Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > CTS3386 > Z17970 > A7297 > BY9000 > b38:20405250A>G

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
629325
13687852-G-T 11532176-G-T A*
28817386-G-T 26671239-G-T A*
23719511-C-T 21557625-C-T A*
26200834-G-A 24054687-G-A P1_Y1 A*
22224387-G-T 20062501-G-T ZS8805 DYZ19 A*
6318128-A-C 6450087-A-C IR3_Dst A*
16645476-T-G 14533596-T-G YY+
23199404-A-G 21037518-A-G Y134253 Y+
14775330-G-T 12663399-G-T YY+
17748510-C-T 15636630-C-T PH3342 YY+
28813691-A-T 26667544-A-T +
8415186-C-CA 8547145-C-CA +
2693997-C-T 2825956-C-T Y134273 YY+
14061845-G-A 11941139-G-A Y134260 YY+
16211512-G-A 14099632-G-A YY+
22280700-A-C 20118814-A-C DYZ19 *
17058856-T-G 14946976-T-G **
17152953-G-A 15041073-G-A **
17152912-A-C 15041032-A-C **
17141900-A-T 15030020-A-T **
17141866-T-G 15029986-T-G **
17103908-C-A 14992028-C-A **
17103937-C-A 14992057-C-A **
17052683-A-T 14940803-A-T **
17046306-T-C 14934426-T-C **
17090845-T-TG 14978965-T-TG **
17090834-A-C 14978954-A-C **
17050838-C-A 14938958-C-A **
17157443-G-T 15045563-G-T **
17234243-A-C 15122363-A-C **
17165501-T-C 15053621-T-C **
17319916-A-G 15208036-A-G **
17352444-G-T 15240564-G-T **
17352437-T-G 15240557-T-G **
17347532-T-G 15235652-T-G **
17347509-A-C 15235629-A-C **
17337617-A-C 15225737-A-C **
17319952-A-G 15208072-A-G **
17319927-G-T 15208047-G-T **
17319919-G-T 15208039-G-T **
17317379-A-T 15205499-A-T **
17190595-T-A 15078715-T-A **
17280159-T-G 15168279-T-G **
17279094-C-A 15167214-C-A **
17270359-T-G 15158479-T-G **
17242083-TG-T 15130203-TG-T **
17238140-TA-T 15126260-TA-T 8×A**
17029366-G-T 14917486-G-T **
17233422-C-A 15121542-C-A **
17192664-G-T 15080784-G-T **
17046299-C-A 14934419-C-A **
16853758-C-A 14741878-C-A **
17004689-A-C 14892809-A-C **
16486704-T-A 14374824-T-A **
16547070-C-A 14435190-C-A **
16536209-G-T 14424329-G-T **
16528091-C-T 14416211-C-T **
16516438-G-T 14404558-G-T **
16492391-C-A 14380511-C-A **
16491900-A-G 14380020-A-G **
16488185-C-A 14376305-C-A **
16488034-A-T 14376154-A-T **
16444203-A-T 14332323-A-T **
16575332-C-A 14463452-C-A **
16383747-C-A 14271867-C-A **
16370931-T-A 14259051-T-A **
16320382-G-T 14208502-G-T **
16317330-C-G 14205450-C-G **
16317321-C-T 14205441-C-T **
16297571-C-A 14185691-C-A **
16286512-G-T 14174632-G-T **
16261106-A-C 14149226-A-C **
16558552-C-A 14446672-C-A **
16602501-A-T 14490621-A-T **
16967469-A-C 14855589-A-C **
16743230-T-G 14631350-T-G **
16943399-A-AT 14831519-A-AT **
16921170-A-C 14809290-A-C **
16871288-C-A 14759408-C-A **
17372226-T-G 15260346-T-G **
16842130-T-G 14730250-T-G **
16764961-A-G 14653081-A-G **
16760285-C-A 14648405-C-A **
16747410-C-A 14635530-C-A **
16719743-T-G 14607863-T-G **
16627501-T-C 14515621-T-C **
16707335-G-T 14595455-G-T **
16681442-A-G 14569562-A-G **
16676177-G-T 14564297-G-T **
16663165-A-G 14551285-A-G **
16654873-C-A 14542993-C-A **
16648278-C-A 14536398-C-A **
16648277-C-T 14536397-C-T **
16643272-T-A 14531392-T-A **
17360370-T-G 15248490-T-G **
14279172-G-T 12158466-G-T **
17374698-A-G 15262818-A-G **
18222533-A-G 16110653-A-G **
18430062-T-G 16318182-T-G P6_Dst **
18400515-G-T 16288635-G-T P6_Gap **
18391780-T-A 16279900-T-A P6_Gap **
18328806-T-G 16216926-T-G P6_Prx **
18307276-C-A 16195396-C-A P6_Prx **
18288595-T-G 16176715-T-G P6_Prx **
18253494-G-T 16141614-G-T **
18235661-G-A 16123781-G-A **
18215631-T-G 16103751-T-G **
18556671-T-G 16444791-T-G **
18197954-G-T 16086074-G-T **
18197940-A-G 16086060-A-G **
18184396-T-C 16072516-T-C **
18174468-A-C 16062588-A-C **
18172515-A-G 16060635-A-G **
18159868-G-T 16047988-G-T **
18159850-G-T 16047970-G-T **
18159835-G-T 16047955-G-T **
18524249-C-A 16412369-C-A P6_Dst **
18596318-C-A 16484438-C-A **
18121689-C-A 16009809-C-A **
18690415-T-A 16578535-T-A **
18768285-A-C 16656405-A-C **
18756232-G-A 16644352-G-A **
18756145-G-T 16644265-G-T **
18755076-A-C 16643196-A-C **
18738126-T-G 16626246-T-G **
18738097-T-A 16626217-T-A **
18728927-A-T 16617047-A-T **
18709863-G-T 16597983-G-T **
18682893-A-G 16571013-A-G **
18604583-G-T 16492703-G-T **
18682890-G-A 16571010-G-A **
18682889-G-A 16571009-G-A **
18682876-C-G 16570996-C-G **
18682875-A-G 16570995-A-G **
18682869-A-C 16570989-A-C **
18679953-G-T 16568073-G-T **
18614187-A-G 16502307-A-G **
18607414-A-T 16495534-A-T **
18607092-C-A 16495212-C-A **
18143976-C-T 16032096-C-T **
18108783-G-T 15996903-G-T **
17374718-T-G 15262838-T-G **
17513266-C-A 15401386-C-A **
17648388-T-G 15536508-T-G **
17648380-A-G 15536500-A-G **
17648375-G-C 15536495-G-C **
17648365-A-G 15536485-A-G **
17648363-G-A 15536483-G-A **
17645637-C-A 15533757-C-A **
17645629-T-C 15533749-T-C **
17531679-A-C 15419799-A-C **
17512651-A-T 15400771-A-T **
17713954-A-C 15602074-A-C **
17500215-G-C 15388335-G-C **
17438572-G-T 15326692-G-T **
17434131-A-C 15322251-A-C **
17425113-C-A 15313233-C-A **
17405788-C-G 15293908-C-G **
17379967-G-T 15268087-G-T **
17376079-G-T 15264199-G-T **
17374732-G-T 15262852-G-T **
16260340-T-A 14148460-T-A **
17652011-C-A 15540131-C-A **
17728810-G-C 15616930-G-C **
18097875-A-C 15985995-A-C **
17941549-A-C 15829669-A-C **
18085663-G-T 15973783-G-T **
18077990-C-A 15966110-C-A **
18053488-C-T 15941608-C-T **
18053475-C-T 15941595-C-T F12407 **
