Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
51482
BigY2
51482
25966635-A-G 23820488-A-G P1_Y1 ***A*
23146630-A-AT 20984744-A-AT 10×TA*
22454351-G-C 20292465-G-C DYZ19 ***A*
22315850-C-T 20153964-C-T DYZ19 ***A*
20618184-A-T 18456298-A-T P4_Prx ***A*
19912863-C-G 17800983-C-G P5_Prx ***A*
18276485-T-C 16164605-T-C P6_Prx ***A*
26198950-G-A 24052803-G-A P1_Y1 ***A*
6271182-C-G 6403141-C-G IR3_Dst ***A*
6267254-A-C 6399213-A-C IR3_Dst ***A*
22310954-A-G 20149068-A-G S1911 DYZ19 ***A*
6274459-A-G 6406418-A-G IR3_Dst ***A*
8853730-A-T 8985689-A-T YY++
18883025-TGATA-T 16771145-TGATA-T ++
8413034-TTTCTGTTCTG-T 8544993-TTTCTGTTCTG-T 7725113-A-T 7×TTCTG+*
19103860-C-T 16991980-C-T BZ4617 YY++
4931917-T-A 5063876-T-A **+
19023741-G-A 16911861-G-A YY++
7714984-CTGTTTGTT-C 7846943-CTGTTTGTT-C 7522818-A-G 10×TGTT+
6943190-G-A 7075149-G-A Z40709 YY++
7407042-C-T 7539001-C-T YY++
7694252-A-G 7826211-A-G YY++
7919487-C-T 8051446-C-T YY++
8753283-C-A 8885242-C-A YY++
9120834-C-T 9283225-C-T Y++
20363414-G-T 18201528-G-T P5_Dst **+
9153451-A-G 9315842-A-G Y++
18645454-G-A 16533574-G-A YY++
9450286-C-T 9612677-C-T YY++
13677225-A-G 11521549-A-G ++
13707868-G-T 11552192-G-T ***+
13821601-A-T 11700895-A-T ++
14519933-A-T 12408134-A-T YY++
14665723-T-G 12553789-T-G YY++
16899080-T-C 14787200-T-C Z30619 Y11991 YY++
17049769-GT-G 14937889-GT-G ++
7634393-C-T 7766352-C-T BY23504 YY++
17465448-G-C 15353568-G-C YY++
22462989-G-C 20301103-G-C DYZ19 ++
23557693-T-A 21395807-T-A F26214 YY++
28805506-T-A 26659359-T-A ***+
15809114-G-A 13697234-G-A YY++
23113296-G-T 20951410-G-T YY++
21508316-A-AT 19346430-A-AT ++
22469158-G-C 20307272-G-C DYZ19 +
28795401-G-T 26649254-G-T *
21477811-A-AAAAGAAAGAAAG 19315925-A-AAAAGAAAGAAAG 14×AAAG****
22287723-G-T 20125837-G-T DYZ19 ****
22288174-C-T 20126288-C-T DYZ19 ****
15732962-T-G 13621082-T-G **
15669794-C-A 13557914-C-A **
15658161-C-A 13546281-C-A **
15626685-A-C 13514805-A-C **
15622370-C-A 13510490-C-A **
14552424-G-A 12440625-G-A **
15605728-T-A 13493848-T-A **
15513601-C-CA 13401721-C-CA **
14549197-C-A 12437398-C-A **
15597259-G-T 13485379-G-T **
14549263-T-A 12437464-T-A **
15566742-A-C 13454862-A-C **
15532415-T-G 13420535-T-G **
15400372-G-T 13288492-G-T **
14558515-C-T 12446716-C-T **
15513619-A-G 13401739-A-G **
15500662-G-T 13388782-G-T **
15513612-T-C 13401732-T-C **
15513598-A-G 13401718-A-G **
14667815-CT-C 12555880-CT-C **
15388006-G-T 13276126-G-T **
15116501-G-T 13004588-G-T **
14589372-C-G 12477572-C-G **
14743650-C-A 12631719-C-A **
14761169-C-A 12649238-C-A **
14776972-C-A 12665041-C-A **
14784726-G-A 12672796-G-A **
14986063-C-A 12874131-C-A **
15012735-A-G 12900823-A-G **
15012779-T-G 12900867-T-G **
15034863-A-C 12922951-A-C **
15061683-C-A 12949775-C-A **
14568966-C-T 12457166-C-T **
15111485-A-G 12999572-A-G **
15116584-G-T 13004671-G-T **
14736117-T-G 12624185-T-G **
15157691-A-G 13045778-A-G **
15157698-CAA-C 13045785-CAA-C **
15157859-T-C 13045946-T-C **
15212521-T-A 13100607-T-A **
15231058-C-A 13119144-C-A **
15232234-A-C 13120320-A-C **
15239581-C-A 13127667-C-A **
15284268-A-G 13172367-A-G **
15324102-C-G 13212220-C-G **
15324121-A-T 13212239-A-T **
15324123-T-C 13212241-T-C **
15381300-C-A 13269420-C-A **
14560728-C-A 12448929-C-A **
18354164-T-A 16242284-T-A P6_Prx 13×AGAA**
