Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > Z21065 > A195 > A761 > Z16254 > A154 > LLB17142

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
N45540
BigY2
N45540
26033338-A-G 23887191-A-G P1_Y1 ***A*
13694962-G-A 11539286-G-A A*
28817224-G-C 26671077-G-C A*
19793412-T-C 17681532-T-C P5_Prx ***A*
6860075-C-G 6992034-C-G L1312 YY++
23148572-A-C 20986686-A-C YY++
18585796-CAAAAT-C 16473916-CAAAAT-C 8×AAAAT++
7584701-C-T 7716660-C-T YY++
16713767-C-A 14601887-C-A YY++
14200095-C-T 12079389-C-T YY++
14200137-G-T 12079431-G-T YY++
23476015-T-G 21314129-T-G FGC8075 YY+
8100215-CT-C 8232174-CT-C 11×T*
8387571-A-AAGAAGG 8519530-A-AAGAAGG 10×AGAAGG*
10753567-T-A **
13858445-C-A 11737739-C-A **
8988654-G-T 9151045-G-T **
3853453-G-T 3985412-G-T **
19936156-C-A 17824276-C-A P5_Prx **
14022923-C-A 11902217-C-A **
7186748-C-A 7318707-C-A **
15475174-C-A 13363294-C-A **
14568151-T-G 12456351-T-G **
14580975-C-A 12469175-C-A **
28744215-CA-C 26598068-CA-C 12×A**
6626773-C-A 6758732-C-A **
13881432-C-A 11760726-C-A **
16245340-C-A 14133460-C-A **
14518589-C-A 12406790-C-A **
13143784-GCACTGCACAT-C 10633270-GCACTGCACAT-C **
10805133-C-A **
21515689-C-T 19353803-C-T **
14649495-G-C 12537560-G-C **
4447602-G-A 4579561-G-A **
27467354-G-T 25321207-G-T P1_Y2 **
7131176-C-A 7263135-C-A **
14630503-A-C 12518572-A-C **
14387817-C-A 12267113-C-A **
14712514-G-T 12600581-G-T **
7043356-A-G 7175315-A-G **
11648969-A-G **
14561880-C-A 12450081-C-A **
2785242-C-A 2917201-C-A **
4129766-C-A 4261725-C-A **
2730000-C-A 2861959-C-A **
14387819-C-A 12267115-C-A **
4087781-C-A 4219740-C-A **
3877014-C-A 4008973-C-A **
3923933-G-T 4055892-G-T **
3960956-G-T 4092915-G-T **
3969846-C-A 4101805-C-A **
4061965-C-A 4193924-C-A **
4087746-C-A 4219705-C-A **
4114714-G-T 4246673-G-T **
3853539-A-G 3985498-A-G **
4245019-G-T 4376978-G-T **
4278760-C-T 4410719-C-T **
4278761-C-T 4410720-C-T **
4278776-A-T 4410735-A-T **
4320732-G-T 4452691-G-T **
4357883-A-G 4489842-A-G **
4408347-A-T 4540306-A-T **
3853584-T-G 3985543-T-G **
3821091-C-A 3953050-C-A **
9943486-C-A 10105877-C-A **
3051314-C-T 3183273-C-T **
16712997-G-T 14601117-G-T **
13885912-A-C 11765206-A-C **
2684074-A-T 2816033-A-T **
2814789-A-T 2946748-A-T **
2817195-T-G 2949154-T-G **
2984757-G-T 3116716-G-T Y60505 **
2984783-G-T 3116742-G-T **
3086533-C-A 3218492-C-A **
3749356-G-T 3881315-G-T **
3086536-C-A 3218495-C-A **
3115967-A-C 3247926-A-C **
3267129-T-G 3399088-T-G **
3491644-G-T 3623603-G-T **
3576477-G-A 3708436-G-A **
3591258-A-T 3723217-A-T **
3638659-G-T 3770618-G-T **
10923591-C-T **
10658905-A-T **
10796131-C-G **
10924347-C-A **
17802111-C-A 15690231-C-A **
2839956-C-A 2971915-C-A **
21584488-G-A 19422602-G-A Y106958 **
3092614-C-A 3224573-C-A **
13606347-C-A 11450671-C-A **
2767775-C-A 2899734-C-A **
16341115-C-A 14229235-C-A **
15791141-A-C 13679261-A-C **
15201379-A-G 13089465-A-G **
14795105-G-TTT 12683176-G-TTT **
18966147-C-A 16854267-C-A **