18036032-C-A 15924152-C-A **
18020811-T-G 15908931-T-G **
17969073-A-G 15857193-A-G **
17941559-T-A 15829679-T-A **
17879352-A-C 15767472-A-C **
17775062-T-G 15663182-T-G **
17854269-T-A 15742389-T-A **
17853645-CA-C 15741765-CA-C **
17852051-C-A 15740171-C-A **
17851733-G-C 15739853-G-C **
17813410-A-T 15701530-A-T **
17787999-A-G 15676119-A-G **
17787989-A-T 15676109-A-T **
17787979-T-A 15676099-T-A **
17779803-T-C 15667923-T-C **
16261091-T-C 14149211-T-C **
16223573-T-A 14111693-T-A **
16249086-T-C 14137206-T-C **
14589485-G-T 12477685-G-T **
14815189-A-C 12703260-A-C **
14789508-C-A 12677579-C-A **
14776037-G-T 12664106-G-T **
14766765-T-G 12654834-T-G **
14672472-C-A 12560538-C-A **
14651393-C-A 12539458-C-A **
14639492-A-C 12527561-A-C **
14609604-C-A 12497806-C-A **
14585720-T-G 12473920-T-G **
14825145-T-TA 12713212-T-TA **
14585662-T-A 12473862-T-A **
14584541-C-A 12472741-C-A **
14584523-A-C 12472723-A-C **
14584499-C-A 12472699-C-A **
14568729-A-C 12456929-A-C **
14537582-T-A 12425783-T-A **
14533012-G-T 12421213-G-T **
14532701-G-A 12420902-G-A **
14824043-T-G 12712110-T-G **
14827176-C-A 12715243-C-A **
12379459-A-G **
14967312-T-G 12855387-T-G **
15076351-G-T 12964441-G-T **
15076331-T-G 12964421-T-G **
15055030-T-G 12943121-T-G **
15055026-C-T 12943117-C-T **
15049467-T-C 12937558-T-C **
14992401-G-C 12880486-G-C **
14992388-A-C 12880473-A-C **
14992358-C-A 12880443-C-A **
14967307-T-A 12855382-T-A **
14844764-A-T 12732830-A-T **
14967297-T-G 12855372-T-G **
14967280-A-G 12855355-A-G **
14953255-A-C 12841329-A-C **
14953246-A-C 12841320-A-C **
14944916-A-T 12832990-A-T **
14944898-A-T 12832972-A-T **
14912909-G-T 12800976-G-T **
14889945-T-C 12778011-T-C **
14494599-C-A 12382796-C-A **
14475999-G-T 12355268-G-T **
15114280-A-G 13002367-A-G **
14125074-G-T 12004368-G-T **
14250449-G-T 12129743-G-T **
14249996-A-C 12129290-A-C **
14233258-CTTT-C 12112552-CTTT-C 8×T**
14229672-C-A 12108966-C-A **
14225851-T-G 12105145-T-G **
14224399-G-T 12103693-G-T **
14216105-A-T 12095399-A-T **
14215785-T-A 12095079-T-A **
14099849-T-G 11979143-T-G **
14252114-T-G 12131408-T-G **
14088791-T-G 11968085-T-G **
14076772-A-T 11956066-A-T **
14055420-G-C 11934714-G-C **
14052148-C-A 11931442-C-A **
14042619-A-C 11921913-A-C **
14032956-C-A 11912250-C-A **
14030895-G-T 11910189-G-T **
14030890-G-T 11910184-G-T **
14251963-G-T 12131257-G-T **
14252150-C-A 12131444-C-A **
14475014-G-T 12354283-G-T **
14385306-G-C 12264602-G-C **
14474991-G-T 12354260-G-T **
14474959-G-T 12354228-G-T **
14460058-T-G 12339331-T-G **
14428846-G-T 12308121-G-T **
14423753-G-C 12303028-G-C **
14413737-C-A 12293034-C-A **
14405835-A-C 12285132-A-C **
14404900-C-A 12284197-C-A **
14368714-A-G 12248010-A-G **
17919855-GAA-G 15807975-GAA-G 25×A**
14368702-T-G 12247998-T-G **
14364252-T-G 12243547-T-G **
14349446-C-A 12228741-C-A **
14314288-G-A 12193582-G-A **
14314282-A-G 12193576-A-G **
14307701-A-C 12186995-A-C **
14295813-G-T 12175107-G-T **
14284250-G-T 12163544-G-T **
15076360-A-G 12964450-A-G **
15114290-T-G 13002377-T-G **
16236139-C-A 14124259-C-A **
15860059-C-A 13748179-C-A **
15976638-T-G 13864758-T-G **
15976597-T-C 13864717-T-C **
15957007-C-A 13845127-C-A **
15931445-C-T 13819565-C-T **
15926039-C-A 13814159-C-A **
15876636-G-T 13764756-G-T **
15873537-G-T 13761657-G-T **
15860061-C-A 13748181-C-A **
15860035-A-C 13748155-A-C **
15989120-A-C 13877240-A-C **
15860027-A-C 13748147-A-C **
15818472-G-T 13706592-G-T **
15793060-G-T 13681180-G-T **
15786336-A-C 13674456-A-C **
15780356-G-T 13668476-G-T **
15777502-GT-G 13665622-GT-G **
15776695-T-G 13664815-T-G **
15722587-T-A 13610707-T-A **
15980718-CTCTAAAAAAAAAAAAAAAAAG-C 13868838-CTCTAAAAAAAAAAAAAAAAAG-C **
16016957-A-C 13905077-A-C **
15711982-A-C 13600102-A-C **
16076037-T-A 13964157-T-A **
16235237-G-A 14123357-G-A **
16235235-C-A 14123355-C-A **
18814924-A-G 16703044-A-G **
16096264-A-C 13984384-A-C **
16084140-G-T 13972260-G-T **
16076056-G-A 13964176-G-A **
16076052-G-A 13964172-G-A **
16076044-A-C 13964164-A-C **
16076033-G-A 13964153-G-A **
16024633-A-T 13912753-A-T **
16076018-C-A 13964138-C-A **
16076013-C-A 13964133-C-A **
16070517-C-A 13958637-C-A **
16070493-C-A 13958613-C-A **
16063430-T-G 13951550-T-G **
16062497-A-C 13950617-A-C **
16048086-G-C 13936206-G-C **
16037441-A-C 13925561-A-C **
15712018-G-T 13600138-G-T **
15711976-C-A 13600096-C-A **
15114298-T-G 13002385-T-G **
15206022-A-C 13094108-A-C **
15308506-C-A 13196608-C-A **
15308496-A-G 13196598-A-G **
15308466-A-T 13196568-A-T **
15305606-G-C 13193705-G-C **
15258458-G-C 13146542-G-C **
15258411-C-A 13146495-C-A **
15252017-G-T 13140103-G-T **
15252001-C-A 13140087-C-A **
15198626-A-C 13086712-A-C **
15324913-A-T 13213031-A-T **
15168549-C-A 13056635-C-A **
15151531-C-T 13039618-C-T **
15127267-A-C 13015354-A-C **
15124153-C-G 13012240-C-G **
15121057-A-C 13009144-A-C **
15121012-G-T 13009099-G-T **
15114740-T-A 13002827-T-A **
15114725-T-A 13002812-T-A **
15309688-A-C 13197792-A-C **
15341649-C-A 13229768-C-A **
15677957-T-C 13566077-T-C **
15578197-T-A 13466317-T-A **
15677942-A-C 13566062-A-C **
15665645-T-G 13553765-T-G **
15662737-A-C 13550857-A-C **
15657256-A-G 13545376-A-G **
15650427-C-A 13538547-C-A **