15971219-T-G 13859339-T-G **
15743685-C-A 13631805-C-A **
16685218-T-G 14573338-T-G **
16411303-A-T 14299423-A-T **
16445614-G-T 14333734-G-T **
16445865-C-G 14333985-C-G **
16451657-C-A 14339777-C-A **
16464682-C-A 14352802-C-A **
16539697-C-A 14427817-C-A **
16539742-C-A 14427862-C-A **
16554750-T-C 14442870-T-C **
16562805-A-G 14450925-A-G **
16605597-G-A 14493717-G-A **
16700310-C-A 14588430-C-A **
16324110-G-A 14212230-G-A **
16777974-G-T 14666094-G-T **
16842650-C-A 14730770-C-A **
16848380-T-A 14736500-T-A **
16933108-T-G 14821228-T-G **
16987892-C-A 14876012-C-A **
17012907-C-T 14901027-C-T **
17012986-T-A 14901106-T-A **
17013013-A-T 14901133-A-T **
17066071-T-C 14954191-T-C **
17090864-T-G 14978984-T-G **
17104081-T-A 14992201-T-A **
16336897-GTTTTTT-G 14225017-GTTTTTT-G 23×T**
16211026-A-G 14099146-A-G **
15748080-C-A 13636200-C-A **
15928723-T-G 13816843-T-G **
15803528-A-T 13691648-A-T **
15803536-G-T 13691656-G-T **
15803560-A-T 13691680-A-T **
15803578-T-G 13691698-T-G **
15815356-A-AT 13703476-A-AT **
15866108-G-A 13754228-G-A **
15870676-T-A 13758796-T-A **
15916567-C-A 13804687-C-A **
15918579-C-A 13806699-C-A **
15927095-C-A 13815215-C-A **
15940291-A-G 13828411-A-G **
16146557-C-A 14034677-C-A P8_Dst **
14540744-T-C 12428945-T-C **
15971224-T-C 13859344-T-C **
16003829-C-A 13891949-C-A **
16005178-G-A 13893298-G-A **
16005188-T-C 13893308-T-C **
16041952-T-C 13930072-T-C **
16047174-A-AT 13935294-A-AT **
16053517-G-C 13941637-G-C **
16055241-C-A 13943361-C-A **
16062192-A-C 13950312-A-C **
16085676-C-A 13973796-C-A **
14544057-C-A 12432258-C-A **
14007590-C-A 11886884-C-A **
14513299-C-A 12401504-C-A **
11022994-A-G **
10975574-T-C **
10978843-C-T **
10988079-C-A **
10988543-T-G **
10988545-C-A **
10988556-A-T **
10999851-T-A **
11008714-C-A **
11008762-C-A **
11022983-A-T **
11022998-A-C **
10942253-C-A **
11023010-T-G **
13194010-G-T 11038334-G-T **
13196065-C-A 11040389-C-A **
13234809-T-G 11079133-T-G **
13249245-C-A 11093569-C-A **
13253197-C-A 11097521-C-A **
13267780-T-CC 11112104-T-CC **
13302331-T-A 11146655-T-A **
13316165-A-C 11160489-A-C **
13317202-C-A 11161526-C-A **
10975539-T-C **
10931280-A-G **
13429973-C-A 11274297-C-A **
10898829-C-A **
10856651-C-A **
10877892-G-C **
10877940-G-T **
10879242-G-A **
10890161-C-A **
10890223-C-T **
10890355-C-A **
10894038-C-A **
10894722-C-A **
10898572-C-T **
10899486-C-T **
10927898-C-G **
10909686-A-T **
10921857-C-A **
10924374-T-G **
10924394-T-TC **
10924396-CCA-C **
10924472-C-A **
10927714-CATTCCA-C **
10927844-C-A **
10927846-C-CTCTTT **
10927861-G-A **
10927871-C-A **
13364257-G-T 11208581-G-T **
13445974-T-G 11290298-T-G **
14509430-G-C 12397635-G-C **
14300250-T-C 12179544-T-C **
14042622-A-C 11921916-A-C **
14042691-T-C 11921985-T-C **
14069055-C-A 11948349-C-A **
14077135-G-T 11956429-G-T **
14100902-C-A 11980196-C-A **
14128282-C-G 12007576-C-G **
14149394-A-G 12028688-A-G **
14176525-A-T 12055819-A-T **
14281090-C-A 12160384-C-A **
14281106-C-A 12160400-C-A **
14307700-C-A 12186994-C-A **
13976454-T-A 11855748-T-A **
14315577-T-C 12194871-T-C **
14343915-T-C 12223210-T-C **
14343928-C-A 12223223-C-A **
14352821-C-A 12232116-C-A **
14384607-C-A 12263903-C-A **
14404822-TT-A 12284119-TT-A **
14462651-A-G 12341924-A-G **
