Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z198 > ZS312 > Z262 > M167 > Z264 > Z205 > ~22224168-A-C > Z206/S235 > Z208/S362 > 13874340-T-C

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
154890
BigY2
154890
13695100-T-G 11539424-T-G A*
28817910-C-A 26671763-C-A A*
22305357-A-T 20143471-A-T DYZ19 ***A*
24262329-A-G 22116182-A-G P3_b1 ***A*
22254358-A-C 20092472-A-C FGC38198 BY1876 DYZ19 ***A*
22252726-A-C 20090840-A-C BY1871 DYZ19 ***A*
13695095-T-C 11539419-T-C A*
13687822-G-T 11532146-G-T A*
19896872-C-T 17784992-C-T P5_Prx ***A*
19851601-C-G 17739721-C-G P5_Prx ***A*
6241438-T-C 6373397-T-C IR3_Dst ***A*
13232522-A-T 11076846-A-T ++
21464964-C-G 19303078-C-G Y56728 YY++
22558068-T-A 20396182-T-A Y57940 YY++
23994453-AG-A 21848306-AG-A ***+
2658910-C-T 2790869-C-T Y44713 YY++
22256349-G-A 20094463-G-A DYZ19 ++
7512350-A-G 7644309-A-G Y46051 Y++
7903340-G-A 8035299-G-A Y46588 YY++
8102893-TG-T 8234852-TG-T ++
8139372-A-G 8271331-A-G Y46869 YY++
14700-G-T +
21740473-G-A 19578587-G-A PR3397 Y57148 YY++
21412161-A-G 19250275-A-G Y56654 YY++
9158708-C-T 9321099-C-T Y48270 **+
21192216-TC-T 19030330-TC-T ++
21129335-G-A 18967449-G-A Y56245 YY++
21081887-T-C 18920001-T-C Y56199 YY++
8745053-T-C 8877012-T-C Y47819 YY++
22457358-G-T 20295472-G-T DYZ19 +
19221170-G-A 17109290-G-A Y55542 YY++
17564449-T-G 15452569-T-G Y53422 YY++
17360614-G-T 15248734-G-T Y53155 YY++
16264120-A-T 14152240-A-T Y51611 YY++
15726862-A-G 13614982-A-G PF742 M9849 V3105 YY++
15494570-T-TA 13382690-T-TA ++
22445984-G-T 20284098-G-T DYZ19 ++
22237706-C-G 20075820-C-G DYZ19 ****
14313426-A-AGTCTACT 12192720-A-AGTCTACT ****
22280916-T-G 20119030-T-G DYZ19 ****
15889783-G-T 13777903-G-T **
15926914-A-G 13815034-A-G **
15858313-A-G 13746433-A-G **
15785980-G-A 13674100-G-A **
15763115-C-A 13651235-C-A **
15932420-T-G 13820540-T-G **
15746110-G-T 13634230-G-T **
15746103-G-T 13634223-G-T **
15395130-G-T 13283250-G-T **
15731396-G-A 13619516-G-A **
15730545-C-A 13618665-C-A **
15669796-A-G 13557916-A-G **
15533036-A-C 13421156-A-C Y50797 **
15500631-C-A 13388751-C-A **
28612219-C-A 26466072-C-A ****
15380417-A-G 13268537-A-G **
14717569-T-C 12605637-T-C **
14517227-C-A 12405428-C-A **
14552472-A-G 12440673-A-G **
14558574-C-A 12446775-C-A **
14589893-G-C 12478093-G-C **
14645147-G-T 12533216-G-T **
14645490-C-A 12533554-C-A **
14741279-C-A 12629347-C-A **
15247437-T-G 13135523-T-G **
14761349-C-A 12649418-C-A **
14765227-C-G 12653296-C-G **
14909585-G-A 12797652-G-A **
14964403-G-T 12852478-G-T **
15045504-A-T 12933594-A-T **
15198658-TC-T 13086744-TC-T **
15962636-G-T 13850756-G-T **
16492935-A-C 14381055-A-C **
15987287-C-A 13875407-C-A **