15617852-T-A 13505972-T-A **
15600081-T-G 13488201-T-G **
15579397-C-A 13467517-C-A **
15506849-G-T 13394969-G-T **
15354982-G-T 13243101-G-T **
15499527-T-A 13387647-T-A **
15489750-C-A 13377870-C-A **
15477846-C-A 13365966-C-A **
15477845-C-A 13365965-C-A **
15471129-T-A 13359249-T-A **
15446280-G-T 13334400-G-T **
15429364-C-A 13317484-C-A **
15422837-C-A 13310957-C-A **
18768553-T-A 16656673-T-A **
18856210-G-C 16744330-G-C **
18814925-G-T 16703045-G-T **
23277723-T-G 21115837-T-G **
23380610-T-A 21218724-T-A **
23380531-G-T 21218645-G-T **
23380507-G-T 21218621-G-T **
23380499-G-T 21218613-G-T **
23380487-G-T 21218601-G-T **
23352664-A-G 21190778-A-G **
23316221-T-G 21154335-T-G **
23298680-A-G 21136794-A-G **
23197345-G-T 21035459-G-T **
23393011-T-A 21231125-T-A **
23192497-A-G 21030611-A-G **
23192485-G-T 21030599-G-T **
23192470-G-T 21030584-G-T **
23189046-T-A 21027160-T-A **
23188154-G-C 21026268-G-C **
23185810-C-A 21023924-C-A **
23138111-C-A 20976225-C-A **
23136199-A-C 20974313-A-C **
23392245-T-G 21230359-T-G **
23393522-T-G 21231636-T-G **
23016769-C-A 20854883-C-A **
23577010-C-G 21415124-C-G **
24071587-C-A 21925440-C-A P3_b1 **
24003113-T-G 21856966-T-G **
23848772-G-T 21686886-G-T **
23823489-A-T 21661603-A-T **
23789779-T-G 21627893-T-G **
23789761-C-A 21627875-C-A **
23651077-C-A 21489191-C-A **
23592291-C-A 21430405-C-A **
23570299-G-A 21408413-G-A **
23396009-G-T 21234123-G-T **
23560818-G-T 21398932-G-T **
23554902-C-A 21393016-C-A **
23540555-A-C 21378669-A-C **
23484495-G-T 21322609-G-T **
23466486-G-A 21304600-G-A **
23466472-A-G 21304586-A-G **
23452058-T-G 21290172-T-G **
23396026-G-T 21234140-G-T **
23061094-T-G 20899208-T-G **
23010909-T-C 20849023-T-C **
24262115-T-A 22115968-T-A P3_b1 **
22561935-T-G 20400049-T-G **
22639338-T-G 20477452-T-G **
22615535-C-A 20453649-C-A **
22600435-G-T 20438549-G-T **
22598848-C-A 20436962-C-A Y78315 **
22587825-G-T 20425939-G-T **
22564450-C-A 20402564-C-A **
22564203-T-C 20402317-T-C **
22563051-T-G 20401165-T-G **
22488217-T-C 20326331-T-C DYZ19 **
22656320-T-G 20494434-T-G **
22484778-C-A 20322892-C-A DYZ19 **
22455489-A-T 20293603-A-T DYZ19 **
22455483-T-A 20293597-T-A DYZ19 **
22455477-C-T 20293591-C-T DYZ19 **
22455448-C-G 20293562-C-G DYZ19 **
22423765-C-T 20261879-C-T DYZ19 **
22316190-T-G 20154304-T-G DYZ19 **
22292028-T-A 20130142-T-A DYZ19 **
22639373-A-C 20477487-A-C **
22659315-C-G 20497429-C-G **
23004870-T-A 20842984-T-A **
22768364-A-T 20606478-A-T **
22993196-T-C 20831310-T-C **
22965014-A-T 20803128-A-T **
22920791-T-G 20758905-T-G **
22920783-T-G 20758897-T-G **
22875868-C-A 20713982-C-A **
22874301-A-C 20712415-A-C **
22845882-C-A 20683996-C-A **
22820268-A-T 20658382-A-T **
22768312-C-A 20606426-C-A **
22659325-T-G 20497439-T-G **
22761113-C-A 20599227-C-A **
22741116-T-G 20579230-T-G **
22741115-T-G 20579229-T-G **
22741112-T-C 20579226-T-C **
22741109-T-G 20579223-T-G **
22741108-G-T 20579222-G-T **
22730308-C-A 20568422-C-A **
22692918-C-A 20531032-C-A **
24079293-A-C 21933146-A-C P3_b1 **
24262227-G-C 22116080-G-C P3_b1 **
22291996-A-T 20130110-A-T DYZ19 **
28497866-T-C 26351719-T-C **
28660533-C-A 26514386-C-A **
28632673-C-A 26486526-C-A **
28632142-C-A 26485995-C-A Y13666 **
28622687-C-A 26476540-C-A **
28618195-T-G 26472048-T-G **
28611690-G-T 26465543-G-T 8×T**
28593805-A-T 26447658-A-T **
28574927-T-C 26428780-T-C **
28479023-T-C 26332876-T-C **
28688884-C-A 26542737-C-A **
28478936-T-C 26332789-T-C **
28462790-A-C 26316643-A-C **
28081864-G-T 25935717-G-T P1_Y2 **
28081863-G-T 25935716-G-T P1_Y2 **
28081853-T-A 25935706-T-A P1_Y2 **
28081844-C-A 25935697-C-A P1_Y2 **
28081837-T-A 25935690-T-A P1_Y2 **
28081834-C-A 25935687-C-A P1_Y2 **
28662235-G-T 26516088-G-T **
28688918-C-A 26542771-C-A **
27767419-T-G 25621272-T-G P1_Y2 **
56848076-C-A **
16106-G-T **
56870151-C-A **
56870126-C-A **
56850525-T-A **
56850515-G-A **
56850492-A-T **
56850465-A-C **
56849689-C-G **
56843468-G-T **
28727957-TGAATA-T 26581810-TGAATA-T **
56839767-C-A **
56827928-C-A **
28818179-G-T 26672032-G-T **
28812317-A-G 26666170-A-G **
28783736-A-C 26637589-A-C **
28766350-A-C 26620203-A-C **
28764889-G-T 26618742-G-T **
28760161-T-G 26614014-T-G **
27829232-C-A 25683085-C-A P1_Y2 **
27767403-G-C 25621256-G-C P1_Y2 **
24328701-C-A 22182554-C-A P3_t1 **
24502418-A-G 22356271-A-G **
24643340-A-T 22497193-A-T P3_t2 **
24643329-TG-T 22497182-TG-T P3_t2 **
24643326-C-CT 22497179-C-CT P3_t2 **
24643318-C-G 22497171-C-G P3_t2 **
24643316-T-G 22497169-T-G P3_t2 **
24535220-G-T 22389073-G-T P3_t2 **
24523614-T-G 22377467-T-G **
24509218-G-T 22363071-G-T **
24502405-G-T 22356258-G-T **
25521860-A-C 23375713-A-C P1_gr1 **
24502399-A-G 22356252-A-G **
24494217-G-T 22348070-G-T **
24462480-G-T 22316333-G-T **
24430101-T-G 22283954-T-G **
24430093-T-G 22283946-T-G **
24404887-G-A 22258740-G-A **
24331327-T-A 22185180-T-A P3_t1 **
24331322-C-A 22185175-C-A P3_t1 **
25383858-G-T 23237711-G-T P2_r2 **
25521876-C-A 23375729-C-A P1_gr1 **
27633727-A-T 25487580-A-T P1_Y2 **
26228678-T-G 24082531-T-G P1_Y1 **
26791160-A-T 24645013-A-T P1_g2 **
26791154-T-G 24645007-T-G P1_g2 **
26791141-T-G 24644994-T-G P1_g2 **
26514910-C-A 24368763-C-A P1_Y1 **
26514888-G-T 24368741-G-T P1_Y1 **