14478826-C-A 12358095-C-A **
14492785-C-T 12380982-C-T **
14499594-G-T 12387799-G-T **
17130454-G-A 15018574-G-A **
13973283-G-A 11852577-G-A **
13460513-G-T 11304837-G-T **
13699027-G-T 11543351-G-T **
13474015-C-A 11318339-C-A **
13476314-C-A 11320638-C-A **
13487007-G-A 11331331-G-A **
13488112-G-T 11332436-G-T **
13523461-A-T 11367785-A-T **
13526052-C-A 11370376-C-A **
13542096-C-A 11386420-C-A **
13566063-C-A 11410387-C-A **
13626714-G-A 11471038-G-A **
13643865-A-C 11488189-A-C **
11647861-G-T **
13973137-T-C 11852431-T-C **
11650311-G-A **
11652968-A-G **
11672902-C-A **
13839826-G-A 11719120-G-A **
13839876-G-A 11719170-G-A **
13898839-G-T 11778133-G-T **
13913172-G-T 11792466-G-T **
13920920-T-C 11800214-T-C **
13951156-G-T 11830450-G-T **
13951196-C-T 11830490-C-T **
13962240-A-T 11841534-A-T **
17126074-G-T 15014194-G-T **
17616854-C-T 15504974-C-T **
17134514-C-A 15022634-C-A **
22297032-TTCATGGTCTTGC-T 20135146-TTCATGGTCTTGC-T DYZ19 **
22149910-C-A 19988024-C-A **
22205578-C-T 20043692-C-T **
22212137-C-A 20050251-C-A **
22215239-C-A 20053353-C-A **
22215285-A-C 20053399-A-C **
22215291-A-C 20053405-A-C **
22215294-T-C 20053408-T-C **
22296999-C-G 20135113-C-G DYZ19 **
22297000-A-T 20135114-A-T DYZ19 **
22297001-G-T 20135115-G-T DYZ19 **
22564585-A-G 20402699-A-G **
22097187-A-C 19935301-A-C **
22614296-C-A 20452410-C-A **
22659682-A-C 20497796-A-C **
22800213-C-T 20638327-C-T **
22857760-G-C 20695874-G-C **
22874529-A-G 20712643-A-G **
22996972-A-T 20835086-A-T **
23007333-T-C 20845447-T-C **
23039544-G-T 20877658-G-T **
23065531-C-A 20903645-C-A **
23079131-C-G 20917245-C-G **
22113986-C-A 19952100-C-A **
22055346-T-A 19893460-T-A **
23087039-C-A 20925153-C-A **
21368745-C-T 19206859-C-T **
21202078-A-C 19040192-A-C **
21207845-C-A 19045959-C-A **
21238741-GCCC-G 19076855-GCCC-G **
21240644-G-T 19078758-G-T **
21255947-C-A 19094061-C-A **
21283373-T-G 19121487-T-G **
21299213-G-T 19137327-G-T **
21323686-G-T 19161800-G-T **
21334685-C-A 19172799-C-A **
21367290-T-A 19205404-T-A Y14155 FGC18629 **
21392359-C-A 19230473-C-A **
21979827-G-A 19817941-G-A **
21503233-C-A 19341347-C-A **
21540884-T-G 19378998-T-G **
21540972-A-T 19379086-A-T **
21582521-C-A 19420635-C-A **
21604120-C-A 19442234-C-A **
21770630-C-A 19608744-C-A FGC2884 **
21827865-T-G 19665979-T-G **
21875911-T-A 19714025-T-A **
21875915-C-A 19714029-C-A **
21922037-C-A 19760151-C-A **
21972238-C-T 19810352-C-T **
23082041-C-A 20920155-C-A **
23127550-A-C 20965664-A-C **
21127395-G-A 18965509-G-A **
28797986-TG-T 26651839-TG-T **
28583664-C-A 26437517-C-A **
28600536-G-T 26454389-G-T **
28609429-C-A 26463282-C-A **
28674703-C-A 26528556-C-A **
28700920-G-T 26554773-G-T **
28722452-C-A 26576305-C-A **
28741976-T-C 26595829-T-C **
28762638-C-A 26616491-C-A **
28797966-T-G 26651819-T-G **
28797984-A-G 26651837-A-G **
56706599-G-C **
28542808-C-A 26396661-C-A **
56706617-T-C **
56706640-C-T **
56706646-A-T **
56825733-GTGTGTACATATATATATATATATAT-G **
56838730-G-T **
56840413-C-A **
56845174-G-T **
56848550-C-A **
56858233-A-G **
56876089-T-A **
28580497-C-A 26434350-C-A **
28521811-A-C 26375664-A-C **
23259181-T-A 21097295-T-A **
24290685-A-AT 22144538-A-AT P3_t1 **
23306698-C-A 21144812-C-A **
23401435-T-G 21239549-T-G **
23446945-A-G 21285059-A-G **
