Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > CTS3386 > S19268 > FGC13300

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
N122185
BigY2
N122185
19724563-C-T 17612683-C-T P5_Prx A*
19583606-A-G 17471726-A-G P5_Prx Y***A*
6238762-G-A 6370721-G-A IR3_Dst ***A*
6326101-C-G 6458060-C-G IR3_Dst ***A*
25870606-G-A 23724459-G-A P1_Y1 ***A*
22438273-T-A 20276387-T-A DYZ19 ***A*
19984469-T-C 17872589-T-C P5_Prx ***A*
22304510-T-C 20142624-T-C DYZ19 ***A*
21193339-TG-T 19031453-TG-T ++
17712627-A-G 15600747-A-G FGC46361 YY++
18045470-T-G 15933590-T-G YFS4300239 YY++
18045476-T-C 15933596-T-C Y101071 YY++
18890213-A-G 16778333-A-G FGC46363 YY++
19198528-C-T 17086648-C-T FGC46364 YY++
23466673-T-C 21304787-T-C FGC46351 YY++
19060541-CT-C 16948661-CT-C ++
16626104-G-T 14514224-G-T FGC46358 YY++
22464841-A-T 20302955-A-T FGC46365 DYZ19 ++
22478590-T-A 20316704-T-A FGC46366 DYZ19 ++
22507076-T-A 20345190-T-A DYZ19 ***+
22581866-C-T 20419980-C-T FGC46367 YY++
22704297-C-T 20542411-C-T FGC46368 YY++
23422678-A-G 21260792-A-G FGC46369 YY++
17329719-A-C 15217839-A-C FGC46360 YY++
17111458-A-T 14999578-A-T FGC46359 YY++
16225431-G-A 14113551-G-A FGC46352 YY++
13556491-A-T 11400815-A-T FGC46355 ++
18122313-G-A 16010433-G-A Z29525FGC46362 YY++
14645726-T-C 12533790-T-C FGC46357 YY++
14590455-A-C 12478655-A-C FGC46356 YY++
18472830-A-ATATTT 16360950-A-ATATTT P6_Dst 6×TATTT**+
7564476-T-C 7696435-T-C FGC46354 YY++
15458677-A-G 13346797-A-G FGC41743 ZS9823 YY++
7160067-G-A 7292026-G-A FGC46353 YY++
6398816-G-A 6530775-G-A YFS4299967 +
22279207-G-A 20117321-G-A DYZ19 ****
22318875-G-T 20156989-G-T DYZ19 ****
22279706-C-T 20117820-C-T DYZ19 *
14911907-T-G 12799974-T-G **
15450180-C-T 13338300-C-T **
15655411-AT-A 13543531-AT-A **
15685387-C-T 13573507-C-T **
15650576-T-A 13538696-T-A **
15050086-C-A 12938177-C-A **
15439981-C-A 13328101-C-A **
15127784-T-C 13015871-T-C **
15429619-A-G 13317739-A-G **
15370670-A-G 13258790-A-G **
15368180-A-G 13256300-A-G **
15302239-T-A 13190338-T-A **
15146715-A-T 13034802-A-T **
15146642-C-G 13034729-C-G **
14911887-A-G 12799954-A-G **
56883016-G-C **
14735132-C-A 12623200-C-A A12987 **
14911885-A-G 12799952-A-G **
14558481-C-A 12446682-C-A **
14495669-T-C 12383866-T-C **
14524082-C-A 12412283-C-A **
14527552-C-A 12415753-C-A **
14537882-A-G 12426083-A-G **
14537884-A-G 12426085-A-G **
14540698-G-T 12428899-G-T **
14552477-T-C 12440678-T-C **
14605178-A-C 12493380-A-C **
14802957-C-T 12691028-C-T **
14607594-C-A 12495796-C-A **
14620867-C-A 12509065-C-A **
15731055-C-A 13619175-C-A **
14757328-C-A 12645397-C-A **
14793182-G-A 12681253-G-A **
14802949-C-T 12691020-C-T **
14802955-A-G 12691026-A-G **
15687941-C-A 13576061-C-A **
16060204-T-A 13948324-T-A **
15745623-C-A 13633743-C-A **
16490230-C-A 14378350-C-A **
16342366-GAGAA-G 14230486-GAGAA-G 5×AGAA**