10900844-C-T **
10829276-G-C **
10829282-C-T **
10829284-T-A **
6748703-CT-C 6880662-CT-C **
15060397-C-A 12948489-C-A **
14512076-C-A 12400281-C-A **
9966067-C-A 10128458-C-A **
2745986-C-A 2877945-C-A **
10791140-G-C **
10963676-C-T **
10963681-T-C **
10822154-C-T **
2855464-C-T 2987423-C-T Y23320 **
18159168-C-A 16047288-C-A **
13303434-C-A 11147758-C-A **
15220979-A-C 13109065-A-C **
28568018-A-G 26421871-A-G **
17034888-C-A 14923008-C-A **
14630529-C-A 12518598-C-A **
10878270-A-G **
21515719-C-T 19353833-C-T **
21515744-T-C 19353858-T-C **
21515778-A-G 19353892-A-G Z38170 **
4241887-C-A 4373846-C-A **
7371819-G-T 7503778-G-T **
13463925-G-T 11308249-G-T **
15221329-C-A 13109415-C-A **
23342057-G-T 21180171-G-T **
13236313-C-A 11080637-C-A **
4460721-C-A 4592680-C-A **
6130179-C-A 6262138-C-A **
14735301-A-G 12623369-A-G **
5458539-C-A 5590498-C-A **
13235462-C-A 11079786-C-A **
21912210-C-A 19750324-C-A **
10767716-C-A **
17946946-G-A 15835066-G-A **
14671587-G-A 12559653-G-A **
15379272-CT-C 13267392-CT-C 9×T**
3853485-T-G 3985444-T-G **
21515755-T-G 19353869-T-G **
2985943-C-A 3117902-C-A **
28555494-C-A 26409347-C-A **
4467218-A-T 4599177-A-T **
23954046-C-A 21807899-C-A **
16921270-G-T 14809390-G-T **
21515811-C-A 19353925-C-A **
10829280-T-C **
4778226-T-A 4910185-T-A **
14099972-C-A 11979266-C-A **
10938119-C-A **
14765254-C-A 12653323-C-A **
23779682-TA-T 21617796-TA-T **
23779685-A-G 21617799-A-G **
18688519-AAC-A 16576639-AAC-A **
10860509-G-T **
7063775-C-A 7195734-C-A **
22739543-C-A 20577657-C-A **
28369949-G-T 26223802-G-T P1_gr2 **
15432796-C-A 13320916-C-A **
21153954-C-A 18992068-C-A **
14073544-C-A 11952838-C-A **
16184336-C-A 14072456-C-A **
3638582-AT-A 3770541-AT-A 11×T**
4440999-C-A 4572958-C-A **
4801668-G-A 4933627-G-A **
4469864-C-A 4601823-C-A **
10894652-A-C **
10836770-C-A **
10865424-T-G **
14195261-A-C 12074555-A-C **
14149240-A-G 12028534-A-G **
10872559-T-C **
14109415-C-G 11988709-C-G **
10896288-C-G **
10818794-T-G **
10902210-T-C **
14052014-C-A 11931308-C-A **
10948168-C-A **
10948438-T-A **
10954740-C-A **
10958470-T-C **
10959439-C-A **
10822140-A-C **
10808047-A-C **
14029444-A-C 11908738-A-C **
10753544-C-G **
10658121-C-A **
10672903-T-C **
14279912-C-A 12159206-C-A **
10747877-T-C **
10753526-C-G **
10753543-C-T **
10753554-C-G **
10804672-C-A **
10753564-C-T **
10753568-C-A **
10753583-C-T **
10764894-T-C **
10764940-T-C **
10769573-T-A **
10781683-T-C **
10963332-C-A **
10993902-T-C **
10050789-C-A 10213180-C-A **
11648965-A-C **
13722289-G-A 11566613-G-A **
13963824-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 11843118-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 49×T**
11648945-G-T **
11648955-G-A **
11648958-T-A **
11648964-A-G **
11648967-A-C **
13558294-C-A 11402618-C-A **
11648983-G-T **
11655326-A-C **
11671572-A-T **
11677580-C-A **
13809239-G-T 11688533-G-T **
13886053-G-T 11765347-G-T **
13928203-T-C 11807497-T-C **