23514332-A-G 21352446-A-G **
23848644-T-A 21686758-T-A **
21751662-C-A **
21752684-T-C **
21783688-C-A **
24244548-G-T 22098401-G-T P3_b1 **
24271377-A-C 22125230-A-C P3_b1 **
24403140-A-T 22256993-A-T **
27929503-T-A 25783356-T-A P1_Y2 **
24446831-G-C 22300684-G-C **
24870061-G-C 22723914-G-C P3_b2 **
24929530-T-G 22783383-T-G g1 **
26045930-C-T 23899783-C-T P1_Y1 **
26169903-A-T 24023756-A-T P1_Y1 **
26908681-A-T 24762534-A-T P1_r3 **
27637333-G-C 25491186-G-C FGC41031 P1_Y2 **
27814080-T-A 25667933-T-A P1_Y2 **
27861875-CAAAAAAAAAAAAAA-C 25715728-CAAAAAAAAAAAAAA-C P1_Y2 32×A**
27872568-A-G 25726421-A-G P1_Y2 **
27908815-A-AG 25762668-A-AG P1_Y2 **
21201952-T-C 19040066-T-C **
21115628-C-T 18953742-C-T **
17151327-T-C 15039447-T-C **
17929094-C-A 15817214-C-A **
17693702-G-T 15581822-G-T Z27075 15×T**
17702652-C-A 15590772-C-A **
17735459-C-A 15623579-C-A **
17741289-A-G 15629409-A-G **
17796520-G-T 15684640-G-T **
17821908-G-T 15710028-G-T **
17842219-A-G 15730339-A-G **
17842369-C-A 15730489-C-A **
17915885-C-A 15804005-C-A **
17918821-T-C 15806941-T-C **
18008666-T-G 15896786-T-G P7_Dst **
17666463-C-A 15554583-C-A **
18093882-G-T 15982002-G-T **
18201202-T-A 16089322-T-A **
18274887-T-G 16163007-T-G P6_Prx **
18401028-C-A 16289148-C-A P6_Gap **
18427767-A-G 16315887-A-G P6_Dst **
18547044-C-A 16435164-C-A **
18593478-A-G 16481598-A-G **
18636606-T-A 16524726-T-A **
18636612-C-T 16524732-C-T 17×T**
18749443-C-A 16637563-C-A **
17693691-G-T 15581811-G-T **
17646588-GT-G 15534708-GT-G **
18814807-C-A 16702927-C-A **
17387381-C-A 15275501-C-A **
17157514-C-T 15045634-C-T **
17215016-A-G 15103136-A-G **
17231323-T-G 15119443-T-G **
17231374-G-C 15119494-G-C **
17313656-T-C 15201776-T-C **
17355718-C-A 15243838-C-A **
17370932-T-G 15259052-T-G **
17370937-C-A 15259057-C-A **
17370940-T-C 15259060-T-C **
17370940-T-TG 15259060-T-TG **
17448219-C-A 15336339-C-A **
17616910-C-T 15505030-C-T **
17465026-G-A 15353146-G-A **
17503017-C-A 15391137-C-A **
17503027-C-A 15391147-C-A **
17504143-G-T 15392263-G-T **
17504197-C-A 15392317-C-A **
17538167-T-C 15426287-T-C **
17538231-T-G 15426351-T-G **
17560643-T-C 15448763-T-C **
17616776-C-A 15504896-C-A Y99742 **
17616850-C-T 15504970-C-T **
10844665-T-C **
18753004-C-G 16641124-C-G **
18838835-C-A 16726955-C-A **
20962073-T-G 18800187-T-G P4_Dst **
19949609-T-TC 17837729-T-TC P5_Prx **
19523440-GC-G 17411560-GC-G **
19532717-T-G 17420837-T-G **
19535562-A-C 17423682-A-C **
19537912-A-AG 17426032-A-AG **
19557509-C-A 17445629-C-A **
19601086-A-C 17489206-A-C P5_Prx **
19622021-T-A 17510141-T-A P5_Prx **
19646345-G-T 17534465-G-T P5_Prx **
19720920-G-T 17609040-G-T P5_Prx **
19845024-C-A 17733144-C-A P5_Prx **
19963824-A-G 17851944-A-G P5_Prx **
19482283-C-A 17370403-C-A **
19963828-A-G 17851948-A-G P5_Prx **
19963831-C-T 17851951-C-T P5_Prx 21×AT**
19963831-C-CAT 17851951-C-CAT P5_Prx 21×AT**
20645125-T-TC 18483239-T-TC P4_Prx **
20760021-T-C 18598135-T-C P4_Prx **
20760064-T-TG 18598178-T-TG P4_Prx **
20760074-C-A 18598188-C-A P4_Prx **
20760081-A-C 18598195-A-C P4_Prx **
20778579-G-T 18616693-G-T P4_Prx **
20851430-A-AC 18689544-A-AC P4_Dst **
20962034-C-G 18800148-C-G P4_Dst **
19506788-C-A 17394908-C-A **
19460039-C-A 17348159-C-A **
18859117-T-C 16747237-T-C **