14490818-C-A 12370087-C-A **
17374576-C-A 15262696-C-A **
17374557-G-C 15262677-G-C **
17306780-A-G 15194900-A-G **
17128616-C-A 15016736-C-A **
17104067-C-A 14992187-C-A **
17006259-TTC-T 14894379-TTC-T **
17002733-T-C 14890853-T-C **
16738599-G-T 14626719-G-T **
16659014-G-T 14547134-G-T **
16654854-C-A 14542974-C-A **
16625714-C-A 14513834-C-A **
16605637-T-G 14493757-T-G **
16602867-C-T 14490987-C-T **
16593843-A-G 14481963-A-G **
16490746-G-A 14378866-G-A **
15999974-G-T 13888094-G-T **
16317015-C-A 14205135-C-A **
16028554-A-T 13916674-A-T **
16028591-T-C 13916711-T-C **
16032289-G-T 13920409-G-T **
16044198-A-G 13932318-A-G **
16216726-C-A 14104846-C-A **
16266085-C-T 14154205-C-T Y51617 **
16356956-C-G 14245076-C-G **
16479936-A-T 14368056-A-T **
16423524-C-A 14311644-C-A **
16423660-A-C 14311780-A-C **
16429592-C-T 14317712-C-T **
16458288-A-T 14346408-A-T **
16469226-G-A 14357346-G-A **
16471000-C-T 14359120-C-T **
14506058-G-T 12394263-G-T **
13893677-C-A 11772971-C-A **
14485264-G-T 12364533-G-T **
10876360-C-A **
11027447-A-G **
11018966-G-C **
11018957-C-A **
11018940-T-TC **
11018939-G-C **
11018938-T-A **
11009243-T-C **
10985531-T-G **
10985523-C-G **
10973172-C-A **
10944695-T-C **
10932605-C-A **
10932485-C-A **
10924415-T-C **
10868666-G-T **
13217520-T-G 11061844-T-G **
10863734-G-T **
10846300-C-A **
10846226-C-A **
10844322-C-G **
10840115-C-A **
10836317-C-A **
10836104-C-A **
10811492-C-A **
10808982-C-A **
10808000-C-A **
10803884-T-C **
10801338-A-C **
10781644-C-A **
10780060-C-A **
11031049-C-A **
13248501-G-T 11092825-G-T **
14456011-C-A 12335284-C-A **
13938805-C-A 11818099-C-A **
14423779-C-A 12303054-C-A **
14408723-G-C 12288021-G-C Y49505 **
14402076-AGGTGAAGCACAGAGAATTTTTAGGGCAGTGAAACTGCTCTGTGTAATACTACAAT-A 12281373-AGGTGAAGCACAGAGAATTTTTAGGGCAGTGAAACTGCTCTGTGTAATACTACAAT-A **
14373531-C-A 12252827-C-A **
14364220-T-C 12243515-T-C **
14295408-T-A 12174702-T-A **
14283880-C-A 12163174-C-A **
14241894-C-T 12121188-C-T **
14226477-C-A 12105771-C-A **
14179744-C-A 12059038-C-A **
14158181-G-T 12037475-G-T **
14153019-A-G 12032313-A-G **
14080069-T-G 11959363-T-G **
14067273-T-G 11946567-T-G **
13930141-C-A 11809435-C-A **
13304877-A-C 11149201-A-C **
13569542-T-C 11413866-T-C **
13327522-C-T 11171846-C-T **
13330389-AT-A 11174713-AT-A **
13411185-G-A 11255509-G-A **
13462340-C-A 11306664-C-A **
13487756-A-C 11332080-A-C **
13558265-C-A 11402589-C-A **
13643496-C-A 11487820-C-A **
13895820-A-T 11775114-A-T **
11656803-GA-G **
11656851-T-G **
11665690-G-T **
13859820-G-A 11739114-G-A **
13890356-G-T 11769650-G-T **
17504021-G-T 15392141-G-T **
17381219-A-G 15269339-A-G Y53182 **