13576362-C-A 11420686-C-A **
13512362-C-A 11356686-C-A **
10994366-C-A **
13214004-C-A 11058328-C-A **
14021487-C-A 11900781-C-A **
11015865-C-A **
11020901-G-T **
14009315-C-A 11888609-C-A **
11033156-TC-T **
11033177-C-T **
13216536-C-A 11060860-C-A **
13490368-C-A 11334692-C-A **
13216544-A-C 11060868-A-C **
13233246-A-G 11077570-A-G **
13250119-G-A 11094443-G-A **
13313850-G-A 11158174-G-A **
13460232-T-G 11304556-T-G **
13460835-A-G 11305159-A-G **
13974829-A-G 11854123-A-G **
10654549-C-A **
10018013-C-A 10180404-C-A **
4469871-C-A 4601830-C-A **
6179492-T-C 6311451-T-C IR3_Dst **
5689200-C-A 5821159-C-A **
5761443-C-A 5893402-C-A **
5858503-C-A 5990462-C-A **
5948882-T-A 6080841-T-A **
5948884-T-A 6080843-T-A **
5948886-T-A 6080845-T-A **
6401667-T-C 6533626-T-C **
5265028-C-A 5396987-C-A **
6492580-G-T 6624539-G-T **
6493934-C-A 6625893-C-A **
6494036-T-A 6625995-T-A **
6732641-C-A 6864600-C-A **
6756077-C-A 6888036-C-A **
14457049-C-A 12336322-C-A **
6806834-C-A 6938793-C-A **
5631190-G-T 5763149-G-T **
5242094-T-A 5374053-T-A **
6998118-C-A 7130077-C-A **
4889405-T-A 5021364-T-A **
4530237-G-A 4662196-G-A **
4582391-T-A 4714350-T-A **
4778212-C-A 4910171-C-A **
4778221-C-T 4910180-C-T **
27596084-C-A 25449937-C-A P1_Y2 **
4805126-C-A 4937085-C-A **
4925425-C-A 5057384-C-A **
14513977-G-A 12402182-G-A YP5780 **
4926127-A-G 5058086-A-G **
4943350-G-T 5075309-G-T **
4948870-C-A 5080829-C-A **
5017652-T-C 5149611-T-C **
5061186-G-T 5193145-G-T **
5140678-A-C 5272637-A-C **
5187117-C-T 5319076-C-T **
6882416-C-A 7014375-C-A **
7039910-G-T 7171869-G-T **
14283470-C-T 12162764-C-T **
8217983-T-G 8349942-T-G **
7897173-C-T 8029132-C-T **
7990824-A-G 8122783-A-G **
8140309-A-G 8272268-A-G **
8181309-C-T 8313268-C-T **
8181335-A-G 8313294-A-G **
8181348-AC-A 8313307-AC-A **
8230501-C-T 8362460-C-T **
7860209-T-C 7992168-T-C **
14427438-C-G 12306713-C-G **
8816990-T-C 8948949-T-C **
8911678-G-T 9043637-G-T **
9110865-G-T **
9047648-T-C 9210039-T-C **
9063235-A-G 9225626-A-G **
9799457-AACATGC-A 9961848-AACATGC-A **
7860426-C-T 7992385-C-T **
7829546-T-C 7961505-T-C **
14427461-A-T 12306736-A-T **
7286780-T-C 7418739-T-C **
7102150-G-T 7234109-G-T **
7186304-C-A 7318263-C-A **
7200502-A-C 7332461-A-C **
7235937-C-A 7367896-C-A **
7254378-C-A 7386337-C-A **
7254740-G-T 7386699-G-T **
7270005-T-G 7401964-T-G **
7320555-T-G 7452514-T-G **
7774156-C-A 7906115-C-A **
7369557-G-T 7501516-G-T **
7371122-G-T 7503081-G-T **
7432347-A-T 7564306-A-T **
7434923-C-A 7566882-C-A **
7475335-G-T 7607294-G-T IR1_L **
14427457-G-T 12306732-G-T **
7757249-C-A 7889208-C-A **
15352903-T-A 13241022-T-A **
10999855-A-AT **
10753536-C-T **
16062000-C-A 13950120-C-A **
18297933-A-C 16186053-A-C P6_Prx **
18297918-C-T 16186038-C-T P6_Prx **
18226308-G-A 16114428-G-A **
18226268-G-T 16114388-G-T **
18206584-C-A 16094704-C-A **
18174854-T-C 16062974-T-C **
18174771-A-C 16062891-A-C **
18688533-T-A 16576653-T-A **