26514870-A-C 24368723-A-C P1_Y1 **
26514863-G-C 24368716-G-C P1_Y1 **
26514851-A-C 24368704-A-C P1_Y1 **
26073096-G-GTA 23926949-G-GTA P1_Y1 **
25521884-C-T 23375737-C-T P1_gr1 **
25978419-T-A 23832272-T-A P1_Y1 **
25978404-C-A 23832257-C-A P1_Y1 **
25978390-T-A 23832243-T-A P1_Y1 **
25956753-G-A 23810606-G-A P1_Y1 **
25938852-C-T 23792705-C-T P1_Y1 **
25804724-G-T 23658577-G-T P1_b3 **
25804720-G-T 23658573-G-T P1_b3 **
25521901-C-A 23375754-C-A P1_gr1 **
22292007-G-T 20130121-G-T DYZ19 **
22291975-A-T 20130089-A-T DYZ19 **
18814940-C-A 16703060-C-A **
19827558-C-A 17715678-C-A P5_Prx **
20440390-AGT-A 18278504-AGT-A P5_Dst **
20440333-A-T 18278447-A-T P5_Dst **
20035078-C-A 17923198-C-A P5_Prx **
20035066-C-A 17923186-C-A P5_Prx **
20035045-C-A 17923165-C-A P5_Prx **
20035041-C-A 17923161-C-A P5_Prx **
20024092-G-C 17912212-G-C P5_Prx **
19829504-A-G 17717624-A-G P5_Prx **
19827556-C-A 17715676-C-A P5_Prx **
20440401-G-GT 18278515-G-GT P5_Dst **
19827458-T-G 17715578-T-G P5_Prx **
19690233-G-C 17578353-G-C P5_Prx **
19670758-C-A 17558878-C-A P5_Prx **
19668795-A-AT 17556915-A-AT P5_Prx **
19644784-A-C 17532904-A-C P5_Prx **
19558116-A-T 17446236-A-T **
19531305-T-G 17419425-T-G **
19530201-A-C 17418321-A-C **
20440401-G-T 18278515-G-T P5_Dst **
20440410-G-T 18278524-G-T P5_Dst **
19522477-C-A 17410597-C-A **
20917250-T-C 18755364-T-C P4_Dst **
20970613-T-G 18808727-T-G P4_Dst **
20970605-T-G 18808719-T-G P4_Dst **
20970600-A-G 18808714-A-G P4_Dst **
20970594-A-G 18808708-A-G P4_Dst **
20959419-A-T 18797533-A-T P4_Dst **
20936486-T-A 18774600-T-A P4_Dst **
20917286-C-A 18755400-C-A P4_Dst **
20917283-A-C 18755397-A-C P4_Dst **
20917249-C-A 18755363-C-A P4_Dst **
20440425-G-T 18278539-G-T P5_Dst **
20917229-C-A 18755343-C-A P4_Dst **
20833126-G-T 18671240-G-T P4_Gap **
20825653-G-T 18663767-G-T P4_Gap **
20817434-A-C 18655548-A-C P4_Gap **
20748901-T-A 18587015-T-A P4_Prx **
20723314-A-T 18561428-A-T P4_Prx **
20574875-G-T 18412989-G-T P5_Dst **
20569517-A-C 18407631-A-C P5_Dst **
19529768-T-A 17417888-T-A **
19522475-C-A 17410595-C-A **
21084515-C-A 18922629-C-A **
18965044-T-G 16853164-T-G **
19004578-T-C 16892698-T-C **
19004567-T-A 16892687-T-A **
19004562-T-G 16892682-T-G **
18994665-A-T 16882785-A-T **
18994654-A-C 16882774-A-C **
34184-T-A **
18966057-C-A 16854177-C-A **
18966028-T-C 16854148-T-C **
18926811-T-A 16814931-T-A **
19007940-C-A 16896060-C-A **
18921651-A-G 16809771-A-G **
18921644-T-G 16809764-T-G **
18898297-C-A 16786417-C-A **
18866026-T-A 16754146-T-A **
14025050-G-C 11904344-G-C **
18848469-T-G 16736589-T-G **
18836156-A-C 16724276-A-C **
18836137-G-T 16724257-G-T **
19004587-T-C 16892707-T-C **
19008269-G-T 16896389-G-T **
19466984-A-C 17355104-A-C **
19333280-T-G 17221400-T-G **
19448201-A-C 17336321-A-C **
19444823-C-A 17332943-C-A **
19435889-C-A 17324009-C-A **
19411759-A-T 17299879-A-T **
19367428-T-G 17255548-T-G **
19346803-A-G 17234923-A-G **
19346792-G-T 17234912-G-T **
19345115-T-G 17233235-T-G **
19260399-C-A 17148519-C-A **
19107526-C-A 16995646-C-A **
19256342-A-C 17144462-A-C **
19228716-A-C 17116836-A-C **
19216566-C-G 17104686-C-G **
19205139-A-C 17093259-A-C **
19170133-C-A 17058253-C-A **
19125694-CAAAAAAAAA-C 17013814-CAAAAAAAAA-C 24×A**
19123261-G-A 17011381-G-A **
19121865-T-C 17009985-T-C **
20987307-C-A 18825421-C-A P4_Dst **
21092171-T-A 18930285-T-A **
22277530-C-A 20115644-C-A DYZ19 **
21946093-T-G 19784207-T-G **
22011236-C-A 19849350-C-A **
22010247-A-C 19848361-A-C **
22008543-A-C 19846657-A-C **
22008465-A-C 19846579-A-C **
21999681-G-T 19837795-G-T **
21986651-A-G 19824765-A-G **
21953704-G-T 19791818-G-T **
21953656-G-T 19791770-G-T **
21932359-C-T 19770473-C-T **
22027889-T-G 19866003-T-G **
21923285-G-T 19761399-G-T F13068 **
21922861-C-A 19760975-C-A **
21915115-C-A 19753229-C-A **
21915065-C-A 19753179-C-A **
21912132-C-A 19750246-C-A **
21890873-G-T 19728987-G-T **
21853786-A-T 19691900-A-T **
21852128-T-A 19690242-T-A **
22021663-C-G 19859777-C-G **
22045509-C-A 19883623-C-A **
21828097-G-C 19666211-G-C **
22130480-A-T 19968594-A-T **
22261617-C-A 20099731-C-A DYZ19 **
22261605-C-A 20099719-C-A DYZ19 **
22261601-G-T 20099715-G-T DYZ19 **
22261582-G-T 20099696-G-T DYZ19 **
22238332-C-G 20076446-C-G DYZ19 **
22236883-G-T 20074997-G-T DYZ19 **
22215844-A-C 20053958-A-C **
22171504-C-A 20009618-C-A **
22128608-C-A 19966722-C-A **
22079152-A-C 19917266-A-C **
22128172-T-A 19966286-T-A **
22127977-T-C 19966091-T-C **
22114880-G-A 19952994-G-A **
22106754-C-T 19944868-C-T BY21984 A15069 **
22102155-C-A 19940269-C-A **
22100427-T-G 19938541-T-G **
22100420-A-G 19938534-A-G **
22100414-T-G 19938528-T-G **
21848586-G-T 19686700-G-T **
21772546-C-A 19610660-C-A **
21100856-C-A 18938970-C-A **
21308284-T-G 19146398-T-G **
21436554-C-A 19274668-C-A **
21414025-T-C 19252139-T-C **
21407889-G-T 19246003-G-T **
21363183-C-A 19201297-C-A **
21362443-G-T 19200557-G-T Y56574 **
21362431-G-T 19200545-G-T **
21326587-C-A 19164701-C-A **
21317584-C-A 19155698-C-A **
21297339-A-C 19135453-A-C **
21445351-T-A 19283465-T-A **
21206923-C-A 19045037-C-A **
21196467-C-A 19034581-C-A **
21149667-G-T 18987781-G-T **
21147954-A-C 18986068-A-C **
21146413-C-A 18984527-C-A **
21140131-T-A 18978245-T-A **