16352562-G-C 14240682-G-C **
16352677-A-C 14240797-A-C **
16356788-C-A 14244908-C-A **
16405501-G-A 14293621-G-A **
16427390-T-A 14315510-T-A **
16476313-C-A 14364433-C-A **
16522948-C-A 14411068-C-A **
16176734-A-G 14064854-A-G **
16577620-C-A 14465740-C-A **
16602705-C-A 14490825-C-A **
16617520-C-A 14505640-C-A **
16656695-A-C 14544815-A-C **
16678464-C-T 14566584-C-T **
16738799-G-T 14626919-G-T **
16829270-T-G 14717390-T-G **
16184311-T-A 14072431-T-A **
16171610-G-A 14059730-G-A **
15842989-A-G 13731109-A-G **
16037287-A-G 13925407-A-G **
15843016-A-G 13731136-A-G **
15931751-G-C 13819871-G-C **
15969915-C-A 13858035-C-A **
15969928-G-A 13858048-G-A **
16004261-A-T 13892381-A-T **
16009698-A-G 13897818-A-G **
16016296-C-G 13904416-C-G **
16039080-G-C 13927200-G-C **
16121180-A-G 14009300-A-G P8_Prx **
16046450-A-C 13934570-A-C **
16050406-G-T 13938526-G-T **
16055090-T-C 13943210-T-C **
16055217-G-A 13943337-G-A **
16055218-A-C 13943338-A-C **
14471831-G-T 12351100-G-T **
16071242-C-T 13959362-C-T **
14483575-A-G 12362844-A-G **
13945304-G-A 11824598-G-A **
14468365-G-T 12347634-G-T **
11030044-C-A **
10989048-A-T **
10989088-A-G **
10989134-C-A **
10989146-C-T **
11000582-C-A **
11001645-T-G **
11037135-C-CCGCAA **
10984878-C-A **
11037160-C-A **
11037180-T-G **
11038200-C-A **
13218788-C-A 11063112-C-A **
13218840-A-C 11063164-A-C **
13218874-G-A 11063198-G-A **
13227977-C-A 11072301-C-A **
10985993-C-A **
10973447-C-A **
13249228-C-A 11093552-C-A **
10924362-C-G **
10922130-C-T **
10922134-A-G **
10922140-T-C **
10922146-T-C **
10922172-CCACCT-C **
10924112-T-C **
10924361-C-A **
10936768-A-T **
10954813-C-T **
10943532-C-A **
10943616-T-C **
10945829-C-G **
10945862-T-A **
10954396-T-G **
10954739-T-C **
10954777-A-T **
13228116-C-G 11072440-C-G **
13258744-T-C 11103068-T-C **
14467775-A-G 12347044-A-G **
14225414-A-C 12104708-A-C **
14032212-G-T 11911506-G-T **
14080228-A-G 11959522-A-G **
14108712-A-T 11988006-A-T **
14113849-T-C 11993143-T-C **
14159567-G-A 12038861-G-A **
14181127-C-G 12060421-C-G **
14224183-G-C 12103477-G-C **
14240041-T-G 12119335-T-G **
13942349-A-G 11821643-A-G **
14250509-A-G 12129803-A-G **
14302245-C-T 12181539-C-T **
14355271-G-A 12234566-G-A **
14355309-C-A 12234604-C-A **
14420248-C-A 12299523-C-A **
14425673-T-G 12304948-T-G **
14458228-C-A 12337501-C-A **
17029112-A-C 14917232-A-C **
13928779-A-C 11808073-A-C **
13461055-G-C 11305379-G-C **
13707790-A-C 11552114-A-C **
13487873-G-A 11332197-G-A **
13502355-G-A 11346679-G-A **
13513501-C-A 11357825-C-A **
13546989-A-ATT 11391313-A-ATT 16×T**
13586139-C-A 11430463-C-A **
13642326-A-G 11486650-A-G **
13705300-C-A 11549624-C-A **
13714760-C-G 11559084-C-G **
13926450-G-T 11805744-G-T **
11650266-C-A **
13855625-G-C 11734919-G-C **
13855706-A-C 11735000-A-C **