18155703-C-A 16043823-C-A **
17242134-C-A 15130254-C-A **
18013559-A-G 15901679-A-G K307 P7_Dst **
18035924-C-T 15924044-C-T CTS8453 **
18155680-C-G 16043800-C-G **
18127940-G-T 16016060-G-T **
18626007-G-T 16514127-G-T **
18703056-A-G 16591176-A-G **
17933477-G-T 15821597-G-T **
19425658-T-C 17313778-T-C **
13860859-G-A 11740153-G-A PF1969 Z831 **
19591986-T-TG 17480106-T-TG P5_Prx **
19591981-C-A 17480101-C-A P5_Prx **
19591972-C-T 17480092-C-T P5_Prx **
19591966-G-T 17480086-G-T P5_Prx **
19448397-T-A 17336517-T-A **
19329424-T-A 17217544-T-A **
18792293-C-A 16680413-C-A **
19310195-G-C 17198315-G-C **
19310152-T-G 17198272-T-G **
19168818-C-T 17056938-C-T **
19001177-C-A 16889297-C-A **
18948172-A-T 16836292-A-T **
18948106-C-A 16836226-C-A **
18915105-A-G 16803225-A-G **
18071810-T-A 15959930-T-A **
17918665-C-A 15806785-C-A Y100645 ALK195 **
19887303-C-CAA 17775423-C-CAA P5_Prx **
5073522-TTA-T 5205481-TTA-T 8×TA**
16945556-T-C 14833676-T-C **
22852198-A-C 20690312-A-C **
59007710-G-A 56861563-G-A **
18534201-TAC-T 16422321-TAC-T P6_Dst 8×AC**
21515818-C-G 19353932-C-G **
3086542-AGC-A 3218501-AGC-A **
7098759-G-A 7230718-G-A **
4778200-T-A 4910159-T-A 11×A**
16914362-C-A 14802482-C-A **
16865297-G-T 14753417-G-T **
16823839-A-G 14711959-A-G **
58992369-C-T 56846222-C-T **
16783503-G-A 14671623-G-A **
24264583-A-C 22118436-A-C P3_b1 **
5241253-TG-T 5373212-TG-T **
2909251-G-A 3041210-G-A **
17722897-C-A 15611017-C-A **
17306420-G-C 15194540-G-C **
17480038-A-C 15368158-A-C **
17449220-TCCTAATG-T 15337340-TCCTAATG-T **
17349391-A-T 15237511-A-T **
17313444-T-A 15201564-T-A **
17306772-C-A 15194892-C-A **
23114014-A-AATATATATAT 20952128-A-AATATATATAT 22×AT**
17152868-C-A 15040988-C-A **
16961319-A-G 14849439-A-G **
17130054-C-A 15018174-C-A **
17030815-C-G 14918935-C-G **
17030801-G-A 14918921-G-A **
16974354-G-T 14862474-G-T **
4778178-C-CA 4910137-C-CA 15×A**
16974163-A-T 14862283-A-T **
18204985-C-A 16093105-C-A 23×A**
19668742-A-C 17556862-A-C P5_Prx **
19948300-A-T 17836420-A-T P5_Prx **
6808157-G-A 6940116-G-A **
23522250-A-C 21360364-A-C **
14624294-C-A 12512494-T-A **
24512676-G-T 22366529-G-T **
24466072-ACAGG-A 22319925-ACAGG-A **
23838713-C-A 21676827-C-A **
23837598-G-T 21675712-G-T **
23742434-C-A 21580548-C-A **
23516500-C-A 21354614-C-A **
25030917-C-A 22884770-C-A g1 **
23440676-ATT-A 21278790-ATT-A 9×T**
23401521-C-A 21239635-C-A **
23398362-G-C 21236476-G-C **
23377483-G-C 21215597-G-C **
23305679-T-A 21143793-T-A **
23260703-C-A 21098817-C-A **
24582545-A-T 22436398-A-T P3_t2 **
25977322-T-TTAC 23831175-T-TTAC P1_Y1 **
23188937-G-T 21027051-G-T **
28482552-C-A 26336405-C-A **
56887040-G-A **
56845199-G-T **
28791400-A-G 26645253-A-G **
28656306-C-T 26510159-C-T **
28533787-T-C 26387640-T-C **
28482814-C-T 26336667-C-T **
28465318-C-T 26319171-C-T **
26012971-G-T 23866824-G-T P1_Y1 **
28376050-C-G 26229903-C-G P1_gr2 **
