Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > S1121 > Z16251 > A159 > Z17981 > Z3006

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
300242
BigY2
300242
13694954-C-T 11539278-C-T A*
13451827-C-A 11296151-C-A A*
28790505-T-G 26644358-T-G A*
13694987-G-A 11539311-G-A A*
28790490-G-T 26644343-G-T A*
18669363-C-G 16557483-C-G YY++
8126343-T-C 8258302-T-C YY++
28660276-C-T 26514129-C-T **+
22833697-C-T 20671811-C-T CTS10916 YY+
23873751-G-C 21711865-G-C Y++
22298304-A-C 20136418-A-C DYZ19 ***+
19402443-T-C 17290563-T-C YY++
18884324-C-T 16772444-C-T Y55006 YY++
18921738-G-T 16809858-G-T YY++
17533174-A-G 15421294-A-G YY++
8168832-G-A 8300791-G-A FGC66784 BY20126 YY++
16365124-G-T 14253244-G-T YY++
15589371-C-A 13477491-C-A YY++
16411626-C-T 14299746-C-T YY++
23552895-C-CA 21391009-C-CA 11×A****
18804948-T-TAC 16693068-T-TAC 12×AC****
10934737-TTTCTA-T **
10936005-A-C **
10961424-T-G **
10938296-C-A **
10956071-A-G **
10946633-C-G **
10955454-T-G **
10955269-T-C **
10945132-A-C **
10945386-C-T **
10945364-T-A **
10945377-A-T **
10945378-T-C **
10874290-G-T **
10886895-C-A **
56860327-ATGCT-A **
10873109-A-G **
10814817-T-C **
10751105-A-C **
10760500-G-T **
10789703-A-T **
10791657-C-A **
10792941-A-C **
10795434-C-A **
10798035-C-A **
10802662-C-A **
10806344-C-T **
10806350-C-T **
10806351-A-T **
10806379-C-T **
10806799-TC-T **
10814818-C-A **
10868860-CTCCAT-C **
10814819-C-G **
10814826-C-T **
10814858-CAATTT-C **
10814873-CCACTT-C **
10814894-C-A **
10815396-C-A **
10817675-A-C **
10832490-A-C **
10840156-A-T **
10842215-G-T **
10843847-CA-C **
10845082-G-T **
10846146-C-A **
10848192-C-A **
10979776-A-C **
10964709-A-T **
14022847-T-C 11902141-T-C **
11648508-A-G **
11653274-A-C **
11653296-C-T **
11660304-C-A **
11669574-G-T **
11673301-G-T **
11674975-T-C **
13828288-A-T 11707582-A-T **
13919333-G-T 11798627-G-T **
13964996-C-A 11844290-C-A **
13966798-G-A 11846092-G-A **
14017068-A-C 11896362-A-C **
14038184-T-C 11917478-T-C **
13690266-A-G 11534590-A-G **
14097889-C-A 11977183-C-A **
14151496-C-A 12030790-C-A **
14161689-G-A 12040983-G-A **
14176428-C-A 12055722-C-A **
14184361-G-A 12063655-G-A **
14228913-C-A 12108207-C-A **
14235927-T-C 12115221-T-C **
14310311-C-A 12189605-C-A **
14363448-G-T 12242743-G-T **
14392868-A-C 12272164-A-C **
14392895-T-A 12272191-T-A **
14423346-C-T 12302621-C-T **
14430644-C-A 12309917-C-A **
13722723-G-A 11567047-G-A **
13608633-G-C 11452957-G-C **
10977785-C-A **
11034310-A-C **
10977838-C-A **
10979773-G-C **
10678572-C-A **
10979783-G-C **
10979795-T-C **
10979800-T-C **
10987371-C-A **
11001626-T-G **
11021574-C-A **
11022771-A-C **
11027515-C-A **
11031629-T-A **
11031647-G-A **
13205329-T-G 11049653-T-G **
13596443-G-T 11440767-G-T **
13256044-G-T 11100368-G-T 12×T**
13291864-T-A 11136188-T-A **
13307212-C-A 11151536-C-A **
13308200-C-A 11152524-C-A **
13326297-T-G 11170621-T-G **
13326300-C-G 11170624-C-G **
13327791-C-A 11172115-C-A **
13330427-T-G 11174751-T-G **
13349848-GA-C 11194172-GA-C **
13572405-T-A 11416729-T-A **
13577938-G-C 11422262-G-C **
13586133-G-T 11430457-G-T **
13594501-A-C 11438825-A-C **
10687892-C-A **
9654623-T-G 9817014-T-G IR3_Prx **
10663579-C-A **
5814223-C-A 5946182-C-A **
5040679-A-C 5172638-A-C **
5204590-T-A 5336549-T-A **
5207663-C-A 5339622-C-A **
5246784-A-T 5378743-A-T **
5339687-A-T 5471646-A-T **
5448790-AT-A 5580749-AT-A **
