Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > LSC > LSC1 > LSC1a > FGC3216 > FGC3197 > Y82590

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B91977
BigY2
B91977
Manual
Edits
6267716-G-A 6399675-G-A IR3_Dst A*
19888269-G-C 17776389-G-C P5_Prx ***A*
19875050-A-G 17763170-A-G P5_Prx ***A*
28817231-G-C 26671084-G-C A*
26170423-AAAGAAG-A 24024276-AAAGAAG-A P1_Y1 9×AAG+
22095584-A-G 19933698-A-G Y108376 YY++
19220443-C-T 17108563-C-T Y104047 YY++
16850211-A-AT 14738331-A-AT 9×T++
13208441-C-T 11052765-C-T ++
8018418-C-G 8150377-C-G Y85611 YY++
8684020-T-C 8815979-T-C Y87719 YY++
21093670-C-T 18931784-C-T Y16482FGC20766 YY++
20650558-AT-A 18488672-AT-A P4_Prx 17×T+
22255187-A-G 20093301-A-G DYZ19 *
14719606-G-A 12607674-G-A **
14458115-A-G 12337388-A-G **
14361624-A-G 12240919-A-G **
14395153-G-A 12274449-G-A Y33545 **
14413074-C-A 12292371-C-A **
14449906-A-G 12329179-A-G **
14452291-G-T 12331564-G-T **
14468341-C-A 12347610-C-A **
14719599-T-A 12607667-T-A **
14339148-C-A 12218443-C-A **
14499532-G-A 12387737-G-A **
14514336-T-A 12402541-T-A **
14568224-A-T 12456424-A-T **
14570756-A-G 12458956-A-G 22×T**
14669825-C-A 12557891-C-A **
14473022-C-A 12352291-C-A **
15753200-AG-A 13641320-AG-A **
14311742-C-A 12191036-C-A **
14036071-C-T 11915365-C-T **
13894315-C-A 11773609-C-A **
13895965-C-A 11775259-C-A **
13942366-C-A 11821660-C-A **
13975842-G-A 11855136-G-A **
13999286-A-T 11878580-A-T **
14011322-G-T 11890616-G-T **
14055448-C-A 11934742-C-A **
14273455-C-T 12152749-C-T **
14143412-G-GAAA 12022706-G-GAAA 12×A**
14152273-A-T 12031567-A-T **
14160292-G-T 12039586-G-T **
14176271-A-T 12055565-A-T **
14203424-C-T 12082718-C-T **
14203428-C-A 12082722-C-A **
14300539-C-A 12179833-C-A **
15843052-C-A 13731172-C-A **
15866151-T-A 13754271-T-A **
15218663-C-A 13106749-C-A **
15049917-T-C 12938008-T-C **
15073285-C-A 12961375-C-A **
15189722-A-G 13077808-A-G **
15201383-A-T 13089469-A-T **
15210925-G-T 13099011-G-T **
15212385-T-C 13100471-T-C **
15264739-G-T 13152828-G-T BY29925 **
15049902-G-A 12937993-G-A **
15320601-G-A 13208707-G-A **
15386655-T-C 13274775-T-C **
15398397-T-C 13286517-T-C **
15431999-A-G 13320119-A-G **
15595149-G-A 13483269-G-A **
15600104-C-T 13488224-C-T **
15632004-C-A 13520124-C-A **
15049915-T-A 12938006-T-A **
15049886-C-A 12937977-C-A **
15729035-C-A 13617155-C-A **
14764913-A-T 12652982-A-T **
15842976-A-T 13731096-A-T **
14719609-T-A 12607677-T-A **
15789587-C-A 13677707-C-A **
13874112-T-G 11753406-T-G **
15769469-C-A 13657589-C-A **