19129081-G-A 17017201-G-A **
18895654-A-G 16783774-A-G **
18901282-T-C 16789402-T-C **
18901286-C-A 16789406-C-A **
18961518-G-A 16849638-G-A **
18961536-T-A 16849656-T-A **
19044554-C-T 16932674-C-T **
19053426-C-G 16941546-C-G **
19053436-C-A 16941556-C-A **
19088383-C-A 16976503-C-A **
19121836-G-T 17009956-G-T **
19172911-A-T 17061031-A-T **
19423919-A-G 17312039-A-G **
19204004-T-A 17092124-T-A **
19241517-G-A 17129637-G-A **
19241527-T-C 17129647-T-C **
19241532-A-C 17129652-A-C **
19248850-C-A 17136970-C-A **
19268296-C-A 17156416-C-A **
19302410-C-A 17190530-C-A **
19328319-T-C 17216439-T-C **
19351694-G-C 17239814-G-C **
19393053-C-A 17281173-C-A **
19410037-G-T 17298157-G-T **
10844670-C-T **
10834093-C-A **
10844657-C-T **
2740523-TA-T 2872482-TA-T **
5393474-C-A 5525433-C-A **
10673942-G-T **
24264540-A-G 22118393-A-G P3_b1 **
9702953-T-A 9865344-T-A IR3_Prx **
25246598-A-T 23100451-A-T P2_r1 **
21387290-C-A 19225404-C-A **
10927836-C-T **
2680978-C-G 2812937-C-G **
2773778-A-T 2905737-A-T **
15115774-G-GT 13003861-G-GT 9×T**
2795134-ATGATGTGTTTGCTTACC-A 2927093-ATGATGTGTTTGCTTACC-A **
2795156-CA-T 2927115-CA-T **
2795159-CATGATTGTAAATT-C 2927118-CATGATTGTAAATT-C **
2928195-A-G 3060154-A-G **
3091992-T-C 3223951-T-C **
3111748-C-A 3243707-C-A **
3116517-C-G 3248476-C-G **
3131062-C-A 3263021-C-A **
3151744-G-T 3283703-G-T **
18950671-C-A 16838791-C-A **
11037802-G-T **
3252608-G-A 3384567-G-A **
10763453-C-A **
10986436-T-C **
10986438-C-G **
10986456-T-C **
11023009-T-C **
13468600-C-G 11312924-C-G **
13468605-A-G 11312929-A-G **
13468609-G-T 11312933-G-T **
15969954-C-A 13858074-C-A **
4900817-G-T 5032776-G-T **
14567090-G-T 12455290-G-T **
18480346-G-A 16368466-G-A P6_Dst **
15732086-C-A 13620206-C-A **
10845713-T-C **
15785853-GT-G 13673973-GT-G **
56836181-C-A **
19415910-C-A 17304030-C-A **
4604348-C-A 4736307-C-A **
14561895-C-A 12450096-C-A **
2859132-C-A 2991091-C-A **
3251986-T-C 3383945-T-C **
3334786-A-T 3466745-A-T **
19187443-AC-A 17075563-AC-A **
5393570-T-C 5525529-T-C **
4888593-G-T 5020552-G-T **
4898459-T-A 5030418-T-A **
4920913-G-T 5052872-G-T **
4930930-A-G 5062889-A-G **
4976805-AAAAG-A 5108764-AAAAG-A **
5186468-T-A 5318427-T-A **
5264217-C-G 5396176-C-G **
5292844-A-T 5424803-A-T **
5448684-CA-C 5580643-CA-C **
4840084-A-G 4972043-A-G **
5550409-A-T 5682368-A-T **
5577264-C-T 5709223-C-T **
5621472-C-T 5753431-C-T **
5621499-A-T 5753458-A-T **
5626031-C-A 5757990-C-A **
5818015-C-A 5949974-C-A **
5851891-C-A 5983850-C-A **
5853494-G-T 5985453-G-T **
5935244-A-G 6067203-A-G **
4879707-C-A 5011666-C-A **
4534091-G-T 4666050-G-T **
3390510-T-A 3522469-T-A **
3956198-A-T 4088157-A-T **
3467337-G-T 3599296-G-T **
3550569-CAACTCA-C 3682528-CAACTCA-C **
3609645-C-G 3741604-C-G **
10844648-C-A **
3696028-A-G 3827987-A-G **
3732090-T-C 3864049-T-C **
3815168-G-T 3947127-G-T **
3870953-TAA-T 4002912-TAA-T 13×A**
3960125-A-G 4092084-A-G **
4505576-T-C 4637535-T-C **
3966911-G-T 4098870-G-T **
4043777-C-A 4175736-C-A **
4080984-C-A 4212943-C-A **
4081083-C-G 4213042-C-G **
4302515-A-G 4434474-A-G **
4412303-A-T 4544262-A-T **
4444748-T-A 4576707-T-A **
4473872-A-T 4605831-A-T **
4474085-G-A 4606044-G-A **
10986426-C-T **
19963812-G-A 17851932-G-A P5_Prx **
5969756-C-A 6101715-C-A **
6619694-C-A 6751653-C-A **