5534042-C-A 5666001-C-A **
5597445-G-A 5729404-G-A **
5755251-C-T 5887210-C-T **
5791302-C-A 5923261-C-A **
5809156-A-G 5941115-A-G **
5924317-T-C 6056276-T-C **
5022026-G-T 5153985-G-T **
5942896-C-T 6074855-C-T **
5960729-G-T 6092688-G-T **
6085921-G-A 6217880-G-A **
6144668-G-T 6276627-G-T IR3_Dst **
6147467-AG-A 6279426-AG-A IR3_Dst **
6350754-C-A 6482713-C-A **
6367558-T-C 6499517-T-C **
6492691-A-G 6624650-A-G **
6666290-C-A 6798249-C-A **
6698969-C-T 6830928-C-T **
6700876-G-A 6832835-G-A **
5022337-G-C 5154296-G-C **
4920869-T-C 5052828-T-C **
6720251-G-C 6852210-G-C **
3749663-T-C 3881622-T-C **
3089653-G-T 3221612-G-T **
3103568-A-G 3235527-A-G **
3109077-T-C 3241036-T-C **
3109094-G-C 3241053-G-C **
3285004-A-C 3416963-A-C **
3380102-C-A 3512061-C-A **
3500581-A-G 3632540-A-G **
3506889-A-G 3638848-A-G **
3660701-G-T 3792660-G-T **
3716189-C-A 3848148-C-A **
3716220-C-T 3848179-C-T **
3821009-C-A 3952968-C-A **
4902605-C-A 5034564-C-A **
3872539-G-T 4004498-G-T **
3987721-C-A 4119680-C-A **
4036059-G-A 4168018-G-A **
4080512-C-T 4212471-C-T **
4094214-G-T 4226173-G-T **
4138475-C-T 4270434-C-T **
4221222-C-T 4353181-C-T **
4244670-A-G 4376629-A-G **
4449921-C-A 4581880-C-A **
4549916-C-A 4681875-C-A **
4766204-C-A 4898163-C-A **
4781144-G-C 4913103-G-C **
6720229-T-G 6852188-T-G **
6776340-C-A 6908299-C-A **
10660995-TC-T **
9030193-A-C 9192584-A-C **
8090988-A-T 8222947-A-T **
8109861-G-T 8241820-G-T **
8213588-T-C 8345547-T-C **
8290733-TTTTTAATA-T 8422692-TTTTTAATA-T **
8575983-T-G 8707942-T-G **
8702863-A-T 8834822-A-T **
8751332-C-A 8883291-C-A **
8807150-C-A 8939109-C-A **
8848425-C-T 8980384-C-T **
8911995-G-T 9043954-G-T **
8976411-C-A 9138802-C-A **
9055402-G-T 9217793-G-T **
7990189-C-A 8122148-C-A **
9075279-T-A 9237670-T-A **
9417002-G-T 9579393-G-T **
9456682-A-T 9619073-A-T **
14610662-C-A 12498864-C-A **
9830631-G-T 9993022-G-T **
9899451-A-C 10061842-A-C **
9937818-G-A 10100209-G-A **
10005951-T-G 10168342-T-G **
10015062-G-C 10177453-G-C **
10074659-T-C 10237050-T-C **
10659228-T-G **
7990194-A-C 8122153-A-C **
7970401-T-C 8102360-T-C **
6808742-C-A 6940701-C-A **
7240222-G-A 7372181-G-A **
6858687-C-T 6990646-C-T **
6882035-C-A 7013994-C-A **
6922414-A-G 7054373-A-G **
6954811-G-T 7086770-G-T **
6976654-G-T 7108613-G-T **
7045543-A-G 7177502-A-G **
7075899-C-A 7207858-C-A **
7108471-C-A 7240430-C-A **
7140377-C-A 7272336-C-A **
7177067-G-A 7309026-G-A **
7240183-C-A 7372142-C-A **
7243779-A-G 7375738-A-G **
7853128-C-T 7985087-C-T **
7247982-C-A 7379941-C-A **
7255455-C-T 7387414-C-T **
7269394-T-A 7401353-T-A **
7303817-G-T 7435776-G-T **
7314596-T-G 7446555-T-G **
7430428-C-A 7562387-C-A **
7453533-T-G 7585492-T-G IR1_L **
7462629-G-T 7594588-G-T IR1_L **
7463905-G-A 7595864-G-A IR1_L **
7572782-C-A 7704741-C-A **
7640788-T-G 7772747-T-G **
7780741-T-A 7912700-T-A 11×A**
14609798-TCA-T 12498000-TCA-T **
15132109-C-A 13020196-C-A **
14620648-A-G 12508846-A-G **
21934633-C-A 19772747-C-A **
21219660-G-A 19057774-G-A **
21371120-A-C 19209234-A-C **
21450799-T-A 19288913-T-A **
21472202-A-C 19310316-A-C **
21554497-C-T 19392611-C-T **
21554499-G-A 19392613-G-A **
21615939-C-A 19454053-C-A **
21625231-A-G 19463345-A-G **
21635355-T-A 19473469-T-A **
21690951-T-G 19529065-T-G **
21905353-C-G 19743467-C-G **
21946503-T-A 19784617-T-A **
21149622-C-A 18987736-C-A **
22059100-C-A 19897214-C-A **