18605302-T-C 16493422-T-C **
17515444-G-T 15403564-G-T **
22954675-A-G 20792789-A-G **
23831292-G-A 21669406-G-A **
23465651-G-T 21303765-G-T **
23401528-C-A 21239642-C-A **
23363702-G-T 21201816-G-T **
23310561-C-A 21148675-C-A **
23267155-C-A 21105269-C-A **
23252675-G-T 21090789-G-T **
23199732-C-A 21037846-C-A **
23120011-C-A 20958125-C-A **
23091498-C-A 20929612-C-A **
23048258-C-A 20886372-C-A **
23004127-C-A 20842241-C-A **
22997545-T-C 20835659-T-C **
22972701-CT-C 20810815-CT-C **
22916777-C-A 20754891-C-A **
24235427-AC-A 22089280-AC-A P3_b1 **
22851535-A-C 20689649-A-C **
22838742-G-T 20676856-G-T **
22810067-C-A 20648181-C-A **
22775303-C-A 20613417-C-A **
22774956-G-C 20613070-G-C **
22548147-G-T 20386261-G-T **
22537275-CAAAAAA-C 20375389-CAAAAAA-C 15×A**
22205520-G-T 20043634-G-T **
22076924-T-C 19915038-T-C **
22056312-C-A 19894426-C-A **
21993811-C-A 19831925-C-A **
21910000-C-A 19748114-C-A **
21856574-T-G 19694688-T-G **
21775315-G-T 19613429-G-T **
23997492-C-A 21851345-C-A **
24378434-C-A 22232287-C-A **
21624713-A-G 19462827-A-G **
28513736-A-G 26367589-A-G **
56875438-A-G **
56865511-G-T **
56847242-G-T **
56847203-G-T **
56843025-G-T **
56838709-T-C **
28741127-C-G 26594980-C-G **
28727727-C-A 26581580-C-A **
28701815-C-A 26555668-C-A **
28630363-G-T 26484216-G-T **
28619295-C-A 26473148-C-A **
28581391-C-A 26435244-C-A **
28546768-T-G 26400621-T-G **
28518275-G-T 26372128-G-T **
28511568-G-T 26365421-G-T **
24402155-C-A 22256008-C-A **
26834928-T-C 24688781-T-C P1_g2 **
24466408-T-G 22320261-T-G **
24466436-T-G 22320289-T-G **
24475381-C-A 22329234-C-A **
26015326-AT-A 23869179-AT-A P1_Y1 **
26314890-C-A 24168743-C-A P1_Y1 **
26415639-T-G 24269492-T-G P1_Y1 **
27029638-G-T 24883491-G-T P1_r4 **
28497277-C-A 26351130-C-A **
27641431-T-A 25495284-T-A P1_Y2 **
27902214-T-A 25756067-T-A P1_Y2 **
28024612-A-G 25878465-A-G P1_Y2 **
28111756-T-C 25965609-T-C P1_Y2 **
28375896-C-G 26229749-C-G P1_gr2 **
28483754-G-T 26337607-G-T **
21678014-A-C 19516128-A-C **
21624679-C-G 19462793-C-G **
17527301-C-A 15415421-C-A **
18543360-T-C 16431480-T-C **
19014662-A-G 16902782-A-G **
18982474-C-A 16870594-C-A **
18915275-C-A 16803395-C-A **
18906273-C-A 16794393-C-A **
18902141-T-C 16790261-T-C **
18873824-C-A 16761944-C-A **
18855608-C-A 16743728-C-A **
18853515-G-T 16741635-G-T **
18838882-C-A 16727002-C-A **
18838621-C-A 16726741-C-A Z44423 **
18754743-C-T 16642863-C-T **
18650970-G-T 16539090-G-T **
14846867-A-G 12734933-A-G CTS3338 **
18593321-C-A 16481441-C-A **
18406496-C-A 16294616-C-A P6_Gap **
19043771-A-G 16931891-A-G **
18022300-C-T 15910420-C-T **
17547522-C-A 15435642-C-A **
17691982-G-A 15580102-G-A **