14742010-G-T 12630078-G-T **
14764995-G-A 12653064-G-A **
14985994-C-A 12874062-C-A **
14769204-C-A 12657273-C-A **
14776921-T-A 12664990-T-A **
14858826-C-A 12746892-C-A **
14887999-C-A 12776065-C-A **
14908485-C-A 12796552-C-A **
15758736-C-A 13646856-C-A **
14910911-G-A 12798978-G-A **
13884960-C-A 11764254-C-A **
13597092-T-C 11441416-T-C **
11672007-AGGAATGGAGTTGAAAG-A **
10993202-G-C **
10959561-C-A **
10969863-C-A **
10979492-C-T **
10986453-C-A **
10988807-C-A **
10993201-A-G **
10993205-T-C **
10955380-C-A **
10993214-A-ACTCTG **
10993230-C-T **
10994206-A-T **
10994218-T-A **
10994230-C-CAATCA **
10994267-T-A **
10959454-C-A **
10950862-G-T **
10998208-T-C **
10909782-G-A **
10906272-T-TGGA **
10906273-CTGT-C **
10906295-T-A **
10906297-G-C **
10906306-A-G **
10909778-A-G **
10917154-T-A **
10948501-G-C **
10917174-C-A **
10923946-T-C **
10927016-T-A **
10942908-A-C **
10948297-TTTCCA-T **
10948459-C-T **
10948468-A-T **
10994302-C-T **
10998230-T-C **
11663071-T-G **
13577983-T-C 11422307-T-C **
13299209-C-A 11143533-C-A **
13349590-G-GA 11193914-G-GA 9×A**
13435698-T-C 11280022-T-C **
13465617-T-C 11309941-T-C **
13480645-G-A 11324969-G-A **
13492805-C-A 11337129-C-A **
13597021-T-C 11441345-T-C **
13255219-T-G 11099543-T-G **
13597022-CT-C 11441346-CT-C **
15971222-G-A 13859342-G-A **
13698512-A-G 11542836-A-G **
11643399-G-A **
11649211-A-G **
11653295-T-C **
13280072-C-A 11124396-C-A **
13218748-T-G 11063072-T-G **
10998252-A-C **
11016434-C-T **
10998262-A-C **
10998270-A-C **
10998283-T-C **
11004754-A-C **
11004758-G-C **
11004759-A-C **
11019358-C-A **
11033823-C-A **
11025949-A-T **
11032183-A-G **
11032203-A-G **
11032208-A-ATTCCT **
11032232-G-C **
11032235-A-T **
11032242-C-A **
15937136-A-G 13825256-A-G **
16119969-T-TTCTTTCTA 14008089-T-TTCTTTCTA P8_Prx **
15986635-G-T 13874755-G-T **
23049762-A-T 20887876-A-T **
22775344-C-A 20613458-C-A **
22801867-A-G 20639981-A-G **
22839001-T-C 20677115-T-C **
23036056-T-C 20874170-T-C **
23047531-A-C 20885645-A-C **
23049756-A-T 20887870-A-T **
23255310-C-A 21093424-C-A **
22424002-C-A 20262116-C-A DYZ19 **
23345956-A-C 21184070-A-C **
23442666-C-A 21280780-C-A **
23789372-C-A 21627486-C-A **
23832831-C-A 21670945-C-A **
24247415-ACAC-A 22101268-ACAC-A P3_b1 **
24432709-G-A 22286562-G-A **
22542792-C-T 20380906-C-T **
22317939-G-C 20156053-G-C DYZ19 **
25533617-G-T 23387470-G-T P1_gr1 **
21969471-A-G 19807585-A-G **
21241802-C-A 19079916-C-A **
21455858-C-A 19293972-C-A **
21491229-G-T 19329343-G-T **