13859976-AGTGTAATAGAAAGATATTGAATGGG-A 11739270-AGTGTAATAGAAAGATATTGAATGGG-A **
27618297-G-A 25472150-G-A P1_Y2 **
24015843-CTCT-C 21869696-CTCT-C 5×TCT**
26834691-G-T 24688544-G-T P1_g2 **
26314823-T-C 24168676-T-C P1_Y1 **
26013011-T-TA 23866864-T-TA P1_Y1 **
23190073-G-T 21028187-G-T **
23127768-T-A 20965882-T-A **
19948307-A-C 17836427-A-C P5_Prx **
28692484-A-G 26546337-A-G CTS12754 **
21515819-C-T 19353933-C-T **
21515817-C-T 19353931-C-T **
21515769-A-T 19353883-A-T **
21515725-T-C 19353839-T-C **
21515709-A-AAAC 19353823-A-AAAC **
21515698-T-C 19353812-T-C **
21457453-A-G 19295567-A-G **
21709210-T-A 19547324-T-A **
20625195-T-G 18463309-T-G P4_Prx **
20621416-G-T 18459530-G-T P4_Prx **
20574814-C-A 18412928-C-A P5_Dst **
20394446-G-T 18232560-G-T P5_Dst **
20394436-TGGA-T 18232550-TGGA-T P5_Dst **
20394410-C-CTTTT 18232524-C-CTTTT P5_Dst 26×T**
20230541-C-T 18068655-C-T P5_Dst **
13858510-AAATGG-A 11737804-AAATGG-A 15×AATGG**
21953581-G-T 19791695-G-T **
23009872-C-T 20847986-C-T **
59004611-G-A 56858464-G-A **
23005349-C-A 20843463-C-A **
22965381-T-C 20803495-T-C **
22965262-C-A 20803376-C-A **
22949934-A-G 20788048-A-G **
22920749-G-C 20758863-G-C **
22839022-AC-A 20677136-AC-A **
22258168-G-T 20096282-G-T DYZ19 **
59004603-G-A 56858456-G-A **
22211473-T-A 20049587-T-A **
22076967-A-T 19915081-A-T **
21990900-T-C 19829014-T-C **
21990897-GC-G 19829011-GC-G **
21979887-C-A 19818001-C-A **
21954604-T-C 19792718-T-C **
21009205-CAT-C 18847319-CAT-C P4_Dst 9×AT**
24290634-G-T 22144487-G-T P3_t1 **
22893304-CCTTTCTTTCTTT-C 20731418-CCTTTCTTTCTTT-C 17×CTTT**
13331681-C-A 11176005-C-A **
18756210-C-A 16644330-C-A **
27546763-A-G 25400616-A-G P1_Y2 **
11030765-T-G **
11030770-T-C **
10033116-C-A 10195507-C-A **
21133392-CA-C 18971506-CA-C 8×A**
21750976-G-T **
23609467-G-A 21447581-G-A **
14807370-T-A 12695441-T-A **
20101688-T-A 17989808-T-A P5_Dst **
17306708-C-A 15194828-C-A **
21754383-G-T **
13215434-C-A 11059758-C-A **
22077026-C-A 19915140-C-A **
13463911-C-T 11308235-C-T **
14716734-A-T 12604802-A-T **
28545689-G-T 26399542-G-T **
15281598-C-A 13169697-C-A **
7280936-C-A 7412895-C-A **
19066026-C-A 16954146-C-A **
6493953-CA-C 6625912-CA-C 19×A**
11030771-C-T **
13216475-C-T 11060799-C-T **
16071243-A-G 13959363-A-G **
16049038-T-A 13937158-T-A **
22063918-C-CA 19902032-C-CA 8×A**
19950178-G-GTA 17838298-G-GTA P5_Prx **
8181352-C-T 8313311-C-T **
15975034-G-A 13863154-G-A **
11018278-C-A **
10659259-G-T **
10679081-C-A **
10753560-A-G **
10945723-T-C **
11022588-G-A **
23098800-G-A 20936914-G-A **
16085604-C-T 13973724-C-T **
15496908-TA-T 13385028-TA-T **
11016006-T-TC **
11016013-T-C **
10845676-C-G **
15928726-G-A 13816846-G-A **
15650492-A-T 13538612-A-T **
15496926-C-T 13385046-C-T **
15477290-TCAAAA-T 13365410-TCAAAA-T **
28596562-ATT-A 26450415-ATT-A 12×T**
14568223-A-G 12456423-A-G **
15397114-C-T 13285234-C-T **
15367509-A-G 13255629-A-G **
13961543-C-A 11840837-C-A **
10999859-GA-G **
15397274-G-T 13285394-G-T **