17691993-C-T 15580113-C-T **
17840439-G-A 15728559-G-A **
17860070-G-T 15748190-G-T **
17884178-G-T 15772298-G-T **
18034590-G-A 15922710-G-A Y54097 **
18275012-C-T 16163132-C-T P6_Prx **
18050462-T-C 15938582-T-C **
18085545-A-C 15973665-A-C **
18086015-G-T 15974135-G-T **
18154372-C-A 16042492-C-A **
18156287-C-A 16044407-C-A **
18230674-T-C 16118794-T-C **
19040694-T-C 16928814-T-C **
19112656-C-A 17000776-C-A **
21624646-C-A 19462760-C-A **
21164738-C-A 19002852-C-A **
21551461-C-T 19389575-C-T **
21515857-C-A 19353971-C-A **
21503086-G-T 19341200-G-T **
21476368-C-A 19314482-C-A **
21476313-C-A 19314427-C-A **
21467988-T-C 19306102-T-C **
21448466-G-T 19286580-G-T **
21409068-C-A 19247182-C-A **
21394039-T-C 19232153-T-C **
21393939-C-T 19232053-C-T **
21351769-C-A 19189883-C-A **
21275906-G-T 19114020-G-T **
21238089-C-G 19076203-C-G **
21211780-C-T 19049894-C-T **
21104971-T-C 18943085-T-C **
19324090-CA-C 17212210-CA-C **
20242480-G-T 18080594-G-T P5_Dst **
19393213-C-A 17281333-C-A **
19512443-T-C 17400563-T-C **
19531455-A-C 17419575-A-C **
19535647-A-G 17423767-A-G **
19544504-G-T 17432624-G-T **
19644634-A-G 17532754-A-G P5_Prx **
20592987-A-G 18431101-A-G P5_Dst **
21054379-C-CAAA 18892493-C-CAAA 18×A**
20593025-A-T 18431139-A-T P5_Dst **
20629095-T-TCC 18467209-T-TCC P4_Prx **
20712426-G-C 18550540-G-C P4_Prx **
20829816-C-A 18667930-C-A P4_Gap **
20927101-T-TC 18765215-T-TC P4_Dst **
21009208-A-ATG 18847322-A-ATG P4_Dst **
10776835-C-A **
10776105-C-A **
10756528-C-A **
10901601-C-A **
2785980-T-C 2917939-T-C **
2784535-C-A 2916494-C-A **
2772900-C-A 2904859-C-A **
2758280-A-G 2890239-A-G **
2758240-T-C 2890199-T-C **
2672078-G-T 2804037-G-T **
16036206-C-A 13924326-C-A **
7195271-G-T 7327230-G-T **
13208100-C-A 11052424-C-A **
6729650-G-T 6861609-G-T **
4094498-C-A 4226457-C-A **
16341125-C-A 14229245-C-A **
16053496-C-A 13941616-C-A **
10654231-C-A **
10788589-C-A **
2930415-G-T 3062374-G-T **
14158194-C-A 12037488-C-A **
21602836-C-A 19440950-C-A **
28463863-C-A 26317716-C-A **
6930871-C-A 7062830-C-A **
7021886-T-G 7153845-T-G **
10801341-C-A **
10816582-G-T **
24509383-C-A 22363236-C-A **
5887721-C-A 6019680-C-A **
7269346-C-A 7401305-C-A **
15612233-C-CAT 13500353-C-CAT **
56838454-G-A **
14550660-C-A 12438861-C-A **
16489982-C-A 14378102-C-A **
2845762-C-A 2977721-C-A **
2967120-G-A 3099079-G-A **
14546821-C-A 12435022-C-A **
3817473-CT-C 3949432-CT-C **
4094598-C-A 4226557-C-A **
4081500-C-A 4213459-C-A **
4078590-G-T 4210549-G-T **
4067549-T-C 4199508-T-C **
4067508-CTTT-C 4199467-CTTT-C 29×T**
4049563-T-A 4181522-T-A **
4003061-C-A 4135020-C-A **
3922954-A-G 4054913-A-G **