21847993-T-G 19686107-T-G **
21848200-T-G 19686314-T-G **
21912027-T-C 19750141-T-C **
22028786-C-A 19866900-C-A **
22317929-A-AGC 20156043-A-AGC DYZ19 **
22093073-A-G 19931187-A-G **
22132793-C-A 19970907-C-A **
22134176-G-T 19972290-G-T **
22167938-G-T 20006052-G-T **
22240955-C-A 20079069-C-A DYZ19 **
22277837-T-C 20115951-T-C DYZ19 **
22284576-T-C 20122690-T-C DYZ19 **
24432827-G-A 22286680-G-A **
25533621-G-T 23387474-G-T P1_gr1 **
21146307-C-A 18984421-C-A **
28763789-G-A 26617642-G-A **
28620582-G-A 26474435-G-A **
28620587-C-A 26474440-C-A **
28624554-C-A 26478407-C-A **
28691447-CAA-C 26545300-CAA-C 16×A**
28730423-G-T 26584276-G-T **
28734771-C-A 26588624-C-A **
28764965-C-A 26618818-C-A **
28609099-T-A 26462952-T-A **
28773028-G-A 26626881-G-A **
28776695-T-C 26630548-T-C **
28800774-G-A 26654627-G-A **
56844531-G-A **
56849808-T-G **
27432-C-A **
28617604-C-A 26471457-C-A **
28591269-G-T 26445122-G-T 11×T**
25881897-C-A 23735750-C-A P1_Y1 **
26236655-A-AG 24090508-A-AG P1_Y1 **
25934942-A-AT 23788795-A-AT P1_Y1 **
25985389-T-TA 23839242-T-TA P1_Y1 **
26014748-T-TA 23868601-T-TA P1_Y1 **
26060194-A-AC 23914047-A-AC P1_Y1 **
26098023-AGAGAG-A 23951876-AGAGAG-A P1_Y1 **
26199601-AT-A 24053454-AT-A P1_Y1 **
26285982-G-T 24139835-G-T P1_Y1 **
28542416-CAAAAAA-C 26396269-CAAAAAA-C 17×A**
26326171-G-A 24180024-G-A P1_Y1 **
27647633-AG-A 25501486-AG-A P1_Y2 **
27791980-GCTTCTT-G 25645833-GCTTCTT-G P1_Y2 9×CTT**
27808425-C-A 25662278-C-A P1_Y2 **
27844541-T-TA 25698394-T-TA P1_Y2 **
28500128-G-C 26353981-G-C **
28537052-G-A 26390905-G-A **
21146309-C-A 18984423-C-A **
20825162-A-C 18663276-A-C P4_Gap **
16052279-T-C 13940399-T-C **
17053230-G-T 14941350-G-T **
16590816-G-A 14478936-G-A **
16607803-AAAAC-A 14495923-AAAAC-A 5×AAAC**
16645864-C-A 14533984-C-A **
16712985-CTT-C 14601105-CTT-C 11×T**
16779181-C-A 14667301-C-A **
16813990-C-A 14702110-C-A **
17063758-C-A 14951878-C-A **
16501608-CT-C 14389728-CT-C **
17188261-C-A 15076381-C-A **
17315332-T-C 15203452-T-C **
17317685-G-A 15205805-G-A **
17342934-A-T 15231054-A-T **
17349409-A-AG 15237529-A-AG **
17527242-C-A 15415362-C-A **
16588237-C-T 14476357-C-T **
16430466-C-A 14318586-C-A **
17634658-C-A 15522778-C-A **
16120022-TA-T 14008142-TA-T P8_Prx **
16052295-T-C 13940415-T-C **
16052321-G-C 13940441-G-C **
16052368-G-T 13940488-G-T **
16054216-CT-C 13942336-CT-C **
16073163-A-C 13961283-A-C **
10906255-G-A **
16146479-A-AAAAGAGAG 14034599-A-AAAAGAGAG P8_Dst 12×AAAG**
16429838-G-T 14317958-G-T **
16176591-C-A 14064711-C-A **