13895203-A-T 11774497-A-T **
13898761-T-TA 11778055-T-TA **
13907165-A-G 11786459-A-G **
13907181-T-G 11786475-T-G **
17014383-G-A 14902503-G-A YFS4300233 **
17466667-C-A 15354787-C-A **
17029184-G-T 14917304-G-T **
23321834-C-G 21159948-C-G **
23184332-A-T 21022446-A-T **
23188599-C-T 21026713-C-T **
23201030-G-C 21039144-G-C **
23225445-A-G 21063559-A-G **
23231552-T-C 21069666-T-C **
23306534-T-C 21144648-T-C **
23321844-C-G 21159958-C-G **
23184319-C-T 21022433-C-T **
23355417-A-G 21193531-A-G **
23355438-T-A 21193552-T-A **
23512274-T-G 21350388-T-G **
23725342-G-T 21563456-G-T **
24373336-A-T 22227189-A-T **
24373346-T-C 22227199-T-C **
24373357-G-A 22227210-G-A **
23184327-T-C 21022441-T-C **
23066621-C-A 20904735-C-A **
24513281-C-A 22367134-C-A **
22171478-G-T 20009592-G-T FGC65244 **
21668927-C-A 19507041-C-A **
21669066-C-G 19507180-C-G **
21834117-A-AAT 19672231-A-AAT **
21895624-T-G 19733738-T-G **
22146616-C-T 19984730-C-T **
22150140-T-C 19988254-T-C **
22170156-G-T 20008270-G-T **
22277805-T-G 20115919-T-G DYZ19 **
23066562-A-G 20904676-A-G **
22530186-C-A 20368300-C-A **
22564775-C-A 20402889-C-A **
22880772-G-A 20718886-G-A **
22965340-C-A 20803454-C-A **
23005562-G-C 20843676-G-C **
23048339-A-C 20886453-A-C **
23066403-T-G 20904517-T-G **
24373403-T-C 22227256-T-C **
25403097-C-G 23256950-C-G P2_r2 **
21522577-G-C 19360691-G-C **
28700728-T-C 26554581-T-C **
28559723-A-C 26413576-A-C **
28560154-C-A 26414007-C-A **
28624731-A-T 26478584-A-T **
28624778-C-A 26478631-C-A **
28640044-T-G 26493897-T-G **
28643434-A-C 26497287-A-C **
28725840-T-A 26579693-T-A **
28546576-C-G 26400429-C-G **
28776312-C-A 26630165-C-A **
28780207-T-G 26634060-T-G **
28793784-G-C 26647637-G-C **
28798663-G-A 26652516-G-A **
56835218-C-A **
56843842-G-T **
56879887-C-A **
28546657-A-G 26400510-A-G **
28544416-G-A 26398269-G-A **
25514628-T-TC 23368481-T-TC P1_gr1 **
27552611-A-C 25406464-A-C P1_Y2 **
26045432-G-T 23899285-G-T P1_Y1 **
26170419-G-A 24024272-G-A P1_Y1 **
26260605-G-T 24114458-G-T P1_Y1 **
26415673-TC-T 24269526-TC-T P1_Y1 **
26440635-T-C 24294488-T-C P1_Y1 **
27466739-G-GA 25320592-G-GA P1_Y2 **
27552590-G-C 25406443-G-C P1_Y2 **
27733706-AT-A 25587559-AT-A P1_Y2 **
28516656-T-G 26370509-T-G **
27815644-G-T 25669497-G-T P1_Y2 **
27949486-T-TC 25803339-T-TC P1_Y2 **
27963436-G-A 25817289-G-A P1_Y2 **
27963502-C-G 25817355-C-G P1_Y2 **
28024153-AGGAACCT-A 25878006-AGGAACCT-A P1_Y2 **
28510340-T-C 26364193-T-C **
28511045-C-A 26364898-C-A **
21543393-C-A 19381507-C-A **
21283172-CACCA-C 19121286-CACCA-C **
17046763-T-G 14934883-T-G **
17968549-A-G 15856669-A-G **
17644240-A-G 15532360-A-G **
17644321-T-G 15532441-T-G **
17693673-A-G 15581793-A-G **
17722674-C-A 15610794-C-A **
17770180-C-A 15658300-C-A **
17916596-C-T 15804716-C-T **
18055352-C-A 15943472-C-A **