22063841-C-A 19901955-C-A **
22079851-T-A 19917965-T-A **
22079865-A-T 19917979-A-T **
22079922-A-T 19918036-A-T **
22164264-G-C 20002378-G-C **
22165117-G-A 20003231-G-A **
22268529-T-A 20106643-T-A DYZ19 **
22268536-C-CTTA 20106650-C-CTTA DYZ19 **
22268539-TACG-T 20106653-TACG-T DYZ19 **
22359696-T-G 20197810-T-G DYZ19 **
21182578-T-C 19020692-T-C **
21111628-C-A 18949742-C-A **
22587133-G-T 20425247-G-T **
19770144-T-C 17658264-T-C P5_Prx **
19462579-T-C 17350699-T-C **
19462580-T-C 17350700-T-C **
19462592-G-A 17350712-G-A **
19465902-C-A 17354022-C-A **
19498032-AG-A 17386152-AG-A **
19523566-C-T 17411686-C-T **
19530499-T-C 17418619-T-C **
19563294-TA-T 17451414-TA-T **
19609573-A-G 17497693-A-G P5_Prx **
19744911-G-T 17633031-G-T P5_Prx **
19770062-A-T 17658182-A-T P5_Prx **
19827451-T-C 17715571-T-C P5_Prx **
21090897-A-G 18929011-A-G **
20066733-A-G 17954853-A-G P5_Dst **
20424784-G-T 18262898-G-T P5_Dst **
20567711-T-G 18405825-T-G P5_Dst **
20579299-CAT-C 18417413-CAT-C P5_Dst **
20685339-C-A 18523453-C-A P4_Prx **
20769923-C-A 18608037-C-A P4_Prx **
20897724-GGT-G 18735838-GGT-G P4_Dst **
20897740-T-G 18735854-T-G P4_Dst **
20897744-T-TG 18735858-T-TG P4_Dst **
21061719-G-A 18899833-G-A **
21061825-A-C 18899939-A-C **
22529500-G-A 20367614-G-A **
22593867-T-A 20431981-T-A **
19461161-T-G 17349281-T-G **
28568009-A-C 26421862-A-C **
26170611-G-T 24024464-G-T P1_Y1 **
26422493-G-A 24276346-G-A P1_Y1 **
26514936-C-CAT 24368789-C-CAT P1_Y1 **
26699129-C-A 24552982-C-A P1_g2 **
27637132-A-T 25490985-A-T P1_Y2 **
27823876-A-G 25677729-A-G P1_Y2 **
27883649-T-A 25737502-T-A P1_Y2 **
27996128-A-AC 25849981-A-AC P1_Y2 **
28033130-A-C 25886983-A-C P1_Y2 **
28033134-A-AG 25886987-A-AG P1_Y2 **
28549910-G-T 26403763-G-T **
28619421-C-A 26473274-C-A **
26002575-T-G 23856428-T-G P1_Y1 **
28619431-G-A 26473284-G-A **
28619432-A-G 26473285-A-G **
28632269-C-A 26486122-C-A **
28742049-T-C 26595902-T-C **
28758119-A-G 26611972-A-G **
28793805-A-G 26647658-A-G **
56835200-A-C **
56845698-A-G **
56847525-T-C **
56858148-T-C **
56858152-C-T **
26133117-T-G 23986970-T-G P1_Y1 **
24878380-C-A 22732233-C-A g1 **
22689841-A-C 20527955-A-C **
23471056-A-G 21309170-A-G **
22776863-C-A 20614977-C-A **
22843810-C-T 20681924-C-T **
22881448-G-A 20719562-G-A **
22881472-C-A 20719586-C-A **
22936315-A-T 20774429-A-T **
22949786-C-A 20787900-C-A **
23264228-A-T 21102342-A-T **
23433611-A-C 21271725-A-C **
23439891-ATTTTGTTTTTTTTGTTTTTTTTT-A 21278005-ATTTTGTTTTTTTTGTTTTTTTTT-A **
23440527-T-A 21278641-T-A **
23459610-G-A 21297724-G-A **
23475537-A-C 21313651-A-C **
24517643-C-A 22371496-C-A **
23476255-A-G 21314369-A-G **
23529616-C-A 21367730-C-A **
23579136-A-G 21417250-A-G **
23579147-T-A 21417261-T-A **
23625586-A-G 21463700-A-G **
23625590-T-C 21463704-T-C **
23773874-T-C 21611988-T-C **
23773875-G-C 21611989-G-C **
23832956-C-T 21671070-C-T **
23954267-T-C 21808120-T-C **
24221224-T-C 22075077-T-C P3_b1 **
24235434-T-G 22089287-T-G P3_b1 **
19462565-C-G 17350685-C-G **
19449169-T-C 17337289-T-C **
14620658-A-G 12508856-A-G **
15916184-A-G 13804304-A-G **
15660930-C-A 13549050-C-A **
15684189-T-C 13572309-T-C **
15712301-A-C 13600421-A-C **
15733848-T-A 13621968-T-A **
15743161-G-T 13631281-G-T **
15761786-T-G 13649906-T-G **
15821461-T-A 13709581-T-A **
15892182-T-G 13780302-T-G **
15904938-G-T 13793058-G-T **
15904985-A-T 13793105-A-T **