22535954-C-A 20374068-C-A **
15491909-ATGTGTG-A 13380029-ATGTGTG-A 16×TG**
13258615-C-A 11102939-C-A **
10843773-C-A **
14427444-C-T 12306719-C-T **
15844894-C-A 13733014-C-A **
4417375-C-A 4549334-C-A **
10865885-G-T **
18925386-C-A 16813506-C-A **
15734406-C-A 13622526-C-A **
8181341-A-G 8313300-A-G A3725 **
14357819-C-A 12237114-C-A **
15688480-C-T 13576600-C-T **
10753541-A-T **
10938120-C-A **
18908082-ATGTG-A 16796202-ATGTG-A 14×TG**
14580987-C-A 12469187-C-A **
10747843-G-C **
14910792-A-G 12798859-A-G **
4505245-C-A 4637204-C-A **
21133535-T-A 18971649-T-A F23925 **
8030029-T-A 8161988-T-A **
11030095-AGTCAA-G **
14510180-CT-C 12398385-CT-C 11×T**
27633654-G-T 25487507-G-T P1_Y2 **
10993014-C-T **
10829301-G-C **
10808636-C-T **
10829297-C-T **
16320450-G-T 14208570-G-T **
11030804-C-T **
10845678-T-G **
11030806-C-T **
11030819-C-T **
11030822-T-C **
11030829-T-C **
11030837-C-T **
17629775-C-A 15517895-C-A **
21133556-C-A 18971670-C-A 23×A**
23128002-C-A 20966116-C-A **
22996012-CAAAAA-C 20834126-CAAAAA-C 18×A**
8181347-T-C 8313306-T-C **
16704462-T-C 14592582-T-C **
27585959-A-T 25439812-A-T P1_Y2 **
14100313-G-A 11979607-G-A **
58834022-C-A 56756849-G-T **
13722266-T-A 11566590-T-A **
16713012-T-C 14601132-T-C **
20641604-TGAGAGA-T 18479718-TGAGAGA-T P4_Prx 16×GA**
16713008-T-C 14601128-T-C **
16667103-T-G 14555223-T-G **
10764556-A-G **
16619979-A-G 14508099-A-G **
16605502-G-A 14493622-G-A **
16572983-A-T 14461103-A-T **
16572923-C-A 14461043-C-A **
16553894-A-C 14442014-A-C **
6770599-CT-C 6902558-CT-C 11×T**
28438188-CA-C 26292041-CA-C P1_gr2 31×A**
11030086-C-G **
27808438-C-A 25662291-C-A P1_Y2 **
16246142-C-T 14134262-C-T **
8214299-G-T 8346258-G-T **
7335745-G-A 7467704-G-A **
10845706-C-G **
10845708-T-G **
10845744-T-C **
10845751-C-G **
10849660-C-G **
14286928-CTTT-C 12166222-CTTT-C 16×T**
23464721-C-A 21302835-C-A **
13885893-C-T 11765187-C-T **
20650573-T-G 18488687-T-G P4_Prx **
10834187-A-ACTCCT **
10834214-T-G **
10834222-A-T **
21754342-G-T **
20230555-T-A 18068669-T-A P5_Dst **
16120024-A-AT 14008144-A-AT P8_Prx **
16120023-A-T 14008143-A-T P8_Prx **
10778316-C-A **
10755386-CCACT-C **
16341023-C-A 14229143-C-A **
17218287-A-T 15106407-A-T **
18036444-G-A 15924564-G-A **
25592900-C-CTATA 23446753-C-CTATA P1_gr1 12×TA**
10845693-T-G **
13943337-T-A 11822631-T-A **
21133525-C-A 18971639-C-A **
17043026-C-A 14931146-C-A **
9125447-CTTTT-C **
23395797-C-A 21233911-C-A **
23395792-T-C 21233906-T-C **
15218722-G-T 13106808-G-T ***
24002973-G-T 21856826-G-T ***
15927647-G-A 13815767-G-A ***
19201138-C-A 17089258-C-A ***
22085466-G-A 19923580-G-A ***
18210270-ATT-A,ATTT 16098390-ATT-A,ATTT 18×T***
18717836-G-T 16605956-G-T ***
22893451-C-T 20731565-C-T ***
15324975-C-A 13213093-C-A ***
27647703-C-A 25501556-C-A P1_Y2 ***
10008531-C-T 10170922-C-T ***
11643756-A-G ***
13804885-T-A 11684179-T-A ***
13846518-C-T 11725812-C-T ***
13461137-G-A 11305461-G-A ***