21128365-C-A 18966479-C-A **
21100859-C-A 18938973-C-A **
21438277-A-C 19276391-A-C **
21500207-T-G 19338321-T-G **
21748422-A-T 19586536-A-T **
21651804-G-T 19489918-G-T **
21738858-T-G 19576972-T-G **
21713933-C-A 19552047-C-A **
21700617-G-T 19538731-G-T **
21700605-A-T 19538719-A-T **
21699095-G-C 19537209-G-C **
21699092-C-T 19537206-C-T **
21682280-A-C 19520394-A-C **
21675320-A-C 19513434-A-C **
21589600-G-C 19427714-G-C **
21505134-C-A 19343248-C-A **
21559065-A-T 19397179-A-T **
21556722-A-C 19394836-A-C **
21529741-A-T 19367855-A-T **
21527729-G-A 19365843-G-A **
21518460-A-G 19356574-A-G **
21518452-A-T 19356566-A-T **
21518352-A-C 19356466-A-C **
21517971-A-C 19356085-A-C **
14030887-G-T 11910181-G-T **
18986682-A-C 16874802-A-C **
6975294-A-G 7107253-A-G **
5601219-G-C 5733178-G-C **
5690254-C-A 5822213-C-A **
5687719-G-T 5819678-G-T **
5687673-A-C 5819632-A-C **
5683676-C-A 5815635-C-A **
5674842-T-G 5806801-T-G **
5674836-C-G 5806795-C-G **
5674832-C-G 5806791-C-G **
5601218-A-G 5733177-A-G **
5779328-G-T 5911287-G-T **
5449502-T-G 5581461-T-G **
5434384-A-G 5566343-A-G **
5390672-T-A 5522631-T-A **
5314166-T-G 5446125-T-G **
5314148-G-T 5446107-G-T **
5314107-G-A 5446066-G-A **
16076067-C-A 13964187-C-A **
14224381-C-G 12103675-C-G **
5796230-T-G 5928189-T-G **
5226625-G-T 5358584-G-T **
6037843-C-A 6169802-C-A **
6182577-C-A 6314536-C-A IR3_Dst **
17480241-C-A 15368361-C-A **
6120265-C-A 6252224-C-A **
10924414-T-A **
6096521-G-T 6228480-G-T **
6096496-G-T 6228455-G-T **
6093226-A-C 6225185-A-C **
6037807-A-C 6169766-A-C **
5803475-G-A 5935434-G-A **
10795935-C-G **
17118395-C-CTT 15006515-C-CTT 16×T**
6028789-A-G 6160748-A-G **
19131668-C-A 17019788-C-A **
10950907-A-C **
5980915-A-C 6112874-A-C **
5949426-T-C 6081385-T-C **
5845870-A-T 5977829-A-T **
5226628-G-T 5358587-G-T **
5226624-T-G 5358583-T-G **
6252379-A-G 6384338-A-G IR3_Dst **
4371897-G-A 4503856-G-A **
4553958-C-A 4685917-C-A **
4532699-A-C 4664658-A-C **
4473101-G-T 4605060-G-T **
4433737-C-A 4565696-C-A **
4418303-G-T 4550262-G-T **
4396970-T-A 4528929-T-A **
4393689-C-A 4525648-C-A **
4336195-G-T 4468154-G-T **
4561438-G-C 4693397-G-C **
4302237-T-C 4434196-T-C **
4270791-A-C 4402750-A-C **
4230072-T-A 4362031-T-A **
4208343-CA-C 4340302-CA-C **
4201611-T-G 4333570-T-G **
4165176-A-T 4297135-A-T **
4114731-C-A 4246690-C-A **
4561174-T-G 4693133-T-G **
4561451-A-C 4693410-A-C **
5226606-A-G 5358565-A-G **
5011621-C-A 5143580-C-A **
5226585-G-T 5358544-G-T **
5226538-T-A 5358497-T-A **
5226524-G-T 5358483-G-T **
5199803-A-G 5331762-A-G **
3603240-C-A 3735199-C-A **
5164959-G-A 5296918-G-A **
5164701-A-C 5296660-A-C **
4930213-A-T 5062172-A-T **
4561452-G-C 4693411-G-C **
4929770-T-A 5061729-T-A **
4919643-C-A 5051602-C-A **
4716534-C-A 4848493-C-A **
4711419-G-T 4843378-G-T **
4711401-C-G 4843360-C-G **
4711394-G-T 4843353-G-T **
4711382-G-T 4843341-G-T **
4580751-C-A 4712710-C-A **
6207791-A-C 6339750-A-C IR3_Dst **
6352114-C-T 6484073-C-T **
4110849-C-A 4242808-C-A **
7201481-G-C 7333440-G-C **
7269279-T-C 7401238-T-C **
7253244-G-A 7385203-G-A **
7229097-T-G 7361056-T-G **
7214296-T-A 7346255-T-A **
7204968-C-A 7336927-C-A **
7201498-G-T 7333457-G-T **
7201490-C-G 7333449-C-G **
7199314-C-A 7331273-C-A **
7303117-T-G 7435076-T-G **
7199306-C-A 7331265-C-A **
7187750-T-A 7319709-T-A **
7170870-T-G 7302829-T-G **
6352030-G-T 6483989-G-T **
7116645-G-T 7248604-G-T **
7087008-C-T 7218967-C-T **
7083858-C-A 7215817-C-A **
7294470-T-G 7426429-T-G **
7311120-C-A 7443079-C-A **
7083097-A-G 7215056-A-G **
7456716-T-A 7588675-T-A IR1_L **
7709251-T-C 7841210-T-C **
23633371-C-CTT 21471485-C-CTT 21×T**
7646045-C-A 7778004-C-A **
7615154-C-A 7747113-C-A **
7542317-C-A 7674276-C-A **
7519079-G-C 7651038-G-C **
7519076-C-T 7651035-C-T **
7378492-A-C 7510451-A-C **
7321983-T-A 7453942-T-A **
7378491-T-C 7510450-T-C FGC18365 **
7375376-G-T 7507335-G-T **
7366429-A-C 7498388-A-C **
7353678-T-A 7485637-T-A **
7353673-T-A 7485632-T-A **
7353660-T-A 7485619-T-A **
7353644-T-A 7485603-T-A **
7340321-C-A 7472280-C-A **
10766732-CACTCT-C **
14845596-C-A 12733662-C-A **
4700435-C-A 4832394-C-A **
6633067-C-G 6765026-C-G **
6707564-G-T 6839523-G-T **
6707542-CT-C 6839501-CT-C **
6707512-T-C 6839471-T-C **
6707500-A-C 6839459-A-C **
6672404-T-G 6804363-T-G **
6650770-G-T 6782729-G-T **
6633471-A-G 6765430-A-G **
6595969-A-C 6727928-A-C **
6764013-A-T 6895972-A-T **
6540890-T-G 6672849-T-G **
6540879-T-G 6672838-T-G **
6540848-T-G 6672807-T-G **
3051574-C-A 3183533-C-A **
15712014-T-C 13600134-T-C **
6425795-A-C 6557754-A-C **
6403087-A-G 6535046-A-G **
16458213-C-A 14346333-C-A **
6730195-C-A 6862154-C-A **
6793617-A-C 6925576-A-C **
7082563-T-G 7214522-T-G **
7011536-A-T 7143495-A-T **
7082530-A-C 7214489-A-C **
7081178-G-T 7213137-G-T **
7081156-G-T 7213115-G-T **
13457735-C-CCAATG 11302059-C-CCAATG **
7080227-A-T 7212186-A-T **
7050119-A-T 7182078-A-T **
6130198-A-C 6262157-A-C **
7011535-C-G 7143494-C-G **
6822519-A-C 6954478-A-C **
6984805-G-T 7116764-G-T **
14021945-A-C 11901239-A-C **
6930422-A-G 7062381-A-G Y61221 **
6926423-C-A 7058382-C-A **
6891804-G-C 7023763-G-C **
6863841-C-G 6995800-C-G **
6828293-C-A 6960252-C-A **
6825687-A-C 6957646-A-C **