16228029-G-A 14116149-G-A **
16305911-C-G 14194031-C-G **
16320449-T-C 14208569-T-C **
16344724-T-G 14232844-T-G **
16428943-T-G 14317063-T-G **
16428945-A-G 14317065-A-G **
17597879-C-A 15485999-C-A **
17739827-C-T 15627947-C-T **
20802741-C-A 18640855-C-A P4_Gap **
20570183-G-A 18408297-G-A P5_Dst **
19438316-GAGGA-G 17326436-GAGGA-G **
19537933-AG-A 17426053-AG-A **
19544166-T-C 17432286-T-C **
19677906-C-CT 17566026-C-CT P5_Prx **
19794094-A-AT 17682214-A-AT P5_Prx **
20019186-T-A 17907306-T-A P5_Prx **
20617712-C-G 18455826-C-G P4_Prx **
19293768-CTC-T 17181888-CTC-T **
20617738-A-AG 18455852-A-AG P4_Prx **
20762234-A-G 18600348-A-G P4_Prx **
20762286-G-T 18600400-G-T P4_Prx **
20762312-G-A 18600426-G-A P4_Prx **
20793457-T-TACGA 18631571-T-TACGA P4_Prx **
20793460-A-ATG 18631574-A-ATG P4_Prx **
20793479-C-T 18631593-C-T P4_Prx **
19382842-A-T 17270962-A-T **
19272142-CAAAAAA-C 17160262-CAAAAAA-C 18×A**
17915959-C-A 15804079-C-A **
18504835-G-T 16392955-G-T P6_Dst **
17956007-C-A 15844127-C-A Y136815 **
18050629-C-A 15938749-C-A **
18190276-C-A 16078396-C-A **
18192459-A-T 16080579-A-T **
18487809-A-AC 16375929-A-AC P6_Dst **
18504821-G-T 16392941-G-T P6_Dst **
18580483-C-A 16468603-C-A **
19216454-C-A 17104574-C-A **
18682481-A-G 16570601-A-G **
18682687-C-A 16570807-C-A **
18792716-T-A 16680836-T-A **
18814876-G-T 16702996-G-T **
18931990-T-C 16820110-T-C **
18959196-C-A 16847316-C-A **
19052442-AG-A 16940562-AG-A **
10906271-C-T **
10909781-C-G **
27443-T-C **
5587292-C-CT 5719251-C-CT **
6593497-C-A 6725456-C-A **
6582494-C-A 6714453-C-A **
6444846-A-T 6576805-A-T **
6221891-T-A 6353850-T-A IR3_Dst **
6123454-T-C 6255413-T-C **
6090283-T-C 6222242-T-C **
5989040-A-AT 6120999-A-AT 12×T**
5844569-C-A 5976528-C-A **
5828900-G-T 5960859-G-T **
5815593-TC-T 5947552-TC-T **
5720681-G-A 5852640-G-A **
5698755-T-C 5830714-T-C **
5627553-T-C 5759512-T-C **
5587297-G-A 5719256-G-A **
5587289-T-C 5719248-T-C **
6694217-C-A 6826176-C-A **
5170436-T-G 5302395-T-G **
4959904-A-G 5091863-A-G **
4961547-A-C 5093506-A-C **
4969310-C-A 5101269-C-A **
4976766-C-G 5108725-C-G **
4976769-C-A 5108728-C-A **
4976780-T-C 5108739-T-C **
5171610-G-A 5303569-G-A **
5587284-A-C 5719243-A-C **
5220506-C-A 5352465-C-A **
5228565-CA-C 5360524-CA-C 8×A**
5318425-C-A 5450384-C-A **
5426309-C-A 5558268-C-A **
5587273-A-G 5719232-A-G **
5587283-C-T 5719242-C-T **
6665432-T-C 6797391-T-C **
6769936-C-A 6901895-C-A **
4557640-C-A 4689599-C-A **
7162269-G-C 7294228-G-C **
7464019-C-A 7595978-C-A IR1_L **
