C-A ***
58980046-C-A 56833899-C-A ***
3174374-CT-C 3306333-CT-C 18×T***
58980043-A-T 56833896-A-T ***
58980029-T-G 56833882-T-G ***
58980016-C-A 56833869-C-A ***
58905895-C-A 56684976-G-T ***
58905894-A-T 56684977-T-A ***
58905871-G-T 56685000-C-A ***
58905833-T-C 56685038-A-G ***
4477725-AT-A 4609684-AT-A 14×T***
6604084-CT-C 6736043-CT-C 17×T***
58905500-G-C 56685371-C-G ***
9327754-GTG-A 9490145-GTG-A ***
13454815-T-TCCATG 11299139-T-TCCATG ***
13267936-CA-TT 11112260-CA-TT ***
13257902-CATCCG-TTTCCA 11102226-CATCCG-TTTCCA ***
13257895-ACAC-GCACT 11102219-ACAC-GCACT ***
13222381-GAGAA-G 11066705-GAGAA-G ***
13222364-GAAGA-G 11066688-GAAGA-G ***
10037317-TG-T 10199708-TG-T 8×G***
8555556-T-TGTTTTG 8687515-T-TGTTTTG ***
2752415-TAAA-T 2884374-TAAA-T 23×A***
6699020-ATT-A 6830979-ATT-A 24×T***
6489371-C-CA 6621330-C-CA 25×A***
6489370-GCAA-G 6621329-GCAA-G ***
5904028-AATC-A 6035987-AATC-A ***
5267536-AT-A 5399495-AT-A 22×T***
5010110-A-AAAAC 5142069-A-AAAAC ***
3970985-CTT-C 4102944-CTT-C 17×T***
3411689-TCAAAAA-T 3543648-TCAAAAA-T ***
58905821-G-C 56685050-C-G ***
58901230-T-G 56689641-A-C ***
28336631-T-G 26190484-T-G P1_b4 ***
58833628-C-T 56757243-G-A ***
58846698-T-C 56744173-A-G ***
58843060-G-A 56747811-C-T ***
58843054-C-T 56747817-G-A ***
58843019-C-T 56747852-G-A ***
58842970-G-C 56747901-C-G ***
58838501-G-T 56752370-C-A ***
58833643-C-T 56757228-G-A ***
58831428-G-T 56759443-C-A ***
58854876-A-G 56735995-T-C ***
58824960-C-A 56765911-G-T ***
28602419-T-C 26456272-T-C ***
28549753-A-G 26403606-A-G ***
28549737-G-T 26403590-G-T ***
28549712-T-G 26403565-T-G ***
28549708-C-G 26403561-C-G ***
28438124-A-G 26291977-A-G P1_gr2 ***
58853794-A-C 56737077-T-G ***
58854877-C-T 56735994-G-A ***
58899971-A-G 56690900-T-C ***
58884467-C-A 56706404-G-T ***
58899857-G-C 56691014-C-G ***
58899828-G-A 56691043-C-T ***
58980039-C-T 56833892-C-T ***
58895802-C-A 56695069-G-T ***
58893485-C-T 56697386-G-A ***
58890243-G-C 56700628-C-G ***
58890210-T-G 56700661-A-C ***
58884460-T-G 56706411-A-C ***
58856285-T-A 56734586-A-T ***
58875954-T-G 56714917-A-C ***
58872422-A-T 56718449-T-A ***
58868407-C-G 56722464-G-C ***
58868369-T-G 56722502-A-C ***
58862633-C-G 56728238-G-C ***
58859102-G-T 56731769-C-A ***
58858734-T-A 56732137-A-T ***
58856299-C-A 56734572-G-T ***
24893851-G-T 22747704-G-T g1 ***
24752818-T-C 22606671-T-C P3_b2 ***
17163047-G-T 15051167-G-T ***
20330932-A-G 18169046-A-G P5_Dst ***
20574971-G-T 18413085-G-T P5_Dst ***
20472666-A-C 18310780-A-C P5_Dst ***
20350443-T-C 18188557-T-C P5_Dst ***
20333779-T-C 18171893-T-C P5_Dst ***
20333776-T-C 18171890-T-C P5_Dst ***
20333761-T-A 18171875-T-A P5_Dst ***
20331772-T-A 18169886-T-A P5_Dst ***