4110900-C-A 4242859-C-A **
4110848-C-A 4242807-C-A **
7780784-A-G 7912743-A-G **
19345116-C-A 17233236-C-A **
10866443-C-A **
21677035-C-A 19515149-C-A **
11011620-C-A **
21708293-T-G 19546407-T-G **
11005697-C-A **
2948478-G-T 3080437-G-T **
15816328-C-A 13704448-C-A **
18263227-G-T 16151347-G-T **
21919469-C-A 19757583-C-A **
17715410-C-A 15603530-C-A **
14476020-G-T 12355289-G-T **
21048257-C-A 18886371-C-A **
7201544-C-T 7333503-C-T **
20440340-C-A 18278454-C-A P5_Dst **
7625203-C-A 7757162-C-A **
14532691-C-A 12420892-C-A **
14224355-C-G 12103649-C-G **
27872532-A-C 25726385-A-C P1_Y2 **
10974343-C-A **
19055490-G-T 16943610-G-T **
7170787-C-A 7302746-C-A **
28793035-G-T 26646888-G-T **
28005236-G-T 25859089-G-T P1_Y2 **
15289399-C-A 13177498-C-A **
10901984-C-A **
16317438-C-A 14205558-C-A **
18564299-C-A 16452419-C-A **
24643323-A-T 22497176-A-T P3_t2 **
13929834-C-A 11809128-C-A **
15481299-C-A 13369419-C-A **
8709850-C-A 8841809-C-A **
5426390-C-CTT 5558349-C-CTT 17×T**
18754951-C-A 16643071-C-A **
10766781-C-A **
8117304-C-A 8249263-C-A **
10895787-A-T **
22177477-C-A 20015591-C-A **
7214469-C-A 7346428-C-A **
5756655-TA-T 5888614-TA-T 9×A**
10981846-T-G **
10825671-C-A **
14316494-C-A 12195788-C-A **
19172799-GTTTTT-G 17060919-GTTTTT-G 17×T**
14490288-C-A 12369557-C-A **
7125055-C-A 7257014-C-A **
10764553-T-TA **
10764507-TCCA-T **
16545646-G-T 14433766-G-T **
22205454-A-G 20043568-A-G **
9029926-G-T 9192317-G-T **
14825824-C-A 12713891-C-A 18×T**
10935458-A-C **
7082553-C-A 7214512-C-A **
10935464-G-A **
7126524-CTTTTTT-C 7258483-CTTTTTT-C 23×T**
10942684-C-A **
7874829-C-A 8006788-C-A **
10843460-C-G **
14698517-C-A 12586583-C-A **
3850122-T-G 3982081-T-G **
16016294-C-A 13904414-C-A **
13521128-C-A 11365452-C-A **
13394869-G-C 11239193-G-C **
3093689-C-A 3225648-C-A **
7507127-G-T 7639086-G-T **
2661151-C-A 2793110-C-A **
16271269-T-G 14159389-T-G **
19558442-C-A 17446562-C-A **
22316244-A-T 20154358-A-T DYZ19 **
4070143-C-A 4202102-C-A **
14476001-G-T 12355270-G-T **
7755068-T-G 7887027-T-G **
4561454-C-A 4693413-C-A **
7183001-C-A 7314960-C-A **
4582288-C-A 4714247-C-A **
56837406-G-A **
11017730-GCATTC-G **
17850086-C-A 15738206-C-A **
10959226-C-A **
13846752-G-T 11726046-G-T **
4070178-G-T 4202137-G-T **
9524246-G-A 9686637-G-A **
3389051-A-C 3521010-A-C **
3347038-G-T 3478997-G-T **
8155985-C-A 8287944-C-A **
3279589-G-C 3411548-G-C **
3274337-C-A 3406296-C-A **
3274289-G-T 3406248-G-T **
3265754-C-A 3397713-C-A **
3265710-C-A 3397669-C-A **
3599049-A-G 3731008-A-G **
3265675-C-A 3397634-C-A **
3265668-C-G 3397627-C-G **
3265601-A-G 3397560-A-G **
3265540-T-G 3397499-T-G **
3253365-A-C 3385324-A-C **
3240780-G-T 3372739-G-T **
3073921-A-C 3205880-A-C **
3436921-C-G 3568880-C-G **
22893331-T-G 20731445-T-G **
2884259-G-T 3016218-G-T **
3726408-T-C 3858367-T-C **
4070125-T-A 4202084-T-A **
4063209-A-G 4195168-A-G **
4016928-C-A 4148887-C-A **
3987783-G-T 4119742-G-T **
3865956-T-A 3997915-T-A **
3726446-C-T 3858405-C-T **
3726422-C-T 3858381-C-T **
3696720-C-G 3828679-C-G **
3599066-C-G 3731025-C-G **
11643483-G-T **
3622532-A-C 3754491-A-C **
3615998-C-G 3747957-C-G **
3603226-G-C 3735185-G-C **
3603225-A-C 3735184-A-C **
3599129-G-T 3731088-G-T **
3599111-G-T 3731070-G-T **
3599070-G-C 3731029-G-C **
2885908-G-T 3017867-G-T **
2883123-C-A 3015082-C-A **
18973340-C-A 16861460-C-A **
11034875-C-G **
2728114-G-A 2860073-G-A **
2706823-A-C 2838782-A-C **
2706773-A-C 2838732-A-C **
2706769-G-A 2838728-G-A **
2699620-C-G 2831579-C-G **
2688073-A-G 2820032-A-G **
2685559-T-G 2817518-T-G **
5226561-G-T 5358520-G-T **
2752642-T-G 2884601-T-G **
15860023-C-A 13748143-C-A **
23819065-T-G 21657179-T-G **
6090821-C-A 6222780-C-A **
15285991-C-A 13174090-C-A **
9932636-C-A 10095027-C-A **
10752749-T-G **
16530966-C-A 14419086-C-A **
10885741-A-G **
2750631-A-T 2882590-A-T **
2770988-G-C 2902947-G-C **
2866355-C-A 2998314-C-A **
22113463-C-A 19951577-C-A **
16232410-C-A 14120530-C-A **
2856499-G-C 2988458-G-C **
10940758-A-AC **
2856438-G-C 2988397-G-C **
10799511-A-T **
2852413-G-C 2984372-G-C **
2840118-AAGAG-A 2972077-AAGAG-A **
2816942-G-T 2948901-G-T **
2771004-G-A 2902963-G-A **
2809562-A-G 2941521-A-G **
2805457-A-G 2937416-A-G **
2799678-CAAA-C 2931637-CAAA-C **
2788159-T-C 2920118-T-C **
2788154-C-A 2920113-C-A **
2788132-A-C 2920091-A-C **
2787420-T-G 2919379-T-G **
2787408-G-A 2919367-G-A **
7753084-T-A 7885043-T-A **
7695663-A-T 7827622-A-T **
7853257-T-C 7985216-T-C **
10909753-A-G **
10940771-CATTTT-C **
10939394-C-G **
20659382-G-A 18497496-G-A P4_Prx **
10932719-C-A **
15374441-GTTTTTT-G 13262561-GTTTTTT-G 20×T**
10910022-C-A **
10909758-A-C **
10909664-C-A **
10944275-C-A **
10909605-G-T **
10904596-G-T **
10901065-A-C **
10899490-A-T **
10898509-C-A **
10895780-C-A **
10894528-T-A **
10944269-C-A **
10944280-T-A **
10894463-C-A **
10972753-G-C **
11004879-C-A **
11004789-C-CAGAAG **
10999999-C-A **
10988456-T-C **
10981912-T-A **
10973673-AATCCC-A **
10972820-T-G **
10968020-A-C **
10950893-T-G **
10965261-T-G **
10963228-C-A **
10963221-T-A **
10959179-T-C **
10959175-C-A **
10952414-C-A **
16768829-C-A 14656949-C-A Y97238 **
10894499-T-A **
10885756-A-G **
11007967-C-A **
10818984-T-A **
10825496-T-C **