17504254-C-G 15392374-C-G **
18173206-C-A 16061326-C-A **
18185206-C-A 16073326-C-A **
18187060-G-A 16075180-G-A **
18196368-G-T 16084488-G-T **
18263643-G-T 16151763-G-T **
18652495-A-G 16540615-A-G **
18652789-A-T 16540909-A-T **
17605076-C-A 15493196-C-A **
10922110-C-T **
18652814-A-T 16540934-A-T **
17144053-C-T 15032173-C-T **
17103413-T-C 14991533-T-C **
17143968-G-A 15032088-G-A **
17143970-G-T 15032090-G-T **
17143984-C-T 15032104-C-T **
17143997-C-T 15032117-C-T **
17144001-CG-C 15032121-CG-C **
17144027-G-A 15032147-G-A **
17187566-C-T 15075686-C-T 28×A**
17453225-G-T 15341345-G-T **
17199650-G-A 15087770-G-A **
17222589-TCCAAA-T 15110709-TCCAAA-T **
17276160-A-T 15164280-A-T **
17276200-G-T 15164320-G-T **
17301216-C-A 15189336-C-A **
17371054-C-A 15259174-C-A **
17407375-T-C 15295495-T-C **
18652802-T-G 16540922-T-G **
18652834-G-C 16540954-G-C **
21155189-C-T 18993303-C-T **
20440392-T-TTG 18278506-T-TTG P5_Dst 13×TTG**
19721211-A-T 17609331-A-T P5_Prx **
19737218-A-G 17625338-A-G P5_Prx **
19737239-T-G 17625359-T-G P5_Prx **
19737251-C-G 17625371-C-G P5_Prx **
19737337-T-G 17625457-T-G P5_Prx **
19739382-A-C 17627502-A-C P5_Prx **
19997265-A-C 17885385-A-C P5_Prx **
20440518-T-C 18278632-T-C P5_Dst **
19588051-T-TG 17476171-T-TG P5_Prx **
20570179-T-G 18408293-T-G P5_Dst **
20612159-A-T 18450273-A-T P4_Prx **
20627528-G-A 18465642-G-A P4_Prx **
20809577-TA-T 18647691-TA-T P4_Gap **
21012089-A-T 18850203-A-T P4_Dst **
21133440-C-A 18971554-C-A **
21141212-T-C 18979326-T-C **
19701512-A-AC 17589632-A-AC P5_Prx **
19588012-G-T 17476132-G-T P5_Prx **
18652922-G-C 16541042-G-C **
18928972-C-A 16817092-C-A **
18749432-C-A 16637552-C-A **
18767534-A-G 16655654-A-G **
18779130-T-C 16667250-T-C **
18779154-C-A 16667274-C-A **
18779168-G-C 16667288-G-C **
18844492-T-A 16732612-T-A **
18844521-C-A 16732641-C-A **
18990465-C-A 16878585-C-A **
19587976-T-G 17476096-T-G P5_Prx **
19052026-C-A 16940146-C-A **
19071345-C-A 16959465-C-A **
19127703-C-T 17015823-C-T **
19137840-C-A 17025960-C-A **
19301078-G-A 17189198-G-A **
19425211-A-T 17313331-A-T **
19438609-G-T 17326729-G-T **
10922118-C-A **
10839290-T-C **
10892674-TG-T **
3866129-A-C 3998088-A-C **
3591860-A-C 3723819-A-C **
3592518-C-A 3724477-C-A **
3599002-C-A 3730961-C-A **
3697488-A-T 3829447-A-T **
3865141-C-G 3997100-C-G **
3865453-A-G 3997412-A-G **
3877048-C-T 4009007-C-T **
3491565-C-T 3623524-C-T **
3987090-T-G 4119049-T-G **
4064030-C-A 4195989-C-A **
4065151-A-G 4197110-A-G **
4066168-C-A 4198127-C-A **
4076074-G-T 4208033-G-T **
4125658-C-A 4257617-C-A **
3591857-A-T 3723816-A-T **
3464641-G-T 3596600-G-T **
4136384-G-A 4268343-G-A **
3229037-C-G 3360996-C-G **
3047530-T-C 3179489-T-C **
3122205-A-G 3254164-A-G **
3130962-C-A 3262921-C-A **
3131986-G-T 3263945-G-T **
3148028-C-A 3279987-C-A **