7437479-G-A 7569438-G-A **
7422222-C-A 7554181-C-A **
7314549-T-A 7446508-T-A **
7282408-C-A 7414367-C-A **
7257849-C-A 7389808-C-A **
7257366-C-A 7389325-C-A **
7242081-C-A 7374040-C-A **
7237273-A-C 7369232-A-C **
7237247-A-C 7369206-A-C **
7224169-C-A 7356128-C-A **
7211313-T-A 7343272-T-A **
7202213-G-A 7334172-G-A **
7180093-T-C 7312052-T-C **
7159133-C-A 7291092-C-A **
6816544-C-A 6948503-C-A **
7088453-G-A 7220412-G-A **
6816545-T-C 6948504-T-C **
6929185-G-T 7061144-G-T **
6978445-C-A 7110404-C-A **
7011537-C-T 7143496-C-T **
7038535-C-A 7170494-C-A **
7082696-C-T 7214655-C-T **
7102538-C-A 7234497-C-A **
7157123-G-C 7289082-G-C **
7107325-C-A 7239284-C-A **
7109386-G-C 7241345-G-C **
7134237-T-C 7266196-T-C **
7135218-C-A 7267177-C-A **
7155352-C-A 7287311-C-A **
7156759-C-A 7288718-C-A **
4920105-C-A 5052064-C-A **
4538493-C-A 4670452-C-A **
7464034-T-A 7595993-T-A IR1_L **
5241254-G-T 5373213-G-T **
10894468-C-T **
10894460-CCTCTG-C **
10894458-C-T **
10894455-T-C **
10691451-A-C **
11016437-T-C **
14055523-C-A 11934817-C-A **
15049892-T-G 12937983-T-G **
20404497-T-A 18242611-T-A P5_Dst **
20459152-G-T 18297266-G-T P5_Dst **
27232179-C-CTTTCT 25086032-C-CTTTCT P1_g3 **
4015740-C-CT 4147699-C-CT 14×T**
17006493-G-GT 14894613-G-GT 10×T**
18454815-C-CT 16342935-C-CT P6_Dst 10×TTCT**
18008710-C-T 15896830-C-T P7_Dst **
2651905-TG-T 2783864-TG-T **
18959213-T-C 16847333-T-C **
16784428-GA-G 14672548-GA-G 10×A**
18008709-A-T 15896829-A-T P7_Dst **
4450487-C-T 4582446-C-T **
5558718-A-T 5690677-A-T Y1946 FGC1594 **
6091206-T-C 6223165-T-C **
6523684-CAT-C 6655643-CAT-C **
5169386-C-A 5301345-C-A **
58994973-G-T 56848826-G-T **
6091118-C-T 6223077-C-T **
6091140-T-C 6223099-T-C **
6091221-T-A 6223180-T-A **
14213862-GGAAA-G 12093156-GGAAA-G **
15655037-C-A 13543157-C-A **
17946965-G-C 15835085-G-C **
4976786-TC-T 5108745-TC-T **
2682819-C-A 2814778-C-A **
4450468-C-CT 4582427-C-CT 9×T**
4178038-C-A 4309997-C-A **
3728456-G-A 3860415-G-A **
3732657-C-A 3864616-C-A **
3797444-C-G 3929403-C-G **
3849411-C-A 3981370-C-A **
4003154-C-A 4135113-C-A **
4168842-G-T 4300801-G-T **
4178993-T-A 4310952-T-A **
3688986-A-G 3820945-A-G **
4292954-A-C 4424913-A-C **
4301982-C-A 4433941-C-A **
4302375-C-T 4434334-C-T **
4326427-AT-A 4458386-AT-A **
4353881-C-A 4485840-C-A **
4374893-C-A 4506852-C-A **
3706647-T-C 3838606-T-C **
3686540-G-T 3818499-G-T **
2684073-C-A 2816032-C-A **
3274216-C-T 3406175-C-T **
2740358-C-T 2872317-C-T **
2791296-A-T 2923255-A-T **
2885754-C-A 3017713-C-A **