13809783-C-T 11689077-C-T ***
13819949-C-G 11699243-C-G ***
16679088-C-T 14567208-C-T ***
13869547-C-A 11748841-C-A ***
13847396-C-A 11726690-C-A ***
13680831-G-C 11525155-G-C ***
13866473-A-T 11745767-A-T ***
13802865-G-A 11682159-G-A ***
23176799-A-AGAAG 21014913-A-AGAAG 11×GAAG***
13659361-C-CGAGTG 11503685-C-CGAGTG ***
13818248-A-G 11697542-A-G ***
13471054-G-C 11315378-G-C ***
13680735-A-G 11525059-A-G ***
13456019-G-C 11300343-G-C 11×ATTCC***
13869534-G-C 11748828-G-C ***
13809813-C-G 11689107-C-G ***
19892867-TG-T 17780987-TG-T P5_Prx ***
13839815-G-C 11719109-G-C ***
13680815-A-C 11525139-A-C ***
13458528-T-C 11302852-T-C ***
13748563-G-A 11592887-G-A ***
13680963-A-ATGCAATGGAG 11525287-A-ATGCAATGGAG ***
13680959-T-A 11525283-T-A ***
13680955-G-T 11525279-G-T ***
13680878-A-G 11525202-A-G ***
13662128-G-A 11506452-G-A ***
13467183-A-C 11311507-A-C ***
13461150-A-T 11305474-A-T ***
58974084-T-G 56827937-T-G ***
13850264-A-T 11729558-A-T ***
13662085-T-A 11506409-T-A ***
13846473-T-A 11725767-T-A ***
13664839-A-G 11509163-A-G ***
15171246-G-T 13059332-G-T ***
58822466-AGATTCCATTCCGTAC-A 56768378-AGGAATGGAATCGTAC-A ***
13476831-T-C 11321155-T-C ***
13818176-T-G 11697470-T-G ***
13818161-T-A 11697455-T-A ***
13748521-A-T 11592845-A-T ***
13680886-G-A 11525210-G-A ***
13842235-A-T 11721529-A-T ***
13842800-G-T 11722094-G-T ***
13818245-C-A 11697539-C-A ***
13476896-C-T 11321220-C-T ***
58974081-T-C,G 56827934-T-C,G ***
13818006-T-G 11697300-T-G ***
20643241-CAT-C 18481355-CAT-C P4_Prx 8×AT***
13454191-CCATGG-C 11298515-CCATGG-C ***
13866580-G-A 11745874-G-A ***
28784383-A-G 26638236-A-G ***
26228672-C-T 24082525-C-T P1_Y1 ***
58974037-A-G 56827890-A-G ***
13818707-C-G 11698001-C-G ***
18378958-A-T 16267078-A-T P6_Prx ***
13682998-G-C 11527322-G-C ***
13866607-C-A 11745901-C-A ***
13691242-C-T 11535566-C-T ***
13668026-A-G 11512350-A-G ***
13668024-T-A 11512348-T-A ***
13869457-C-A 11748751-C-A ***
13801296-C-A 11680590-C-A ***
13452976-T-C 11297300-T-C ***
25776420-T-TA 23630273-T-TA P1_b3 12×A***
13868595-GGACAC-G 11747889-GGACAC-G ***
58974003-T-A 56827856-T-A ***
13865736-A-T 11745030-A-T ***
58973926-GAGTCCATTCCATTCCATTCT-G,GAGTCAATTCCATTCCATTCT 56827779-GAGTCCATTCCATTCCATTCT-G,GAGTCAATTCCATTCCATTCT ***
19892865-C-T 17780985-C-T P5_Prx ***
15358761-G-GAA 13246880-G-GA 26×A***
6126444-G-C 6258403-G-C ZS5053 ***
13869467-A-C 11748761-A-C ***
13869459-C-G 11748753-C-G ***
13196297-T-C 11040621-T-C PF465 ***
5426389-TC-T 5558348-TC-T ***
13866042-A-G 11745336-A-G ***
9994813-ATTC-A 10157204-ATTC-A ***
13668022-T-A 11512346-T-A ***
13869370-G-C 11748664-G-C ***
13452674-G-T 11296998-G-T ***
13461120-C-A 11305444-C-A ***
58980391-ATTCCG-A,ATTCCA 56834244-ATTCCG-A,ATTCCA ***
59004479-G-GA 56858332-G-GA ***
58972993-C-T 56826846-C-T ***
13802958-G-A 11682252-G-A ***
13686902-G-C 11531226-G-C ***
13818247-C-G 11697541-C-G ***
13866469-G-A 11745763-G-A ***
13488926-G-A,T 11333250-G-A,T ***