20326617-A-T 18164731-A-T P5_Dst ***
20676523-A-G 18514637-A-G P4_Prx ***
20326160-T-C 18164274-T-C P5_Dst ***
20128680-A-T 18016800-A-T P5_Dst ***
20084976-A-T 17973096-A-T P5_Dst ***
20084936-A-T 17973056-A-T P5_Dst ***
20084916-A-T 17973036-A-T P5_Dst ***
20084826-A-T 17972946-A-T P5_Dst ***
20084825-C-T 17972945-C-T P5_Dst ***
20654802-T-G 18492916-T-G P4_Prx ***
20734158-T-G 18572272-T-G P4_Prx ***
20084668-A-T 17972788-A-T P5_Dst ***
21747717-G-C 19585831-G-C ***
22248386-T-A 20086500-T-A DYZ19 ***
22232455-G-C 20070569-G-C DYZ19 ***
22154372-C-A 19992486-C-A ***
22013834-A-C 19851948-A-C ***
21830009-T-A 19668123-T-A ***
21786881-A-T 19624995-A-T ***
21786873-A-G 19624987-A-G ***
21409215-C-A 19247329-C-A ***
20734224-T-A 18572338-T-A P4_Prx ***
21276967-G-T 19115081-G-T ***
21133448-T-A 18971562-T-A ***
21027314-T-A 18865428-T-A P4_Dst ***
20935780-G-A 18773894-G-A P4_Dst ***
20865073-C-G 18703187-C-G P4_Dst ***
20751491-A-C 18589605-A-C P4_Prx ***
20751304-C-A 18589418-C-A P4_Prx ***
20749318-G-A 18587432-G-A P4_Prx ***
20084766-A-T 17972886-A-T P5_Dst ***
20084656-G-T 17972776-G-T P5_Dst ***
22274082-C-A 20112196-C-A DYZ19 ***
17728320-T-C 15616440-T-C ***
18346139-T-G 16234259-T-G P6_Prx ***
18336999-C-T 16225119-C-T P6_Prx ***
18285628-C-A 16173748-C-A P6_Prx ***
18283169-G-A 16171289-G-A P6_Prx ***
18275881-T-A 16164001-T-A P6_Prx ***
18006986-T-A 15895106-T-A P7_Gap ***
17830451-G-T 15718571-G-T ***
17643373-C-A 15531493-C-A ***
18511141-G-A 16399261-G-A P6_Dst ***
17451023-C-T 15339143-C-T ***
17372733-C-A 15260853-C-A ***
17349265-G-A 15237385-G-A ***
17268699-G-C 15156819-G-C ***
17268569-T-C 15156689-T-C ***
17267030-A-T 15155150-A-T ***
17228036-T-C 15116156-T-C ***
18455336-T-C 16343456-T-C P6_Dst ***
18515772-C-A 16403892-C-A P6_Dst ***
20084617-A-T 17972737-A-T P5_Dst ***
19726191-T-A 17614311-T-A P5_Prx 12×A***
20084582-G-T 17972702-G-T P5_Dst ***
20084577-A-T 17972697-A-T P5_Dst ***
19999806-G-T 17887926-G-T P5_Prx ***
19987543-A-G 17875663-A-G P5_Prx ***
19787835-A-G 17675955-A-G P5_Prx ***
19769633-T-C 17657753-T-C P5_Prx ***
19740963-C-A 17629083-C-A P5_Prx ***
19726166-G-T 17614286-G-T P5_Prx ***
18540071-C-A 16428191-C-A ***
19542003-T-C 17430123-T-C ***
19073325-G-T 16961445-G-T ***
19025025-T-A 16913145-T-A ***
19015828-A-G 16903948-A-G ***
19012964-T-C 16901084-T-C ***
18891227-T-C 16779347-T-C ***
18702016-G-T 16590136-G-T ***
18687595-C-A 16575715-C-A ***
22274052-C-A 20112166-C-A DYZ19 ***
22274109-A-C 20112223-A-C DYZ19 ***
24726274-G-T 22580127-G-T P3_b2 ***
22434879-C-A 20272993-C-A DYZ19 ***
22637570-C-T 20475684-C-T ***
22498029-T-G 20336143-T-G DYZ19 ***
22482840-G-A 20320954-G-A DYZ19 ***
22435027-T-G 20273141-T-G DYZ19 ***