3914698-C-A 4046657-C-A **
3895735-C-A 4027694-C-A **
3851610-C-A 3983569-C-A **
3833564-T-A 3965523-T-A **
3821141-C-A 3953100-C-A **
3818512-G-C 3950471-G-C **
3804838-C-A 3936797-C-A **
2985855-T-G 3117814-T-G **
3584834-T-G 3716793-T-G **
3285112-T-C 3417071-T-C **
3385284-C-A 3517243-C-A **
3428298-C-A 3560257-C-A **
3440374-A-T 3572333-A-T **
3451356-C-A 3583315-C-A **
3568773-C-A 3700732-C-A **
3605839-T-A 3737798-T-A **
3790653-C-A 3922612-C-A **
3616880-G-T 3748839-G-T **
3635223-A-G 3767182-A-G **
3681432-G-T 3813391-G-T **
3690398-G-T 3822357-G-T **
3707401-G-T 3839360-G-T **
3773043-G-T 3905002-G-T **
2853613-C-A 2985572-C-A **
13468068-T-G 11312392-T-G **
4133912-G-C 4265871-G-C **
11018947-T-C **
19506980-C-A 17395100-C-A **
17385563-C-A 15273683-C-A **
4178050-C-A 4310009-C-A **
10828694-T-A **
19992570-AT-A 17880690-AT-A P5_Prx 9×T**
10977100-C-T **
13216424-C-A 11060748-C-A **
20869231-T-TG 18707345-T-TG P4_Dst **
4129716-C-A 4261675-C-A **
6252869-A-G 6384828-A-G IR3_Dst **
24910908-T-A 22764761-T-A g1 **
17012971-C-A 14901091-C-A **
14561242-C-A 12449443-C-A **
4179238-C-A 4311197-C-A **
17946944-G-TTT 15835064-G-TTT **
13217169-C-A 11061493-C-A **
21834117-AAT-A 19672231-AAT-A **
22893301-ATTCCTTTC-A 20731415-ATTCCTTTC-A ****
58993295-A-G 56847148-A-G **
3703696-G-T 3835655-G-T **
3967055-C-T 4099014-C-T Z18641 **
13491738-C-A 11336062-C-A **
17203308-C-T 15091428-C-T **
25246449-T-TC 23100302-T-TC P2_r1 **
16045746-C-A 13933866-C-A **
3847439-C-A 3979398-C-A **
10965516-C-A **
3875978-C-A 4007937-C-A **
10797994-C-G **
10797995-CATA-C **
16412420-C-A 14300540-C-A **
10892021-C-A **
3866057-C-A 3998016-C-A **
13468063-T-A 11312387-T-A **
24435580-C-A 22289433-C-A **
13468061-G-A 11312385-G-A **
16653351-C-A 14541471-C-A **
6751557-C-A 6883516-C-A **
23438847-C-A 21276961-C-A **
10801782-A-AT **
17722536-C-A 15610656-C-A **
15106660-C-A 12994748-C-A **
28648433-G-GT 26502286-G-GT 10×T**
15619396-C-A 13507516-C-A **
4585440-C-A 4717399-C-A **
14933701-G-A 12821766-G-A **
7456760-C-A 7588719-C-A IR1_L **
15122221-C-A 13010308-C-A **
10661643-C-A **
14464286-C-A 12343559-C-A **
16028585-C-A 13916705-C-A **
13974646-G-T 11853940-G-T **
22165181-C-G 20003295-C-G **
2967165-G-C 3099124-G-C **
5710565-C-A 5842524-C-A **
8987271-C-A 9149662-C-A **
10800240-C-A **
23633414-A-C 21471528-A-C **
21513917-T-C 19352031-T-C **
7269639-TGA-T 7401598-TGA-T **
5601037-C-A 5732996-C-A **
16612656-G-A 14500776-G-A **
22851538-C-A 20689652-C-A **
9440411-AT-A 9602802-AT-A 9×T**
22428552-C-A 20266666-C-A DYZ19 **
5586579-C-A 5718538-C-A **
4107264-A-C 4239223-A-C **
27544-T-G **
4136932-A-C 4268891-A-C **
4301965-C-A 4433924-C-A **