2970428-C-A 3102387-C-A **
3046474-C-A 3178433-C-A **
3123227-C-A 3255186-C-A **
3274221-A-G 3406180-A-G **
3640495-C-T 3772454-C-T **
3420692-C-G 3552651-C-G **
3500579-C-A 3632538-C-A **
3500600-C-A 3632559-C-A **
3508383-G-T 3640342-G-T **
3594214-A-G 3726173-A-G **
3627430-A-G 3759389-A-G **
7464024-C-A 7595983-C-A IR1_L **
7157052-T-A 7289011-T-A **
7541502-C-A 7673461-C-A **
10796132-C-T **
10798921-C-T **
10798824-C-T **
10796268-A-T **
10796267-C-A **
10796242-C-A **
10796241-C-T **
10796228-G-A **
10796223-G-T **
10796200-T-TC **
10796197-C-CATTTA **
10796171-CCGT-C **
10796162-CGTTCCGT-C **
10796156-C-G **
10796137-C-A **
7621372-TA-T 7753331-TA-T **
10799609-C-G **
10776156-A-T **
10770914-T-C **
10770931-G-C **
10770939-A-C **
10775695-T-C **
10775704-A-G **
10776131-G-TTCCT **
10776192-C-T **
10780510-C-T **
10776202-CTCCAT-C **
10776227-C-T **
10776951-C-A **
10777143-T-C **
10777976-C-T **
10779299-A-G **
10799608-T-A **
10799617-C-G **
10769664-G-C **
10839918-A-C **
10883495-C-A **
10869984-T-TTCTGG **
10869983-A-G **
10869967-C-A **
10869959-T-C **
10869947-C-T **
10864059-T-C **
10861583-C-A **
10857933-C-A **
10851702-TCATTC-T **
10846571-G-C **
10842601-A-C **
10840232-C-A **
10839922-CATTCT-C **
10839909-TTG-T **
10799630-C-T **
10817926-G-A **
10799635-C-T **
10799649-A-T **
10804758-A-C **
10806335-C-A **
10810747-A-C **
10815293-A-C **
10817940-C-CACTCT **
10839903-ACTC-A **
10817956-A-C **
10817960-T-C **
10817961-A-C **
10818584-C-A **
10820365-G-T **
10820388-C-G **
10770896-A-C **
10794190-T-A **
10769648-G-T **
10023674-C-A 10186065-C-A **
10671820-T-C **
10668611-C-T **
10663232-A-C **
7866781-TGTC-T 7998740-TGTC-T **
8091282-G-T 8223241-G-T **
10652856-A-G **
10652208-A-T **
8290701-C-A 8422660-C-A **
8321656-A-G 8453615-A-G **
10627781-C-A **
10050853-C-A 10213244-C-A **
9979148-C-A 10141539-C-A **
10678712-G-T **
9971569-C-A 10133960-C-A **
9967242-C-A 10129633-C-A **
9950363-G-T 10112754-G-T **
8720544-C-A 8852503-C-A **
9943481-A-G 10105872-A-G **
8730961-T-A 8862920-T-A **
8749066-C-A 8881025-C-A **
9942192-G-T 10104583-G-T **
8850486-C-A 8982445-C-A **
9482260-C-A 9644651-C-A **
9034372-T-TA 9196763-T-TA 11×A**
9077347-T-G 9239738-T-G **
10673210-C-A **
10662072-G-T **
10683445-C-A **
10745124-C-A **
10768657-C-T **
10768421-G-T **
10767801-A-C **
10767764-T-C **
10767763-T-C **
10767762-G-A **
10765375-T-C **
10764153-GTTCCA-G **
10761183-C-T **
10761165-C-A **
10750399-A-G **
9383506-G-A 9545897-G-A **
10744695-A-C **
10685887-C-A **