22434995-G-A 20273109-G-A DYZ19 ***
22434994-A-C 20273108-A-C DYZ19 ***
22434896-A-C 20273010-A-C DYZ19 ***
22364507-T-G 20202621-T-G DYZ19 ***
23017923-G-T 20856037-G-T ***
22360076-A-G 20198190-A-G DYZ19 ***
22360034-C-T 20198148-C-T DYZ19 ***
22358695-T-A 20196809-T-A DYZ19 ***
22358586-C-G 20196700-C-G DYZ19 ***
22356785-T-C 20194899-T-C DYZ19 ***
22354998-T-G 20193112-T-G DYZ19 ***
22354973-T-A 20193087-T-A DYZ19 ***
22955007-T-G 20793121-T-G ***
23017980-G-T 20856094-G-T ***
22354954-C-A 20193068-C-A DYZ19 ***
24154373-A-G 22008226-A-G P3_b1 ***
24670653-A-T 22524506-A-T P3_b2 ***
24658704-A-C 22512557-A-C P3_b2 ***
24595484-A-G 22449337-A-G P3_t2 ***
24595460-A-T 22449313-A-T P3_t2 ***
24338842-C-A 22192695-C-A P3_t1 ***
24326395-A-G 22180248-A-G P3_t1 ***
24242783-T-A 22096636-T-A P3_b1 ***
24113337-T-A 21967190-T-A P3_b1 ***
23181437-G-A 21019551-G-A ***
24075082-G-T 21928935-G-T P3_b1 ***
23709018-G-A 21547132-G-A ***
23708990-G-A 21547104-G-A ***
23660910-G-C 21499024-G-C ***
23564214-T-C 21402328-T-C ***
23517652-T-A 21355766-T-A ***
23317946-A-T 21156060-A-T ***
23317884-A-T 21155998-A-T ***
22354972-C-T 20193086-C-T DYZ19 ***
22354953-A-T 20193067-A-T DYZ19 ***
22282143-T-G 20120257-T-G DYZ19 ***
22322267-A-T 20160381-A-T DYZ19 ***
22322342-G-C 20160456-G-C DYZ19 ***
22322334-C-T 20160448-C-T DYZ19 ***
22322324-G-T 20160438-G-T DYZ19 ***
22322323-G-A 20160437-G-A DYZ19 ***
22322317-T-C 20160431-T-C DYZ19 ***
22322313-G-A 20160427-G-A DYZ19 ***
22322306-G-A 20160420-G-A DYZ19 ***
22311299-G-C 20149413-G-C DYZ19 ***
22322357-T-C 20160471-T-C DYZ19 ***
22308020-T-A 20146134-T-A DYZ19 ***
22307976-T-G 20146090-T-G DYZ19 ***
22307957-C-G 20146071-C-G DYZ19 ***
22292191-A-C 20130305-A-C DYZ19 ***
22282266-T-G 20120380-T-G DYZ19 ***
22282239-T-A 20120353-T-A DYZ19 ***
22282238-G-A 20120352-G-A DYZ19 ***
22282223-G-T 20120337-G-T DYZ19 ***
22322351-G-T 20160465-G-T DYZ19 ***
22322374-C-G 20160488-C-G DYZ19 ***
22354914-C-A 20193028-C-A DYZ19 ***
22350949-T-G 20189063-T-G DYZ19 ***
22352977-T-A 20191091-T-A DYZ19 ***
22352974-G-C 20191088-G-C DYZ19 ***
22352941-A-C 20191055-A-C DYZ19 ***
22352148-A-T 20190262-A-T DYZ19 ***
22351423-T-C 20189537-T-C DYZ19 ***
22351399-T-C 20189513-T-C DYZ19 ***
22350956-A-G 20189070-A-G DYZ19 ***
22349319-G-T 20187433-G-T DYZ19 ***
22324646-G-T 20162760-G-T DYZ19 ***
22343134-T-C 20181248-T-C DYZ19 ***
22342873-C-T 20180987-C-T DYZ19 ***
22342849-A-C 20180963-A-C DYZ19 ***
22342661-A-T 20180775-A-T DYZ19 ***
22342658-C-T 20180772-C-T DYZ19 ***
22342592-T-C 20180706-T-C DYZ19 ***
22342540-A-G 20180654-A-G DYZ19 ***
22327593-C-G 20165707-C-G DYZ19 ***
58899768-G-A 56691103-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page