3228982-T-A 3360941-T-A **
3229128-G-A 3361087-G-A **
3425757-G-T 3557716-G-T **
3253227-T-G 3385186-T-G **
3276053-TA-T 3408012-TA-T **
3328369-C-G 3460328-C-G **
3346743-G-A 3478702-G-A **
3409614-A-C 3541573-A-C **
3409663-G-C 3541622-G-C **
4133945-T-C 4265904-T-C **
4137588-C-A 4269547-C-A **
2947779-C-A 3079738-C-A **
5449316-C-A 5581275-C-A **
4999531-C-A 5131490-C-A **
5235344-T-G 5367303-T-G **
5235388-T-G 5367347-T-G **
5374114-T-G 5506073-T-G **
5374123-G-T 5506082-G-T **
5443300-A-AG 5575259-A-AG **
5458702-C-A 5590661-C-A **
4920960-C-T 5052919-C-T **
5669258-A-G 5801217-A-G **
5670157-A-G 5802116-A-G **
5728022-C-A 5859981-C-A **
5755965-G-T 5887924-G-T **
5785692-AAT-A 5917651-AAT-A **
5817590-A-C 5949549-A-C **
10884682-C-CATTCG **
4900702-A-G 5032661-A-G **
4171805-C-A 4303764-C-A **
4430475-T-A 4562434-T-A **
4201562-C-A 4333521-C-A **
4241990-T-G 4373949-T-G **
4242849-A-T 4374808-A-T **
4242904-T-A 4374863-T-A **
4308770-C-T 4440729-C-T **
4351245-A-G 4483204-A-G **
4437729-A-T 4569688-A-T **
4900683-C-G 5032642-C-G **
4448913-T-C 4580872-T-C **
4460811-C-A 4592770-C-A **
4491936-A-G 4623895-A-G **
4702803-C-A 4834762-C-A **
4755946-T-G 4887905-T-G **
4861915-C-A 4993874-C-A **
4900640-A-G 5032599-A-G **
3011502-A-G 3143461-A-G **
2905890-T-C 3037849-T-C **
5817715-T-C 5949674-T-C **
11022039-T-C **
26415749-GTT-G 24269602-GTT-G P1_Y1 14×T**
2812768-C-T 2944727-C-T **
17367678-C-A 15255798-C-A **
6474717-C-A 6606676-C-A **
16050410-C-A 13938530-C-A **
11022037-A-T **
14097945-A-T 11977239-A-T 23×T**
10669412-T-G **
15131899-T-C 13019986-T-C **
14462594-C-A 12341867-C-A **
5191285-C-A 5323244-C-A **
7287804-C-A 7419763-C-A **
5817595-A-G 5949554-A-G **
9381911-C-A 9544302-C-A **
10669415-A-T **
10669400-A-T **
10845681-C-T **
15169040-C-A 13057126-C-A **
7432312-C-G 7564271-C-G **
22241072-G-T 20079186-G-T DYZ19 *****
22448914-T-G 20287028-T-G DYZ19 **
27264826-C-T 25118679-C-T P1_g3 **
19351650-G-A 17239770-G-A Z23360 **
17737618-CAA-C 15625738-CAA-C 14×A**
10992352-C-CTGTAT **
21105490-C-A 18943604-C-A **
10655793-G-T **
11037193-C-T **
10940427-A-G **
7363813-C-A 7495772-C-A **
3388577-C-A 3520536-C-A **
27127785-T-C 24981638-T-C P1_g3 **
10845663-T-A **
19394129-T-G 17282249-T-G **
2905885-T-C 3037844-T-C **
10791337-A-T **
19412824-T-G 17300944-T-G **
17144069-C-T 15032189-C-T **
10893457-C-A **
28555642-C-A 26409495-C-A **
10791295-C-G **
10791302-ACTCCT-A **
10791345-C-T **
11037130-C-A **
9973484-C-A 10135875-C-A **
2746038-G-T 2877997-G-T **
2768394-A-C 2900353-A-C **
2790902-A-C 2922861-A-C **
2790916-T-G 2922875-T-G **
2842988-C-A 2974947-C-A **
10951205-C-A **
27963481-A-AG 25817334-A-AG P1_Y2 **
18086903-C-A 15975023-C-A **
10671450-C-A **
10924334-CTCGACTCTAT-C **
10925098-C-A **
10687919-C-A **
14757796-C-A 12645865-C-A **