15909497-C-A 13797617-C-A **
15924138-C-A 13812258-C-A **
15641853-G-A 13529973-G-A **
15969930-C-A 13858050-C-A **
15999773-G-A 13887893-G-A **
16060664-G-A 13948784-G-A **
16073002-A-G 13961122-A-G **
16096481-G-T 13984601-G-T **
16184445-C-A 14072565-C-A **
16196219-C-A 14084339-C-A **
16305784-G-GTA 14193904-G-GTA **
16305786-GTA-G 14193906-GTA-G **
16305794-G-T 14193914-G-T **
16305806-T-A 14193926-T-A **
15641856-C-T 13529976-C-T **
15641847-G-A 13529967-G-A A6185 **
16413426-C-A 14301546-C-A **
15201594-C-A 13089680-C-A **
14736047-C-A 12624115-C-A **
14807281-C-T 12695352-C-T **
14807310-C-A 12695381-C-A **
14807311-C-G 12695382-C-G **
14815247-T-C 12703318-T-C **
14990170-G-C 12878255-G-C **
15111474-G-C 12999561-G-C **
2965392-G-T 3097351-G-T **
15140606-C-A 13028693-C-A **
15171544-T-C 13059630-T-C **
15193378-C-A 13081464-C-A **
15238916-G-A 13127002-G-A **
15593157-T-C 13481277-T-C **
15288073-A-C 13176172-A-C **
15315423-G-A 13203528-G-A **
15333426-T-C 13221544-T-C **
15336568-A-G 13224686-A-G **
15358684-A-G 13246803-A-G **
15358690-A-G 13246809-A-G **
15365939-T-C 13254059-T-C **
15366397-C-A 13254517-C-A **
15366598-G-T 13254718-G-T **
15435317-T-G 13323437-T-G **
15581161-G-A 13469281-G-A **
15589571-C-A 13477691-C-A **
16405294-AT-A 14293414-AT-A **
16425505-G-A 14313625-G-A **
19415614-C-T 17303734-C-T **
18763778-C-A 16651898-C-A **
18071980-C-A 15960100-C-A **
18174660-G-T 16062780-G-T **
18187074-C-T 16075194-C-T **
18190816-T-C 16078936-T-C **
18646074-A-T 16534194-A-T **
18698735-T-C 16586855-T-C **
18717872-G-T 16605992-G-T **
18723945-A-G 16612065-A-G **
18723949-C-T 16612069-C-T BZ1316 **
18723952-G-C 16612072-G-C **
18747177-A-T 16635297-A-T **
18816926-C-A 16705046-C-A **
17952634-T-C 15840754-T-C **
18856948-C-A 16745068-C-A **
18864901-T-G 16753021-T-G **
18972700-A-G 16860820-A-G **
18972777-G-A 16860897-G-A **
19007848-A-C 16895968-A-C **
19012493-A-T 16900613-A-T **
19054382-C-A 16942502-C-A **
19068039-A-C 16956159-A-C **
19143136-T-A 17031256-T-A **
19256346-GT-G 17144466-GT-G **
19302417-C-A 17190537-C-A **
18042937-GGGGGAGGGGGGA-G 15931057-GGGGGAGGGGGGA-G **
17920839-G-A 15808959-G-A **
16425509-A-G 14313629-A-G **
17340812-C-A 15228932-C-A **
16471548-C-A 14359668-C-A **
16524931-C-A 14413051-C-A **
16588459-T-C 14476579-T-C **
16601461-C-A 14489581-C-A **
16609502-T-G 14497622-T-G **
16609509-C-G 14497629-C-G **
16665045-A-C 14553165-A-C **
16848669-TG-T 14736789-TG-T **
17238444-C-T 15126564-C-T **
17317761-C-A 15205881-C-A **
17340810-T-C 15228930-T-C **
17372132-C-A 15260252-C-A **
17871762-T-C 15759882-T-C **
17479850-T-C 15367970-T-C **
17501913-T-G 15390033-T-G **
17513813-A-C 15401933-A-C **
17638533-T-G 15526653-T-G **
17645618-C-A 15533738-C-A **
17645621-C-A 15533741-C-A **
17645636-G-A 15533756-G-A **
17672179-T-A 15560299-T-A **
17697043-C-A 15585163-C-A **
17714993-T-A 15603113-T-A **
17718256-T-C 15606376-T-C **
17832454-C-A 15720574-C-A **
3006823-G-T 3138782-G-T **
3668553-G-T 3800512-G-T **
2959900-G-A 3091859-G-A **
16516405-C-A 14404525-C-A **
23825294-A-C 21663408-A-C **
25524734-A-C 23378587-A-C P1_gr1 **
10962730-T-C **
10962747-T-C **
15606917-C-A 13495037-C-A **
19523575-C-A 17411695-C-A **
2959899-G-A 3091858-G-A **
15733854-T-G 13621974-T-G **
13709674-G-T 11553998-G-T *****
16305805-G-A 14193925-G-A **
6765634-T-G 6897593-T-G **
14361957-C-A 12241252-C-A **