10655806-G-A **
10655813-T-A **
10655815-T-A **
11659101-C-A **
14080222-C-A 11959516-C-A **
13945217-C-A 11824511-C-A **
6231166-T-A 6363125-T-A IR3_Dst **
9077312-G-T 9239703-G-T **
11672680-C-A **
10986455-T-A **
18147556-G-T 16035676-G-T **
18422861-C-A 16310981-C-A P6_Gap **
10868126-C-T **
13705512-A-AATTCC 11549836-A-AATTCC **
18035711-T-C 15923831-T-C **
9535173-G-T 9697564-G-T IR3_Prx **
4976787-C-A 5108746-C-A 21×A**
10902162-C-A **
5985930-GA-G 6117889-GA-G 12×A**
10989433-TCCAC-T **
17942103-CTT-C 15830223-CTT-C 11×T**
24235425-C-T 22089278-C-T P3_b1 **
19410150-C-A 17298270-C-A **
58884239-G-A 56706632-C-T **
24446852-AAT-A 22300705-AAT-A 15×AT**
22297068-A-T 20135182-A-T DYZ19 **
2855484-G-T 2987443-G-T **
13295276-A-G 11139600-A-G **
15928730-C-A 13816850-C-A **
13468583-G-A 11312907-G-A **
21464577-C-A 19302691-C-A **
22215290-G-A 20053404-G-A **
3726368-C-A 3858327-C-A **
17994809-G-A 15882929-G-A P7_Prx **
26045932-A-T 23899785-A-T P1_Y1 **
22296984-T-C 20135098-T-C DYZ19 **
28700731-CTATATATA-C 26554584-CTATATATA-C 17×TA**
58884258-C-T 56706613-G-A **
8016924-CT-C 8148883-CT-C 8×T**
18085708-A-G 15973828-A-G **
7186238-A-C 7318197-A-C **
22241130-A-G 20079244-A-G DYZ19 *****
16562808-T-A 14450928-T-A **
23831295-C-T 21669409-C-T **
21428566-C-A 19266680-C-A **
6295515-T-TA 6427474-T-TA IR3_Dst **
4178897-C-A 4310856-C-A **
10764548-T-C **
13299505-C-A 11143829-C-A **
9551441-T-TA 9713832-T-TA IR3_Prx **
10792768-C-T **
18858566-C-A 16746686-C-A **
10911698-G-A **
10911728-G-C **
24109043-C-A 21962896-C-A P3_b1 **
10877933-G-A **
6179636-A-C 6311595-A-C IR3_Dst **
21141426-C-A 18979540-C-A **
11023016-G-C **
6751550-C-A 6883509-C-A **
20893455-A-AC 18731569-A-AC P4_Dst **
20775220-T-A 18613334-T-A P4_Prx **
10924388-ACTTT-A **
3847319-C-A 3979278-C-A **
16095267-A-C 13983387-A-C **
18263856-CAA-C 16151976-CAA-C 26×A**
10877916-C-T **
11005382-C-A **
24466073-C-A 22319926-C-A **
20510995-C-T 18349109-C-T P5_Dst **
22816364-CT-C 20654478-CT-C **
24475328-AT-A 22329181-AT-A 10×T**
10845678-T-C **
19226601-C-A 17114721-C-A **
10927846-C-T **
56861065-C-CGTTCAAAAATTAACCATATAGACGGACAA **
17879428-C-A 15767548-C-A **
19361171-C-A 17249291-C-A **
7335730-C-A 7467689-C-A **
10877904-A-C **
11658836-C-A **
24884192-A-T 22738045-A-T g1 **
14008778-GAAAAA-G 11888072-GAAAAA-G 25×A**
15866107-T-A 13754227-T-A **
19270564-T-G 17158684-T-G **
10988554-T-C **
2960048-C-A 3092007-C-A **
10877898-T-C **
10877903-T-A **
5935266-T-G 6067225-T-G **
3609683-T-G 3741642-T-G **
5985916-G-A 6117875-G-A **
10017984-C-A 10180375-C-A **
9937025-A-C 10099416-A-C **
9937837-C-A 10100228-C-A **
9942167-C-A 10104558-C-A **
9945078-C-A 10107469-C-A **
9955411-C-A 10117802-C-A **
9978437-G-T 10140828-G-T **
5985922-C-T 6117881-C-T **
10004806-A-G 10167197-A-G **
10040066-C-T 10202457-C-T **
9799417-G-T 9961808-G-T **
10057444-C-A 10219835-C-A **
10652196-C-T **
10655199-G-T **
10660362-G-T **
10661368-A-C **
10662518-T-C **
10662520-C-G **
10662523-T-A **
9832612-C-A 9995003-C-A **
9784669-C-T 9947060-C-T **
10662540-T-C **
9108261-T-C **
8333635-T-C 8465594-T-C **
8353346-C-A 8485305-C-A **
8379273-C-A 8511232-C-A **
8379687-C-A 8511646-C-A **
8734911-C-A 8866870-C-A **
8735634-T-G 8867593-T-G **
8761581-A-G 8893540-A-G **