23391494-C-T 21229608-C-T **
17144064-A-G 15032184-A-G **
10845655-C-A **
14802960-AG-A 12691031-AG-A **
6714480-C-T 6846439-C-T **
11037102-T-A **
17144001-C-T 15032121-C-T **
3286554-C-A 3418513-C-A **
9945068-C-A 10107459-C-A **
18753083-G-T 16641203-G-T **
10911672-C-A **
5817610-T-C 5949569-T-C **
4951485-T-C 5083444-T-C **
5852784-CA-C 5984743-CA-C **
9599332-A-AG 9761723-A-AG IR3_Prx **
9441294-T-C 9603685-T-C **
9461831-G-T 9624222-G-T **
9465222-T-C 9627613-T-C **
9501308-CA-C 9663699-CA-C **
9502520-TGGGGGGA-T 9664911-TGGGGGGA-T **
9599326-A-G 9761717-A-G IR3_Prx **
9617707-A-G 9780098-A-G IR3_Prx **
9361310-T-A 9523701-T-A **
9700816-A-T 9863207-A-T IR3_Prx **
9908451-G-T 10070842-G-T **
9938562-C-A 10100953-C-A **
9967085-G-T 10129476-G-T **
10034490-C-A 10196881-C-A **
10057046-C-A 10219437-C-A **
9441167-T-A 9603558-T-A **
9231776-A-C 9394167-A-C **
10655784-T-C **
8661115-A-G 8793074-A-G **
8074242-C-A 8206201-C-A **
8074955-T-G 8206914-T-G **
8153869-C-A 8285828-C-A **
8153883-A-G 8285842-A-G **
8295594-GA-G 8427553-GA-G 10×A**
8399143-C-A 8531102-C-A **
8720654-C-A 8852613-C-A **
9082060-C-A 9244451-C-A **
8723873-C-A 8855832-C-A **
8811181-C-A 8943140-C-A **
8832756-C-A 8964715-C-A **
8849742-G-C 8981701-G-C **
8849750-G-T 8981709-G-T **
5904562-C-A 6036521-C-A **
10655779-C-G **
10655817-A-T **
8073093-G-C 8205052-G-C **
10855848-A-C **
10813231-T-A **
10817695-C-T **
10819325-C-A **
10826964-C-A **
10830446-C-G **
10840495-T-G **
10855876-C-T **
10805277-G-T **
10858678-A-G **
10858718-T-G **
10858882-C-A **
10877848-CATTGT-C **
10880224-T-G **
10880949-T-A **
10813190-A-G **
10804932-T-C **
10655818-C-A **
10676549-T-C **
10655837-G-A **
10655842-G-T **
10655851-T-A **
10657180-C-T **
10667059-A-C **
10672078-C-A **
10689500-TTTCCA-T **
10780945-C-A **
10756417-A-T **
10756463-A-G **
10756474-A-G **
10762063-C-A **
10764371-C-A **
10764565-CA-C **
10770969-C-A **
8073112-T-C 8205071-T-C **
8986840-C-A 9149231-C-A **
6829398-A-G 6961357-A-G **
6752200-T-A 6884159-T-A **
7143069-A-G 7275028-A-G **
7100662-C-A 7232621-C-A **
6247165-G-T 6379124-G-T IR3_Dst **
7100472-G-A 7232431-G-A **
7030596-C-T 7162555-C-T **
7018027-A-ATTT 7149986-A-ATTT 24×T**
5956976-G-T 6088935-G-T **
6998082-C-A 7130041-C-A **
6948092-GTTTT-G 7080051-GTTTT-G 31×T**
6929566-C-T 7061525-C-T **
6901411-C-A 7033370-C-A **
6881248-A-G 7013207-A-G **
6832012-C-A 6963971-C-A **
6828905-C-A 6960864-C-A **
6692513-G-T 6824472-G-T **
7143184-A-G 7275143-A-G **
6066056-C-A 6198015-C-A **
6125053-T-C 6257012-T-C **
6280585-T-C 6412544-T-C IR3_Dst **
6318974-A-G 6450933-A-G IR3_Dst **
6318992-C-G 6450951-C-G IR3_Dst **
6318996-C-G 6450955-C-G IR3_Dst **
6318997-A-G 6450956-A-G IR3_Dst **
6319013-A-G 6450972-A-G IR3_Dst **
6664443-T-C 6796402-T-C **
6319029-T-G 6450988-T-G IR3_Dst **