13709673-T-C 11553997-T-C *****
13709299-T-A 11553623-T-A *****
11016723-G-C **
19677913-C-CA 17566033-C-CA P5_Prx **
10776469-T-C **
10946631-C-T **
10785362-G-C **
16305769-CA-C 14193889-CA-C **
19059385-C-A 16947505-C-A **
5645026-C-A 5776985-C-A **
3834976-C-A 3966935-C-A **
7186804-AT-A 7318763-AT-A 9×T**
15866241-C-A 13754361-C-A **
6147436-G-T 6279395-G-T IR3_Dst **
10964607-G-C **
18480346-G-A 16368466-G-A P6_Dst **
10946636-C-T **
7860163-C-A 7992122-C-A **
13880766-C-A 11760060-C-A **
14155953-C-A 12035247-C-A ****
2683252-T-C 2815211-T-C **
22615442-C-A 20453556-C-A **
10956134-C-A **
19979174-A-C 17867294-A-C P5_Prx **
17707356-G-A 15595476-G-A **
5960696-A-AT 6092655-A-AT 30×T**
10814841-T-C **
10814884-C-A **
24614210-G-A 22468063-G-A P3_t2 **
18756160-C-A 16644280-C-A **
2833178-CTTT-C 2965137-CTTT-C 19×T**
10760739-A-G **
2683262-T-C 2815221-T-C **
10832449-T-A **
10832450-C-T **
15477288-T-A 13365408-T-A **
10828102-G-T **
10961390-C-G **
19054342-CTTTT-C 16942462-CTTTT-C 16×T**
5586119-C-A 5718078-C-A **
5059685-A-G 5191644-A-G **
20440388-C-A 18278502-C-A P5_Dst **
10832437-A-T **
10926718-C-T **
6944942-T-G 7076901-T-G **
17505662-C-A 15393782-C-A **
10961428-C-T **
26260636-A-ATT 24114489-A-ATT P1_Y1 11×T**
23264111-C-A 21102225-C-A **
13215557-C-A 11059881-C-A **
10814792-C-T **
10832442-A-C **
10832410-C-T **
21147926-C-A 18986040-C-A **
4063900-C-A 4195859-C-A **
13856230-C-A 11735524-C-A **
20591714-A-AC 18429828-A-AC P5_Dst **
10814855-T-A **
56850956-G-T **
15622701-A-G 13510821-A-G **
22300851-T-A 20138965-T-A DYZ19 **
9979215-C-A 10141606-C-A **
23460486-G-T 21298600-G-T **
15739806-C-A 13627926-C-A **
10832406-A-T **
24636393-C-T 22490246-C-T P3_t2 **
19145421-C-A 17033541-C-A **
23825105-T-C 21663219-T-C **
24296350-A-AC 22150203-A-AC P3_t1 **
23832962-T-A 21671076-T-A **
16227989-A-G 14116109-A-G **
17158616-C-A 15046736-C-A **
23342074-G-T 21180188-G-T **
11011462-A-ACATTC **
10945376-G-C **
10760729-A-C **
10976944-G-A **
8109866-T-C 8241825-T-C **
10842254-A-C **
28633537-C-A 26487390-C-A **
56841071-C-A **
15882073-T-A 13770193-T-A **
21152512-CTT-C 18990626-CTT-C 14×T**
11030160-A-ATTCCAT **
8109853-G-A 8241812-G-A **
8109860-T-C 8241819-T-C **
9702932-G-A 9865323-G-A IR3_Prx **
15065984-T-G 12954076-T-G **
14549309-C-A 12437510-C-A 16×A**
10994192-T-C **
13922452-C-A 11801746-C-A **
10976949-A-G **
8702842-C-A 8834801-C-A **
10945385-A-C **
10979650-C-T **
10895875-C-G **
3991898-C-A 4123857-C-A **
10814844-C-A **
6038786-G-T 6170745-G-T **
10789115-A-C **
10940322-A-C **
10940327-C-T **
10672699-C-A **
17584182-A-C 15472302-A-C **
10789087-G-C **
10789089-A-T **
10789090-C-T **
10789102-C-G **
10789117-T-C **
18346573-C-A 16234693-C-A P6_Prx **
10789129-C-T **
15364049-G-A 13252169-G-A **
10926695-T-TCCGA **
15604346-C-A 13492466-C-A **
17946945-A-T 15835065-A-T **
27872569-C-G 25726422-C-G P1_Y2 **
10814829-G-C **
7135218-C-A 7267177-C-A **
10760737-G-C **
10895857-A-G **
11024579-A-T **
15324966-C-A 13213084-C-A **
10782669-T-A **
19436785-A-T 17324905-A-T **
24513641-C-A 22367494-C-A **
10998937-C-A **
28542477-C-A 26396330-C-A **
16227993-A-G 14116113-A-G **
4929378-C-A 5061337-C-A **
18890559-A-G 16778679-A-G BY42336 **
16528284-G-GA 14416404-G-GA 9×A**
22803994-A-T 20642108-A-T 10×T**
10806375-T-A **
16305781-C-T 14193901-C-T **
16305817-T-C 14193937-T-C **
10946617-T-A **