10822682-A-C **
10819232-A-T **
10819227-A-T **
10819198-T-G **
10819191-C-G **
10819010-C-A **
10815341-C-A **
10826234-A-G **
10806898-T-G **
7871332-C-A 8003291-C-A **
10799505-G-A **
10792298-A-C **
10791604-T-C **
10922172-C-G **
10788087-C-A **
10826230-C-A **
10935444-T-C **
10885522-A-T **
2810389-TGA-T 2942348-TGA-T **
10880170-T-G **
10877724-A-T **
10872495-C-A **
10867019-T-G **
10865270-T-A **
10864774-G-C **
10808076-C-A **
8376337-G-T 8508296-G-T **
10828211-T-A **
10864258-T-A **
10864253-C-A **
10864252-A-C **
10847205-T-A **
10846145-C-A **
10839928-A-C **
10839053-T-C **
11007879-T-G **
11009391-T-G **
10766798-A-T **
11658237-C-A **
11676413-A-T **
11676351-G-T **
11675624-A-C **
11673726-G-T **
11673725-G-T **
11669220-T-A **
11663417-C-A **
11658140-A-C **
13850608-C-G 11729902-C-G **
11656414-G-C **
28812307-A-G 26666160-A-G **
5577219-G-A 5709178-G-A **
11653572-C-G **
6846959-CTAT-C 6978918-CTAT-C 6×TAT**
11645890-T-A **
13596945-C-A 11441269-C-A **
13847050-G-T 11726344-G-T **
13856810-T-C 11736104-T-C **
13588205-C-A 11432529-C-A **
13929830-A-C 11809124-A-C **
14021942-T-G 11901236-T-G **
14021932-A-T 11901226-A-T **
14007868-C-A 11887162-C-A **
14002730-T-A 11882024-T-A **
13975015-C-G 11854309-C-G **
13974931-G-T 11854225-G-T **
13940279-T-G 11819573-T-G **
13928693-T-C 11807987-T-C **
13860797-A-C 11740091-A-C **
13891341-C-A 11770635-C-A **
13885942-C-T 11765236-C-T **
22455462-T-A 20293576-T-A DYZ19 **
14992432-C-A 12880517-C-A **
13885941-C-T 11765235-C-T **
13885924-C-T 11765218-C-T **
13866945-G-T 11746239-G-T **
13642995-A-C 11487319-A-C **
13586151-CT-C 11430475-CT-C **
11009541-C-A **
11034862-GA-T **
13216643-A-C 11060967-A-C **
13199707-A-C 11044031-A-C **
11038183-T-A **
11034928-C-A **
11034919-C-T **
22236880-C-A 20074994-C-A DYZ19 **
11034866-T-TC **
11026908-C-G **
13227373-C-G 11071697-C-G **
11026892-T-A **
11024986-T-G **
11024979-A-T **
11024942-G-T **
7777046-G-T 7909005-G-T **
11012432-G-A **
11009843-C-A **
13223796-G-T 11068120-G-T **
13227763-A-T 11072087-A-T **
13555231-A-G 11399555-A-G **
13468142-CAG-C 11312466-CAG-C **
18194095-A-T 16082215-A-T Z27533 **
13523059-C-G 11367383-C-G **
13522032-C-A 11366356-C-A **
13522029-C-A 11366353-C-A **
13521137-G-C 11365461-G-C **
18596093-C-T 16484213-C-T A4950 **
13488976-G-T 11333300-G-T **
13394895-C-G 11239219-C-G **
13227973-C-A 11072297-C-A **
13394879-C-A 11239203-C-A **
13328739-C-A 11173063-C-A **
13282971-C-A 11127295-C-A **
16483725-C-A 14371845-C-A Y51921 **
13236851-G-T 11081175-G-T **
13236846-G-T 11081170-G-T **
13236588-A-T 11080912-A-T **
13231806-T-A 11076130-T-A **
10767564-T-G **
10800070-C-A **
10766797-A-G **
8779681-A-G 8911640-A-G **
9124455-A-G **
9109666-T-A **
8913099-A-C 9045058-A-C **
8873128-G-A 9005087-G-A **
8851218-A-C 8983177-A-C **
8835126-C-A 8967085-C-A **
8831048-C-A 8963007-C-A **
8778171-C-A 8910130-C-A **
9125530-T-G **
8774201-G-T 8906160-G-T 4×TATTT**
8756903-G-C 8888862-G-C **
8748345-T-C 8880304-T-C **
8742759-G-T 8874718-G-T **
8732654-T-C 8864613-T-C **
8732617-C-A 8864576-C-A BY35569 **
8732574-C-A 8864533-C-A **
8732572-C-A 8864531-C-A **
9125529-C-G **
9125542-G-T **
8698616-T-C 8830575-T-C **
9062977-A-C 9225368-A-C **
9074012-T-C 9236403-T-C **
10766793-A-C **
10981933-G-C **
9063006-C-A 9225397-C-A **
9062995-GAAA-G 9225386-GAAA-G **
9062996-A-ACCT 9225387-A-ACCT **
9062994-A-C 9225385-A-C **
9062965-A-C 9225356-A-C **
8996103-G-T 9158494-G-T **
9059940-C-A 9222331-C-A **
9048122-C-A 9210513-C-A **
9041946-G-T 9204337-G-T **
18873431-G-T 16761551-G-T **
9030071-A-T 9192462-A-T **
9029925-G-T 9192316-G-T **
9013072-C-A 9175463-C-A **
9006777-A-C 9169168-A-C **
8698652-C-A 8830611-C-A **
8669962-T-C 8801921-T-C **
9094624-T-G 9257015-T-G **
8002039-T-G 8133998-T-G **
8134643-A-C 8266602-A-C **
8119118-C-T 8251077-C-T **
14289062-C-A 12168356-C-A **
24634099-G-T 22487952-G-T P3_t2 **
8040139-C-A 8172098-C-A **
8036308-T-C 8168267-T-C **
8035967-A-G 8167926-A-G **
7976410-G-T 8108369-G-T **
8135070-A-T 8267029-A-T **
7975942-G-T 8107901-G-T **
7975853-G-C 8107812-G-C **
13928690-C-A 11807984-C-A **
7939646-GA-G 8071605-GA-G **
7939641-T-A 8071600-T-A **
7938787-A-C 8070746-A-C **
7922761-T-C 8054720-T-C **
7922755-A-C 8054714-A-C **
8135063-C-A 8267022-C-A **
21518387-C-A 19356501-C-A **
8654810-T-G 8786769-T-G **
8290152-A-G 8422111-A-G **
8399297-A-T 8531256-A-T **
8399246-A-T 8531205-A-T **
8350602-C-A 8482561-C-A **
8344328-T-C 8476287-T-C **
8344308-C-G 8476267-C-G **
8343979-A-T 8475938-A-T **
8333463-T-C 8465422-T-C **
8668225-T-G 8800184-T-G **
10766813-T-C **
8145275-G-T 8277234-G-T **
8279952-G-T 8411911-G-T **
8279930-T-G 8411889-T-G **
15206032-A-C 13094118-A-C **
8279928-G-T 8411887-G-T **
10689030-T-C **
8217774-T-G 8349733-T-G **
8184613-T-G 8316572-T-G **
8151163-T-A 8283122-T-A **
9075321-C-A 9237712-C-A **
9069946-G-A 9232337-G-A FGC74990 **
28526931-G-T 26380784-G-T **
10032679-A-C 10195070-A-C **
10653663-A-G **
10653454-C-A **
10652444-T-G **
22997926-C-A 20836040-C-A **
10652422-C-G **
11029768-T-A **
10032691-A-C 10195082-A-C **
10025267-C-G 10187658-C-G **
21617700-C-A 19455814-C-A **
10011041-T-C 10173432-T-C **
9979265-G-T 10141656-G-T **
9979250-G-T 10141641-G-T **