7248565-C-A 7380524-C-A **
7240717-C-A 7372676-C-A **
7222629-C-A 7354588-C-A **
7222614-C-A 7354573-C-A **
7166755-C-A 7298714-C-A **
7148245-A-C 7280204-A-C **
7134820-G-T 7266779-G-T **
7113651-A-C 7245610-A-C **
7108587-A-G 7240546-A-G **
7081820-C-A 7213779-C-A **
7039171-C-A 7171130-C-A **
7028521-G-A 7160480-G-A **
6978212-T-C 7110171-T-C **
6917736-C-A 7049695-C-A **
7347677-C-T 7479636-C-T **
6917073-T-C 7049032-T-C **
6855404-C-G 6987363-C-G **
6808110-G-A 6940069-G-A Y45317 **
6807870-A-C 6939829-A-C **
6773922-A-C 6905881-A-C **
6771730-C-A 6903689-C-A **
6759207-C-A 6891166-C-A **
6732394-C-A 6864353-C-A **
6729637-T-G 6861596-T-G **
6729629-T-G 6861588-T-G **
6667379-C-A 6799338-C-A **
6666367-C-G 6798326-C-G **
6647969-T-C 6779928-T-C **
7286968-C-A 7418927-C-A **
7670828-C-A 7802787-C-A **
6434638-T-G 6566597-T-G **
9571871-TGTG-T 9734262-TGTG-T IR3_Prx **
10754714-C-A **
10686004-G-A **
10678154-ATCCAT-A **
10670755-T-C **
10652118-ATTCCA-G **
10093777-C-T 10256168-C-T **
10046140-T-C 10208531-T-C **
10040850-T-C 10203241-T-C **
10025065-C-A 10187456-C-A **
9937100-T-G 10099491-T-G **
9925044-C-A 10087435-C-A **
9824265-A-C 9986656-A-C **
9700765-A-G 9863156-A-G IR3_Prx **
9571870-G-T 9734261-G-T IR3_Prx **
7670876-C-A 7802835-C-A **
9521250-G-T 9683641-G-T **
9385169-C-A 9547560-C-A **
9357270-C-G 9519661-C-G **
8981031-G-T 9143422-G-T **
8856300-C-A 8988259-C-A **
8807448-C-T 8939407-C-T **
8713720-T-C 8845679-T-C **
8674195-G-T 8806154-G-T **
8389732-C-A 8521691-C-A **
8321631-C-A 8453590-C-A **
8279698-C-A 8411657-C-A **
8214037-C-A 8345996-C-A **
8052623-T-A 8184582-T-A **
7753138-C-A 7885097-C-A **
6454642-C-A 6586601-C-A **
6953379-C-A 7085338-C-A **
6419108-G-T 6551067-G-T **
4922161-G-T 5054120-G-T **
5426665-A-C 5558624-A-C **
5426635-C-A 5558594-C-A **
5401483-T-A 5533442-T-A **
5323894-C-A 5455853-C-A **
5200259-C-A 5332218-C-A **
5066209-G-A 5198168-G-A **
5059672-A-G 5191631-A-G **
5059565-C-A 5191524-C-A **
5010899-G-T 5142858-G-T **
4936984-T-C 5068943-T-C **
4931545-T-G 5063504-T-G **
4931530-G-T 5063489-G-T **
4804612-A-G 4936571-A-G **
5667199-G-T 5799158-G-T **
4804525-C-G 4936484-C-G **
4755068-TTGATTTTATGTA-T 4887027-TTGATTTTATGTA-T **
4755022-T-C 4886981-T-C **
4671635-T-C 4803594-T-C **
4563624-A-G 4695583-A-G **
4557608-T-A 4689567-T-A **
4540303-C-A 4672262-C-A **
4505256-C-A 4637215-C-A **
4371088-A-G 4503047-A-G **
4371083-T-G 4503042-T-G **
4357659-A-AG 4489618-A-AG **
4357647-GT-G 4489606-GT-G **
4357590-A-T 4489549-A-T **
5442009-G-C 5573968-G-C **
4964672-C-A 5096631-C-A **
5690222-G-T 5822181-G-T **
6267715-AG-A 6399674-AG-A IR3_Dst **
6419065-T-G 6551024-T-G **