18738140-A-T 16626260-A-T **
7269662-G-T 7401621-G-T **
10832452-T-A **
2842994-C-A 2974953-C-A **
10659256-G-T **
11673446-C-A **
10806361-T-A **
11024593-T-A **
10939059-T-C **
11024609-A-T **
11024637-C-G **
10895841-CAT-C **
7217193-G-T 7349152-G-T **
8776573-A-G 8908532-A-G **
23825103-A-C 21663217-A-C **
15049314-TTTTG-T 12937405-TTTTG-T 4×TTTG**
10782668-A-C **
10895839-T-TCA **
58834003-C-T 56756868-G-A **
25524730-A-C 23378583-A-C P1_gr1 **
22268524-A-G 20106638-A-G DYZ19 **
10895835-C-CTATTG **
7174339-C-A 7306298-C-A **
10802634-C-T **
10802636-T-A **
10802640-C-A **
13486675-T-A 11330999-T-A **
58834005-T-A 56756866-A-T **
14313706-C-A 12193000-C-A **
14871365-C-A 12759435-C-A **
22936324-C-T 20774438-C-T **
11656647-C-A **
28505594-C-A 26359447-C-A **
22092988-C-A 19931102-C-A **
13608634-C-A 11452958-C-A **
21953182-C-A 19791296-C-A **
10657565-C-A **
14807289-T-C 12695360-T-C **
11003518-C-A **
21752694-G-T **
16085757-C-A 13973877-C-A **
21836184-C-A 19674298-C-A **
4875331-G-T 5007290-G-T **
5621263-AGT-A 5753222-AGT-A 10×GT**
14953535-G-A 12841609-G-A **
10934716-C-T **
18723957-C-T 16612077-C-T **
14815268-C-A 12703339-C-A **
7099925-C-A 7231884-C-A **
27952093-A-G 25805946-A-G P1_Y2 **
7103359-C-A 7235318-C-A **
19873758-C-A 17761878-C-A P5_Prx **
11018230-T-C **
17353170-C-A 15241290-C-A **
23109543-T-C 20947657-T-C CTS11430 M5558 PF1891 **
16707453-G-T 14595573-G-T **
10929581-C-A **
6010342-C-A 6142301-C-A **
14826539-G-T 12714606-G-T **
23954011-C-A 21807864-C-A **
7324743-C-A 7456702-C-A **
21554490-TG-T 19392604-TG-T **
15658086-GTA-G 13546206-GTA-G **
14398307-A-G 12277603-A-G **
15612293-C-A 13500413-C-A **
10814801-C-T **
23304489-C-A 21142603-C-A **
14079716-C-A 11959010-C-A **
28650640-C-A 26504493-C-A **
13468207-C-G 11312531-C-G **
21136854-T-C 18974968-T-C **
23954197-C-A 21808050-C-A **
16172191-C-G 14060311-C-G CTS5264 FGC2043 ****
13322814-G-A 11167138-G-A **
19398174-C-A 17286294-C-A **
5189670-C-A 5321629-C-A **
19563337-C-A 17451457-C-A **
15728787-G-A 13616907-G-A **
13722731-A-T 11567055-A-T **
17713968-C-A 15602088-C-A **
8575984-TGC-T 8707943-TGC-T **
10945358-A-T **
21974676-T-C 19812790-T-C **
9310592-ACC-A 9472983-ACC-A **
9310601-C-T 9472992-C-T **
10835436-C-A **
14050775-C-A 11930069-C-A **
4221231-TA-T 4353190-TA-T 19×A**
16305815-C-T 14193935-C-T **
16305840-G-A 14193960-G-A **
10850525-C-A **
13962138-A-T 11841432-A-T **
13488995-C-T 11333319-C-T **
10678546-C-A **
21766754-A-AC **
24407117-T-C 22260970-T-C **
11653281-C-A **
22541091-C-A 20379205-C-A **
19202765-C-A 17090885-C-A 17×A**
5817959-G-T 5949918-G-T **
7329277-C-A 7461236-C-A **
14992398-C-A 12880483-C-A **
16676596-C-A 14564716-C-A **
13902914-G-A 11782208-G-A **
18636641-G-T 16524761-G-T YFS287772 **
14588928-G-T 12477128-G-T **
17944900-C-A 15833020-C-A **
15109918-C-A 12998005-C-A **
22936314-G-T 20774428-G-T **
28062611-A-C 25916464-A-C P1_Y2 **
14555000-C-A 12443201-C-A **
13885977-A-T 11765271-A-T **
10851802-G-C **
3152180-A-G 3284139-A-G **
22529534-G-A 20367648-G-A **
2708012-A-T 2839971-A-T **
2683263-G-A 2815222-G-A **
10936014-C-A **
16036280-G-T 13924400-G-T **
13643495-C-A 11487819-C-A **
10851733-T-C **
15866233-T-A 13754353-T-A **
20635502-A-G 18473616-A-G P4_Prx **
20280146-TC-T 18118260-TC-T P5_Dst **
58995859-A-G 56849712-A-G **
9221731-C-A 9384122-C-A Y8279 **
15161291-T-A 13049377-T-A **