10796668-ATTC-A ***
15302738-G-GTT 13190837-G-GTT 13×T***
11643725-A-C ***
13857579-T-A 11736873-T-A ***
10753290-C-A ***
21211565-C-A 19049679-C-A ***
2892561-G-T 3024520-G-T ***
11643715-A-T ***
10796673-ATT-A ***
10796640-T-A ***
2836388-G-T 2968347-G-T ***
6807738-A-G 6939697-A-G ***
15161182-C-A 13049268-C-A ***
56830301-TCCATTCCATG-T ***
56831442-C-CCCACTCCATTCCATT ***
8216406-CTT-C,CT 8348365-CTT-C,CT 16×T***
14392777-G-T 12272073-G-T ***
23190182-G-T 21028296-G-T ***
2810409-G-T 2942368-G-T ***
10673922-C-CT ***
8462063-GCAAAA-G 8594022-GCAAAA-G ***
9980368-C-A 10142759-C-A ***
10987805-A-T ***
9843220-C-CA 10005611-C-CA 8×A***
11022922-C-A,T ***
10999878-C-CCGTAT ***
10973966-C-CA,TA ***
10946787-C-G ***
10889198-C-A ***
10868386-C-G ***
10868365-A-C ***
10677523-TTCCAG-T,TTCCAT ***
8270163-CA-C 8402122-CA-C ***
14986544-C-A 12874612-C-A ***
7723866-A-G 7855825-A-G ***
7042801-C-A 7174760-C-A ***
6757846-G-T 6889805-G-T ***
5214312-C-A 5346271-C-A ***
23952724-G-T 21806577-G-T ***
10956576-T-G ***
7869276-C-A 8001235-C-A ***
15038375-G-T 12926465-G-T ***
10982730-C-A ***
10673917-CCA-C ***
10868361-G-C ***
13866610-A-C 11745904-A-C ***
19206778-AG-A 17094898-AG-A ***
22456580-C-A 20294694-C-A DYZ19 ***
22451106-A-C 20289220-A-C DYZ19 ***
22343784-C-A 20181898-C-A DYZ19 ***
22337788-A-T 20175902-A-T DYZ19 ***
19982158-G-GAA 17870278-G-GAA P5_Prx 11×A***
19948181-C-CCTTTCTTTCTTTCTTT,T 17836301-C-CCTTTCTTTCTTTCTTT,T P5_Prx 21×CTTT***
19891024-TTA-T 17779144-TTA-T P5_Prx 8×TA***
19668782-T-TAAAAAAA 17556902-T-TAAAAAAA P5_Prx 33×A***
16918717-G-GA 14806837-G-GA 11×A***
22920605-C-CTT 20758719-C-CTT 25×T***
16679093-C-T 14567213-C-T ***
13869567-G-A 11748861-G-A ***
13869528-T-A 11748822-T-A ***
13869508-T-A 11748802-T-A ***
13869493-T-C 11748787-T-C ***
13869488-TA-T,TC 11748782-TA-T,TC ***
13869409-G-C 11748703-G-C ***
13869396-C-A,T 11748690-C-A,T ***
13869229-G-C 11748523-G-C ***
22461815-T-C 20299929-T-C BY25073 DYZ19 ***
24600462-T-TTCTG 22454315-T-TTCTG P3_t2 ***
8760517-CTTTTTTTTT-C 8892476-CTTTTTTTTT-C 20×T***
20804885-GTATA-G 18642999-GTATA-G P4_Gap 15×TA***
58973993-C-A,T 56827846-C-A,T ***
13680931-T-C,G 11525255-T-C,G ***
13140208-TTCCATCCTATTCTATTGAAC-C,T 10629694-TTCCATCCTATTCTATTGAAC-C,T ***
13858590-CAAGTG-C,G 11737884-CAAGTG-C,G ***
13869209-GGAAAT-A,G 11748503-GGAAAT-A,G ***
13140125-G-A,C 10629611-G-A,C 6×CACTC***
13472230-CCA-C 11316554-CCA-C ***
25885794-GGAAA-G,GGAAAGAAAGAAA 23739647-GGAAA-G,GGAAAGAAAGAAA P1_Y1 15×GAAA***
13811134-G-C 11690428-G-C ***
25307978-T-C 23161831-T-C P2_r1 ***
13457689-T-G 11302013-T-G ***
9843220-C-A 10005611-C-A 8×A***
8666716-A-T 8798675-A-T ***
16514304-A-ATG 14402424-A-ATG 18×TG***
13545299-A-AAGAGAGAG 11389623-A-AAGAGAGAG ***
58980962-C-A 56834815-C-A ***
27791926-T-TCTG 25645779-T-TCTG P1_Y2 ***
26948645-T-G 24802498-T-G P1_r3 ***
25381168-A-G 23235021-A-G P2_r2 ***
28164-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page