6063361-G-T 6195320-G-T **
5867399-C-A 5999358-C-A **
5861128-C-A 5993087-C-A **
6084919-A-G 6216878-A-G **
6303546-G-C 6435505-G-C IR3_Dst **
6086028-T-C 6217987-T-C **
5845907-C-T 5977866-C-T **
6114336-C-A 6246295-C-A **
5701114-G-T 5833073-G-T **
6090942-A-T 6222901-A-T **
6384338-G-T 6516297-G-T **
9811183-G-T 9973574-G-T ***
23818085-G-T 21656199-G-T ***
10627693-ATC-A ***
14380243-G-T 12259539-G-T ***
10023209-C-A 10185600-C-A ***
16734397-A-G 14622517-A-G ***
10863827-C-A ***
13468107-GC-G 11312431-GC-G ***
19065315-G-T 16953435-G-T ***
9798127-G-T 9960518-G-T ***
10809325-CTCCATTCCAT-C,CTCCAT ***
28605579-C-A 26459432-C-A ***
10627697-CATT-C ***
56841590-C-T ***
22224032-A-T 20062146-A-T DYZ19 ***
9041-C-A ***
22249620-T-A 20087734-T-A DYZ19 ***
22425045-C-A 20263159-C-A DYZ19 ***
22436273-T-G 20274387-T-G DYZ19 ***
24223325-AC-A 22077178-AC-A P3_b1 ***
24809389-A-G 22663242-A-G P3_b2 ***
26193718-G-A 24047571-G-A P1_Y1 ***
19127858-CAA-C,CAAA 17015978-CAA-C,CAAA 17×A***
56833038-C-A ***
56742759-GT-AT,G ***
24223321-GAA-G 22077174-GAA-G P3_b1 ***
16539794-G-T 14427914-G-T ***
4325984-C-A 4457943-C-A ***
19479120-G-A 17367240-G-A ***
17246725-TA-T 15134845-TA-T ***
28605533-C-A 26459386-C-A ***
14324894-CTTTTT-C,CTTTT 12204188-CTTTTT-C,CTTTT 26×T***
18951682-C-A 16839802-C-A ***
18986528-C-A 16874648-C-A ***
13448795-ACTCCG-A,ACTCCT 11293119-ACTCCG-A,ACTCCT ***
5060913-G-T 5192872-G-T ***
7337502-C-A 7469461-C-A ***
13450406-CTCCACTCCATTCCATTCCATTCTATTCCATTCCAT-C,CTCCACTGCATTCCATTCAATTCTATTCCATTCCAT 11294730-CTCCACTCCATTCCATTCCATTCTATTCCATTCCAT-C,CTCCACTGCATTCCATTCAATTCTATTCCATTCCAT ***
15684679-A-T 13572799-A-T ***
5317057-G-T 5449016-G-T ***
14898443-TTTTTTTTCCAGGTA-T,TTTTTTTCCAGGTA 12786510-TTTTTTTTCCAGGTA-T,TTTTTTTCCAGGTA ***
21394697-G-T 19232811-G-T ***
13228753-AG-A 11073077-AG-A ***
18190469-C-A 16078589-C-A ***
16320202-G-T 14208322-G-T ***
13708994-G-A 11553318-G-A ***
10667034-C-A ***
13854371-TG-T 11733665-TG-T ***
21540979-C-A 19379093-C-A ***
15065023-C-A 12953115-C-A ***
13236497-A-G 11080821-A-G ***
13226723-T-G 11071047-T-G ***
13215844-AT-A,ATT 11060168-AT-A,ATT 16×T***
10804769-C-A ***
24363930-T-C 22217783-T-C ***
2813791-A-G 2945750-A-G ***
10983592-C-G ***
17387290-GTGTGTA-G 15275410-GTGTGTA-G ***
10757353-T-C ***
23419147-C-A 21257261-C-A ***
10996316-T-C ***
11015952-C-A ***
13468087-G-T 11312411-G-T ***
3790887-TA-T 3922846-TA-T ***
14717800-G-T 12605868-G-T ***
13468096-T-C 11312420-T-C ***
23061915-G-T 20900029-G-T ***
8281694-A-T 8413653-A-T ***
19461169-C-G 17349289-C-G ***
21238000-C-A 19076114-C-A ***
17503951-G-T 15392071-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page