17714705-C-A 15602825-C-A **
23291372-C-A 21129486-C-A **
19532456-C-A 17420576-C-A **
20326037-GCA-G 18164151-GCA-G P5_Dst **
10948411-C-A **
24416978-C-A 22270831-C-A **
10690782-G-T **
13471973-G-T 11316297-G-T **
17942164-C-A 15830284-C-A **
2885871-C-A 3017830-C-A **
13722737-A-G 11567061-A-G **
18847735-C-A 16735855-C-A **
19256354-C-A 17144474-C-A **
16601481-G-A 14489601-G-A **
24673313-G-T 22527166-G-T P3_b2 **
2860090-C-A 2992049-C-A **
17813536-C-A 15701656-C-A **
10990873-G-T **
14264411-C-A 12143705-C-A **
3012159-G-T 3144118-G-T **
56858137-A-G **
56858157-A-AATAC **
23104371-T-C 20942485-T-C **
8127997-C-A 8259956-C-A **
7176972-C-A 7308931-C-A **
15658069-C-T 13546189-C-T **
28755738-C-A 26609591-C-A **
16485795-C-A 14373915-C-A **
4918974-G-T 5050933-G-T **
15143645-G-C 13031732-G-C Z356 **
18346517-G-A 16234637-G-A P6_Prx **
10974923-A-C **
28650012-C-A 26503865-C-A **
15452585-C-A 13340705-C-A **
11002195-C-A **
14551560-C-A 12439761-C-A **
26098021-A-G 23951874-A-G P1_Y1 **
11019148-C-A **
28567501-C-A 26421354-C-A **
17346433-C-A 15234553-C-A **
10934721-C-T **
10010613-G-T 10173004-G-T **
21863870-C-A 19701984-C-A **
15358692-T-A 13246811-T-A **
28701801-C-A 26555654-C-A **
13316100-C-A 11160424-C-A **
4878246-C-A 5010205-C-A 18×A**
5022254-T-A 5154213-T-A **
6948136-A-T 7080095-A-T **
16601473-C-T 14489593-C-T **
9426681-C-A 9589072-C-A **
13486668-G-A 11330992-G-A **
13466476-G-A 11310800-G-A ***
28800099-A-G 26653952-A-G ***
56838412-G-A,T ***
22005300-CTT-C 19843414-CTT-C 13×T***
7179760-G-T 7311719-G-T ***
13707964-G-C 11552288-G-C BY25130 ***
10746953-C-T ***
13678581-T-C 11522905-T-C ***
14893972-C-CT 12782038-C-CT 11×T***
10755392-AT-A,TG ***
6753384-T-C 6885343-T-C L1064 ******
13859368-T-A 11738662-T-A ***
10847047-G-C ***
17038241-ATT-A 14926361-ATT-A 13×T***
10673885-T-G ***
10973984-G-A,T ***
13447330-T-TTCACG 11291654-T-TTCACG ***
13447314-T-C 11291638-T-C 8×TCCAC***
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCATTCCACCCCATTCCATTCCTTTCCATTCCAT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCATTCCACCCCATTCCATTCCTTTCCATTCCAT ***
13686882-G-A 11531206-G-A ***
3012765-CAT-C 3144724-CAT-C ***
13846668-C-T 11725962-C-T F11172 ***
23564752-G-T 21402866-G-T ***
6753387-A-G 6885346-A-G L250 ******
58975176-G-T 56829029-G-T ***
16679134-A-G 14567254-A-G ***
14392723-CT-C 12272019-CT-C 11×T***
13809751-A-T 11689045-A-T ***
58982751-ATCCAT-A 56836604-ATCCAT-A ***
13472717-C-A 11317041-C-A ***
13472682-G-A 11317006-G-A ***
13472672-G-T 11316996-G-T ***
25380934-G-C 23234787-G-C P2_r2 ***
13140511-T-C 10629997-T-C ***
58988498-T-G 56842351-T-G ***
23127414-CAAAAA-C,CA 20965528-CAAAAA-C,CA 24×A***
22887687-CTTT-C 20725801-CTTT-C 15×T***
10016313-T-A 10178704-T-A ***
23196651-T-G 21034765-T-G ***
13477258-A-G 11321582-A-G SK2337 ***
15405313-C-A 13293433-C-A ***
58978571-G-A 56832424-G-A ***
13466420-A-G 11310744-A-G ***
15984459-TG-T 13872579-TG-T 10×G***
18095390-G-GA 15983510-G-GA 10×A***
22919315-C-A 20757429-C-A Y110122 ***
16909213-G-T 14797333-G-T ***
27637198-TCA-T,TCACACA 25491051-TCA-T,TCACACA P1_Y2 17×CA***
7646416-T-TA 7778375-T-TA 14×A***
24168705-T-C 22022558-T-C P3_b1 ***
24446701-G-T 22300554-G-T ***
13493905-T-C 11338229-T-C ***
22422105-G-C 20260219-G-C DYZ19 ***
22236925-C-G 20075039-C-G DYZ19 ***
21291218-C-A 19129332-C-A ***
21929580-A-ATG 19767694-A-ATG 10×TG***
14331156-TGC-T 12210450-TGC-T ***