9977591-G-T 10139982-G-T **
11029771-C-A **
11029779-A-C **
9094634-A-T 9257025-A-T **
9888075-T-A 10050466-T-A **
10659464-A-C **
10660201-A-T **
9877218-C-A 10039609-C-A **
10759545-C-A **
10766790-C-T **
10766780-T-C **
10766776-A-C **
10766771-G-C **
10766752-C-T **
10764199-A-T **
10764191-G-C **
10759219-T-C **
10684221-T-G **
10759215-C-G **
10759201-C-A **
10826744-C-A **
10744536-T-G **
14817419-ATT-A 12705490-ATT-A 12×T**
4070741-C-A 4202700-C-A **
10688387-T-G **
10688385-A-C **
9881407-A-C 10043798-A-C **
9960889-T-C 10123280-T-C **
5761331-C-A 5893290-C-A **
9399726-C-T 9562117-C-T **
9424614-AG-A 9587005-AG-A **
9414596-T-G 9576987-T-G **
9414553-T-A 9576944-T-A **
9408388-T-C 9570779-T-C **
9402454-A-C 9564845-A-C **
9400080-A-G 9562471-A-G **
9380397-T-G 9542788-T-G **
9444501-C-A 9606892-C-A **
9364510-G-T 9526901-G-T **
9302744-G-T 9465135-G-T **
9302720-G-T 9465111-G-T **
9157936-C-A 9320327-C-A **
9136657-A-C 9299048-A-C **
9112689-C-A 9275080-C-A **
9094636-A-T 9257027-A-T **
9442774-T-G 9605165-T-G **
9434991-G-T 9597382-G-T **
9465125-T-C 9627516-T-C **
9511719-G-A 9674110-G-A **
11029786-C-T **
9823563-A-C 9985954-A-C **
13215387-C-A 11059711-C-A **
8279971-T-G 8411930-T-G **
13233530-C-A 11077854-C-A **
9737286-G-T 9899677-G-T IR3_Prx **
9649470-A-C 9811861-A-C IR3_Prx **
9513695-T-G 9676086-T-G **
9631762-T-TA 9794153-T-TA IR3_Prx **
9509919-G-T 9672310-G-T **
9465178-G-T 9627569-G-T **
15777486-C-A 13665606-C-A **
9465199-G-T 9627590-G-T **
13453409-C-CA 11297733-C-CA ***
14557804-C-A 12446005-C-A ***
28813084-G-A 26666937-G-A ***
10671931-C-A ***
15869054-GT-G 13757174-GT-G 9878559-G-T 11×T***
25030353-G-A 22884206-G-A g1 ***
15839926-C-T 13728046-C-T ***
23412324-C-A 21250438-C-A ***
16421063-C-A 14309183-C-A ***
13453409-C-A 11297733-C-A ***
20804004-T-TTG 18642118-T-TTG P4_Gap 19×TG***
16568881-TAA-T,TA 14457001-TAA-T,TA 16×A***
22998809-C-A 20836923-C-A ***
24502936-C-A 22356789-C-A ***
24511133-C-A 22364986-C-A ***
28661098-C-A 26514951-C-A ***
19529116-C-CTT 17417236-C-CTT 14×T***
14022446-C-A 11901740-C-A ***
23827851-C-A 21665965-C-A ***
9966944-C-A 10129335-C-A ***
15781688-A-G 13669808-A-G ***
15869236-G-GTT 13757356-G-GTT 13×T***
10752682-C-A ***
10694073-T-A ***
10691107-C-T ***
16078537-C-A 13966657-C-A ***
16231378-C-A 14119498-C-A ***
10060231-C-A 10222622-C-A ***
16297902-C-A 14186022-C-A ***
16424024-C-A 14312144-C-A ***
15677505-CA-C,CAA 13565625-CA-C,CAA 16×A***
16483879-C-A 14371999-C-A ***
9785839-TA-T 9948230-TA-T ***
9770369-C-A 9932760-C-A ***
9469608-G-T 9631999-G-T ***
16922126-C-A 14810246-C-A ***
17033802-C-A 14921922-C-A ***
17119079-C-A 15007199-C-A ***
17465878-G-A 15353998-G-A ***
8286631-A-G 8418590-A-G ***
17572215-C-A 15460335-C-A ***
15772992-G-T 13661112-G-T ***
15561989-C-A 13450109-C-A ***
8139919-G-T 8271878-G-T ***
13489615-ACCCACCCCCACCACCACCCA-A,ACCCTCACTCCACACACAAACC 11333939-ACCCACCCCCACCACCACCCA-A,ACCCTCACTCCACACACAAACC ***
14147301-C-A 12026595-C-A ***
14150909-A-T 12030203-A-T ***
14233365-C-A 12112659-C-A ***
14327977-C-A 12207271-C-A ***
14328891-C-A 12208185-C-A ***
14358494-G-T 12237789-G-T ***
13694916-G-A 11539240-G-A ***
13676648-GTGGAATGGAATGGAATGGAATGGAATGGAA-G 11520972-GTGGAATGGAATGGAATGGAATGGAATGGAA-G 11×TGGAA***
13523106-T-C 11367430-T-C ***
13255624-GT-G,GTT 11099948-GT-G,GTT 10×T***
15557504-A-G 13445624-A-G ***
14771643-C-A 12659712-C-A ***
14788452-C-A 12676523-C-A ***
11022877-C-T ***
15028710-C-A 12916798-C-A ***
10951115-C-A ***
15126123-C-T 13014210-C-T ***
15174614-G-A 13062700-G-A ***
10924401-C-G ***
15402260-C-T 13290380-C-T ***
15545194-C-A 13433314-C-A ***
8266769-C-A 8398728-C-A ***
8106663-A-G 8238622-A-G ***
22010460-C-A 19848574-C-A ***
56833340-CT-CC,G ***
2859939-C-A 2991898-C-A ***
21986493-C-A 19824607-C-A ***
2855245-C-A 2987204-C-A ***
2849447-T-A 2981406-T-A ***
2824200-C-A 2956159-C-A ***
2797175-C-A 2929134-C-A ***
22774735-C-A 20612849-C-A ***
19215149-C-A 17103269-C-A ***
22869879-C-A 20707993-C-A ***
23044921-C-A 20883035-C-A ***
21827584-CA-C 19665698-CA-C ***
21617543-C-A 19455657-C-A ***
18996884-C-CTT 16885004-C-CTT 13×T***
23412316-C-A 21250430-C-A ***
23431039-A-G 21269153-A-G ***
23440163-C-A 21278277-C-A ***
14743386-C-A 12631454-C-A ***
23573240-C-A 21411354-C-A ***
19032538-CA-C,CAA 16920658-CA-C,CAA 14×A***
23597669-G-T 21435783-G-T ***
18250054-CT-C 16138174-CT-C ***
21934892-C-A 19773006-C-A ***
21700823-T-A 19538937-T-A ***
8104887-C-A 8236846-C-A ***
6364572-C-A 6496531-C-A ***
17864637-CT-C 15752757-CT-C ***
7138786-C-A 7270745-C-A ***
18685992-GAAAA-G 16574112-GAAAA-G 13×A***
18698689-C-A 16586809-C-A ***
18740028-TA-T 16628148-TA-T ***
7036579-C-G 7168538-C-G 11×T***
19022172-C-A 16910292-C-A ***
19089000-T-C 16977120-T-C ***
6401292-G-T 6533251-G-T ***
6144974-C-A 6276933-C-A IR3_Dst ***
21695890-G-T 19534004-G-T ***
19322284-G-A 17210404-G-A ***
19370055-C-A 17258175-C-A ***
19407324-C-A 17295444-C-A ***
19421612-C-A 17309732-C-A ***
19422106-C-A 17310226-C-A ***
19529643-C-A 17417763-C-A ***
5292361-C-A 5424320-C-A ***
5170375-T-A 5302334-T-A ***
3648883-T-C 3780842-T-C ***
21648330-C-A 19486444-C-A ***
19103869-G-GT 16991989-G-GT 10×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page