15045722-C-A 12933812-C-A ***
7255997-G-T 7387956-G-T ***
7811508-A-G 7943467-A-G DC96Z1370 ***
18196521-G-T 16084641-G-T ***
22503002-C-G 20341116-C-G DYZ19 ***
15938078-CAT-C 13826198-CAT-C ***
9218522-TTGTGTGTG-T 9380913-TTGTGTGTG-T 12×TG***
7664291-C-A 7796250-C-A ***
25134627-T-C 22988480-T-C BY28190 g1 ***
14875621-GA-G 12763691-GA-G ***
18149562-A-AATAG 16037682-A-AATAG 7×ATAG***
25134616-G-C 22988469-G-C BY28189 g1 ***
20434723-C-A 18272837-C-A P5_Dst ***
10892561-T-C ***
10936776-G-T ***
13459278-T-C 11303602-T-C ***
10851005-C-A ***
7811532-C-T 7943491-C-T Z12229 ***
56835413-C-A ***
56825909-CCATTCCAATC-C,CCATTCCAGTG ***
25134610-G-A 22988463-G-A BY28186 g1 ***
25134613-C-T 22988466-C-T BY28187 g1 ***
10892544-A-ATTCGGGTTGTTTGCT ***
25134615-G-C 22988468-G-C BY28188 g1 ***
13832302-A-G 11711596-A-G ***
8274069-C-A 8406028-C-A ***
19113763-C-T 17001883-C-T ***
7359830-A-G 7491789-A-G ***
28798928-C-A 26652781-C-A ***
7311543-T-C 7443502-T-C ***
13481943-G-A 11326267-G-A ***
13446606-A-AC 11290930-A-AC ***
23656776-T-C 21494890-T-C ***
5937226-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA 6069185-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA ***
10660894-C-CCATTCCATTCCACTA ***
21555222-C-T 19393336-C-T ***
21464771-GTTCTTC-G,GTTC 19302885-GTTCTTC-G,GTTC 16×TTC***
21456074-T-C 19294188-T-C ***
10669417-T-TA ***
6523677-G-A 6655636-G-A ***
10685596-G-T ***
16938218-CTTT-C,CTT 14826338-CTTT-C,CTT 19×T***
13219025-C-A 11063349-C-A ***
21905326-T-C 19743440-T-C ***
10747023-C-CAGGTTA ***
13488712-C-CATG 11333036-C-CATG ***
13488713-GCCA-G 11333037-GCCA-G ***
4616749-C-A 4748708-C-A ***
13940928-A-G 11820222-A-G ***
19113759-T-G 17001879-T-G ***
4957988-CT-C 5089947-CT-C ***
13725050-T-C 11569374-T-C ***
14432390-C-A 12311663-C-A ***
21946945-ATT-A,AT 19785059-ATT-A,AT 15×T***
24105803-G-A 21959656-G-A P3_b1 ***
22965169-G-T 20803283-G-T ***
25052749-C-G 22906602-C-G g1 ***
25131712-C-T 22985565-C-T g1 ***
22580054-A-T 20418168-A-T ***
7166637-TATA-T,TATT 7298596-TATA-T,TATT ***
9771906-G-T 9934297-G-T ***
10985079-T-C ***
10986736-C-A ***
22974116-CAAAAAA-C 20812230-CAAAAAA-C 24×A***
10898275-C-A ***
10652618-C-A ***
22809997-C-A 20648111-C-A ***
11648583-G-T ***
13446608-CT-C 11290932-CT-C ***
14704286-ATATAT-A 12592352-ATATAT-A 4×TATAT***
10747022-C-G ***
22255186-C-A 20093300-C-A DYZ19 ***
16188181-CTTTT-C,CTT 14076301-CTTTT-C,CTT 16×T***
16226397-T-A 14114517-T-A ***
10896333-C-CCTTCA ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page