19910616-C-T 17798736-C-T P5_Prx ***
14168640-TAA-T,TAAA 12047934-TAA-T,TAAA 12×A******
22047796-C-A 19885910-C-A ***
11014453-A-T ***
14591813-C-A 12480013-C-A 12×T***
19536231-T-C 17424351-T-C ***
9856029-C-A 10018420-C-A ***
21549200-TA-A,T 19387314-TA-A,T ***
8470549-C-CAA 8602508-C-CAA 22×A***
10832467-T-C ***
8140243-C-A 8272202-C-A ***
10673432-C-A ***
10847046-T-A ***
9952224-C-A 10114615-C-A ***
9735917-A-G 9898308-A-G IR3_Prx ***
9820401-G-T 9982792-G-T ***
9821547-T-A 9983938-T-A ***
17038315-G-T 14926435-G-T ***
7329458-A-T 7461417-A-T ***
9934306-C-A 10096697-C-A ***
56827376-C-A ***
7775865-C-A 7907824-C-A ***
10693991-A-AATTCCATTCCGTTCCATTCC ***
10751573-C-A ***
10958334-C-CT ***
26024712-GT-G 23878565-GT-G P1_Y1 10×T***
14376958-C-A 12256254-C-A ***
58979508-C-T 56833361-C-T ***
9944082-G-T 10106473-G-T ***
11001708-C-A ***
8096742-C-A 8228701-C-A ***
15512642-TAA-T 13400762-TAA-T 13×A***
11018804-C-A ***
56828723-C-T ***
2892552-T-C 3024511-T-C ***
2798961-A-G 2930920-A-G ***
2798954-T-C 2930913-T-C ***
3152262-ATTTTATTTTAT-A,ATTTTATTTTA 3284221-ATTTTATTTTAT-A,ATTTTATTTTA ***
14513374-C-A 12401579-C-A ***
13815543-A-C 11694837-A-C FGC52777 ***
17631020-C-A 15519140-C-A ***
15223032-C-A 13111118-C-A ***
5200011-C-A 5331970-C-A ***
10954921-C-A ***
15140644-C-A 13028731-C-A ***
56828710-A-T ***
7255065-T-C 7387024-T-C ***
56828709-C-T ***
6368856-G-T 6500815-G-T ***
56828679-C-G ***
56828678-C-A ***
56828671-T-A ***
17170194-A-C 15058314-A-C ***
10776521-C-G ***
10668285-C-A ***
7146104-C-A 7278063-C-A ***
7163487-C-A 7295446-C-A ***
7082561-C-A 7214520-C-A ***
11011417-C-A ***
14458558-CAAAAAAAA-C 12337831-CAAAAAAAA-C 21×A***
19479747-T-C 17367867-T-C ***
17685638-G-C 15573758-G-C 8×A***
16274404-C-A 14162524-C-A ***
5829135-C-A 5961094-C-A ***
16365124-G-GAT 14253244-G-GAT ***
10958348-C-CCACTG ***
21905283-CAA-C,CA 19743397-CAA-C,CA 16×A***
10982860-C-A ***
16830461-C-A 14718581-C-A ***
19337654-TTG-T 17225774-TTG-T ***
17515256-C-A 15403376-C-A ***
17685626-TAAAAA-T 15573746-TAAAAA-T 9×A***
21773948-C-A 19612062-C-A ***
11019416-TTCCAC-T ***
15956866-CTTTT-C 13844986-CTTTT-C 15×T***
4930682-C-A 5062641-C-A ***
18031343-C-A 15919463-C-A ***
18709290-CA-C 16597410-CA-C 10×A***
18242085-C-A 16130205-C-A ***
18723911-C-T 16612031-C-T ***
10958320-A-G ***
56742724-A-G ***
18806191-A-T 16694311-A-T ***
14771683-G-T 12659752-G-T ***
13578034-CAAA-C 11422358-CAAA-C 14×A***
14231997-T-G 12111291-T-G ***
21235209-C-A 19073323-C-A ***
7098893-G-T 7230852-G-T ***
20001304-G-A 17889424-G-A P5_Prx ***
19529077-C-A 17417197-C-A Y30016 ***
56828701-T-G ***
13446480-G-T 11290804-G-T ***
5603500-C-A 5735459-C-A ***
21235211-C-A 19073325-C-A ***
10983874-C-A ***
28714489-C-A 26568342-C-A ***
11669734-T-C ***
15066488-C-A 12954579-C-A ***
22295290-G-T 20133404-G-T DYZ19 ***
13866799-G-T 11746093-G-T ***
14060245-A-C 11939539-A-C ***
8056073-G-T 8188032-G-T ***
21446246-G-T 19284360-G-T ***
17503374-C-A 15391494-C-A Y99343 ***
14340851-G-T 12220146-G-T ***
17584173-C-T 15472293-C-T ***
14816106-G-A 12704177-G-A ***
25995094-G-A 23848947-G-A P1_Y1 ***
19124960-G-T 17013080-G-T ***
22729245-GA-G,GAA 20567359-GA-G,GAA 13×A***
18740721-C-A 16628841-C-A ***
16271807-GAAAA-G,GAAA 14159927-GAAAA-G,GAAA 19×A***
15722636-C-T 13610756-C-T ***
58974851-G-C 56828704-G-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page