6335081-C-G 6467040-C-G IR3_Dst **
6459693-C-A 6591652-C-A **
6491354-A-T 6623313-A-T **
6592381-A-T 6724340-A-T **
6626591-C-A 6758550-C-A **
7143131-T-G 7275090-T-G **
6228199-A-ATC 6360158-A-ATC IR3_Dst **
7159179-C-T 7291138-C-T **
7340924-G-T 7472883-G-T **
8072653-C-T 8204612-C-T **
7894961-G-C 8026920-G-C **
7821024-T-C 7952983-T-C **
7758470-C-A 7890429-C-A **
7755210-C-A 7887169-C-A **
7713344-TG-T 7845303-TG-T **
7713269-C-T 7845228-C-T **
7699348-C-G 7831307-C-G **
7646630-A-G 7778589-A-G **
7433912-A-G 7565871-A-G **
7422377-C-A 7554336-C-A **
7390520-C-A 7522479-C-A **
7371838-T-C 7503797-T-C **
7342348-G-C 7474307-G-C **
7363697-T-C 7495656-T-C **
7196213-AT-A 7328172-AT-A **
7309196-C-T 7441155-C-T **
7313261-T-A 7445220-T-A **
7182163-A-T 7314122-A-T **
7165674-C-A 7297633-C-A **
5923804-C-A 6055763-C-A **
7294576-C-T 7426535-C-T **
7309307-C-A 7441266-C-A **
7165665-G-T 7297624-G-T **
13717397-A-T 11561721-A-T ***
24969718-C-T 22823571-C-T g1 ***
25317692-T-C 23171545-T-C P2_r1 ***
26766094-G-C 24619947-G-C P1_g2 ***
25193952-T-G 23047805-T-G g1 ***
22438297-A-T 20276411-A-T DYZ19 ***
13713542-G-A,T 11557866-G-A,T ***
13720231-T-A 11564555-T-A ***
13720226-T-A 11564550-T-A ***
24099244-C-G 21953097-C-G P3_b1 ***
13715848-G-T 11560172-G-T ***
22239839-T-C 20077953-T-C DYZ19 ***
22448866-G-A 20286980-G-A DYZ19 ***
13706560-A-G 11550884-A-G ***
13705250-T-A 11549574-T-A ******
13714624-T-A 11558948-T-A ***
22245295-A-T 20083409-A-T DYZ19 ***
22429785-A-G 20267899-A-G DYZ19 ***
22249728-G-C 20087842-G-C DYZ19 ***
13714644-A-T 11558968-A-T ***
19246960-T-C 17135080-T-C ***
13705314-TGAAATGGCATGTAATGGAA-T,TGGAATGGAATGTAATGGAA 11549638-TGAAATGGCATGTAATGGAA-T,TGGAATGGAATGTAATGGAA ***
7083968-C-A 7215927-C-A ***
19356963-CAAA-C,CAA 17245083-CAAA-C,CAA 14×A***
14301911-G-T 12181205-G-T ***
9117125-C-A 9279516-C-A ***
14600771-C-A 12488971-C-A ***
18191912-C-T 16080032-C-T ***
7269631-TT-G 7401590-TT-G ***
7241813-C-T 7373772-C-T ***
7195307-CAAAAA-C,CA 7327266-CAAAAA-C,CA 16×A***
13462178-C-T 11306502-C-T ***
15221809-G-T 13109895-G-T ***
22737231-CAAAAAAAA-C 20575345-CAAAAAAAA-C 18×A***
22936288-CTTTTTTTTTT-C,CTTTTTTT 20774402-CTTTTTTTTTT-C,CTTTTTTT 25×T***
13713149-AAGTGGAATGGCATCG-A,GAGTGGATTGGAATCG 11557473-AAGTGGAATGGCATCG-A,GAGTGGATTGGAATCG ***
23007019-C-T 20845133-C-T ***
13485698-G-A 11330022-G-A ***
19308322-TAA-T 17196442-TAA-T 12×A***
23435181-G-GT,GTTTT 21273295-G-GT,GTTTT 20×T***
56833306-C-A ***
10954195-C-A ***
5242526-A-G 5374485-A-G ***
16719797-A-C 14607917-A-C ***
13706546-T-C 11550870-T-C ***
23572484-CGTGT-C 21410598-CGTGT-C 13×GT***
28030780-C-CTTTCT 25884633-C-CTTTCT P1_Y2 ***
13714652-T-A,C 11558976-T-A,C ***
17319880-G-GAAGAAAGAAAGA 15208000-G-GAAGAAAGAAAGA 16×AAGA***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page