8852219-C-G 8984178-C-G **
8970831-C-A 9133222-C-A **
9551425-C-A 9713816-C-A IR3_Prx **
9015201-C-A 9177592-C-A **
9015776-T-C 9178167-T-C **
9063770-T-A 9226161-T-A **
9077280-C-A 9239671-C-A **
9330797-A-C 9493188-A-C **
9438101-T-TA 9600492-T-TA **
9444875-C-A 9607266-C-A **
9508485-C-A 9670876-C-A **
9535174-G-GT 9697565-G-GT IR3_Prx **
10662532-C-T **
10662541-A-T **
8279938-C-A 8411897-C-A **
10818695-C-G **
10769695-A-G **
10792741-T-G **
10792761-T-A **
10792769-A-G **
10796869-C-A **
10801657-G-T **
10801662-C-T **
10818685-C-A **
10818705-C-G **
10764577-T-TTCGGGTTGAA **
10829069-A-G **
10834035-T-A **
10834079-A-G **
10844613-A-T **
10844621-T-A **
10844625-C-T **
10844630-T-C **
10844643-C-A **
10769666-A-C **
10764554-C-CGGCTT **
10662572-G-A **
10686471-C-G **
10662573-A-C **
10662577-T-C **
10662595-A-T **
10663420-C-A **
10668355-C-A **
10672748-C-A **
10683209-T-C **
10686276-G-T **
10691535-C-T **
10763690-C-G **
10744245-TC-T **
10744248-ATTCC-A **
10755392-A-CGTTC **
10760253-T-A **
10760289-CCG-C **
10760295-G-TCC **
10760297-T-C **
10760323-T-C **
10760334-C-CGTGTT **
8325527-A-T 8457486-A-T **
9991156-C-A 10153547-C-A **
29927-T-C **
7154603-C-A 7286562-C-A **
6925681-C-A 7057640-C-A **
7029700-A-G 7161659-A-G **
7038402-C-A 7170361-C-A **
7042289-A-C 7174248-A-C **
7062657-A-G 7194616-A-G **
7076235-T-A 7208194-T-A **
7090607-T-G 7222566-T-G **
7098606-C-A 7230565-C-A **
7139309-C-A 7271268-C-A **
7158964-C-A 7290923-C-A **
6892473-C-T 7024432-C-T **
7186790-C-A 7318749-C-A **
7203698-G-A 7335657-G-A **
7225778-G-T 7357737-G-T **
7243858-C-A 7375817-C-A **
7255557-C-A 7387516-C-A **
7269692-A-G 7401651-A-G **
7277577-A-G 7409536-A-G **
7299691-G-T 7431650-G-T **
7325749-C-A 7457708-C-A **
7334067-C-A 7466026-C-A **
6916173-T-A 7048132-T-A **
6892466-A-C 7024425-A-C **
7341310-C-CT 7473269-C-CT 12×T**
6622949-CT-C 6754908-CT-C **
5985926-T-C 6117885-T-C **
5985927-C-A 6117886-C-A **
6092207-C-A 6224166-C-A **
6147544-G-T 6279503-G-T IR3_Dst **
6231140-G-A 6363099-G-A IR3_Dst **
6384807-CACA-C 6516766-CACA-C **
6464978-A-G 6596937-A-G **
6582736-C-T 6714695-C-T **
6582775-C-A 6714734-C-A **
6637292-G-T 6769251-G-T **
6892379-G-A 7024338-G-A **
6744568-C-G 6876527-C-G **
6765766-C-A 6897725-C-A **
6765982-A-T 6897941-A-T **
6765988-C-G 6897947-C-G **
6771401-G-A 6903360-G-A **
6771411-G-T 6903370-G-T **
6771514-A-G 6903473-A-G **
6808021-C-A 6939980-C-A **
6881158-A-G 7013117-A-G **
6881369-C-G 7013328-C-G **
7335727-AA-T 7467686-AA-T **
7058220-C-A 7190179-C-A **
7475365-T-A 7607324-T-A IR1_L **
8127934-CA-C 8259893-CA-C 8×A**
7871442-C-A 8003401-C-A **
7613831-C-A 7745790-C-A **
7970343-G-A 8102302-G-A **
7867045-T-A 7999004-T-A **
7464060-A-C 7596019-A-C IR1_L **
8085349-A-C 8217308-A-C **
7464054-A-C 7596013-A-C IR1_L **
7416680-A-T 7548639-A-T **
7896656-T-C 8028615-T-C **
7821072-C-A 7953031-C-A **
7413960-C-A 7545919-C-A **
7385341-C-A 7517300-C-A **
7645516-C-A 7777475-C-A **
7374506-A-G 7506465-A-G **
8154019-A-G 8285978-A-G **
7705540-C-A 7837499-C-A **
8230395-C-A 8362354-C-A **
8158865-C-A 8290824-C-A **
7758738-G-T 7890697-G-T **
7383888-A-G 7515847-A-G **
18556556-CTGTG-C 16444676-CTGTG-C 15×TG***
23516365-C-A 21354479-C-A ***
22435568-A-C 20273682-A-C DYZ19 ***
8452227-G-A 8584186-G-A ***
13448233-TCCACC-T 11292557-TCCACC-T ***
7188711-G-GGA 7320670-G-GGA 10×GA***
21750974-G-T ***
17923862-A-T 15811982-A-T ***
22251743-G-T 20089857-G-T DYZ19 ***
21751008-G-T ***
10673891-T-A ***
9364890-G-C 9527281-G-C ***
24518651-G-A 22372504-G-A ***
19596295-A-G 17484415-A-G P5_Prx ***
20030808-GTCC-G 17918928-GTCC-G P5_Prx ***
20030813-GACA-G 17918933-GACA-G P5_Prx ***
20030822-T-TG 17918942-T-TG P5_Prx ***
22285483-G-A 20123597-G-A DYZ19 ***
22248883-G-A 20086997-G-A DYZ19 ***
22303871-G-A 20141985-G-A DYZ19 ***
13493995-C-A 11338319-C-A ***
6655160-C-A 6787119-C-A ***
23389550-G-T 21227664-G-T ***
14977709-CTT-C 12865784-CTTT-C 14×T***
25082148-C-T 22936001-C-T g1 ***
13478113-C-A 11322437-C-A ***
56836695-A-G ***
56835401-CAGTACATTCCACTCCACTCCACTCC-C,CAGTACATTCCCCTCCACGCCACTCA ***
56832466-C-A ***
56827681-C-A ***
17815787-T-TGA 15703907-T-TGA 14×GA***
8666716-A-T 8798675-A-T ***
8124973-A-G 8256932-A-G ***
10851034-C-A ***
18465454-C-A 16353574-C-A P6_Dst ***
28786367-A-T 26640220-A-T ***
58981193-C-T 56835046-C-T ***
8555800-C-A 8687759-C-A ***
28792470-G-A 26646323-G-A ***
22030040-T-TA 19868154-T-TA 10×A***
14530877-TAC-T 12419078-TAC-T 9×AC***
15818376-C-A 13706496-C-A ***
9937258-A-T 10099649-A-T ***
6915826-A-G 7047785-A-G ***
24074302-G-A 21928155-G-A P3_b1 ***
10660817-G-T ***
16430208-C-T 14318328-C-T ***
28560627-C-A 26414480-C-A ***
22498702-T-A 20336816-T-A DYZ19 ***
7803116-GAA-G 7935075-GAA-G 14×A***
24094688-C-T 21948541-C-T P3_b1 ***
7201611-A-T 7333570-A-T Y30462 ***
3790878-G-GTATATATA 3922837-G-GTATATATA 21×TA***
21861398-G-A 19699512-G-A ***
13218423-T-C 11062747-T-C ***
22023223-A-G 19861337-A-G ***
13725983-A-G 11570307-A-G ***
14884685-T-G 12772751-T-G ***
10980707-T-A ***
13258018-C-A 11102342-C-A ***
3593972-C-A 3725931-C-A ***
14324920-TG-T 12204214-TG-T ***
56834492-C-G ***
15971761-GT-G 13859881-GT-G 11×T***
10673870-T-C ***
7501520-G-T 7633479-G-T IR1_L ***
21225096-C-A 19063210-C-A ***
9954717-C-A 10117108-C-A ***
10673899-A-G ***
21153123-C-A 18991237-C-A ***
13446804-GC-G 11291128-GC-G 12×CCATT***
2847143-G-T 2979102-G-T ***
7359664-C-A 7491623-C-A ***
13811097-T-A 11690391-T-A ***
13485577-T-G 11329901-T-G ***
13485603-G-C 11329927-G-C ***
13485608-G-T 11329932-G-T ***
21923295-ATTT-A 19761409-ATTT-A 15×T***
14316186-CTT-C,CT 12195480-CTT-C,CT 14×T***
18926909-A-T 16815029-A-T ***
24328468-T-C 22182321-T-C P3_t1 ***
22536603-C-A 20374717-C-A ***
24804389-C-T 22658242-C-T P3_b2 ***
24947022-A-C 22800875-A-C g1 ***
25214674-T-C 23068527-T-C P2_r1 ***
28784495-G-A 26638348-G-A ***
23196197-G-T 21034311-G-T ***
9190278-C-T 9352669-C-T ***
13958765-C-T 11838059-C-T ***
14585846-G-T 12474046-G-T ***
9334611-C-A 9497002-C-A ***
16931693-G-T 14819813-G-T ***
13938879-T-C 11818173-T-C ***
16409009-G-T 14297129-G-T ***
22489666-G-T 20327780-G-T DYZ19 ***
17170207-G-T 15058327-G-T ***
13484066-G-T 11328390-G-T ***
10751066-T-A ***
10751041-T-A ***
10980687-A-G ***
19391771-C-A 17279891-C-A ***
56836993-T-G ***
56837015-C-CCATTA ***
13488839-C-T 11333163-C-T ***
7142465-T-C 7274424-T-C ***
19411976-G-A 17300096-G-A ***
7201630-CTT-C 7333589-CTT-C 11×T***
22122274-T-C 19960388-T-C ***
14367949-G-T 12247245-G-T ***
18688347-T-C 16576467-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page