James

BigY3: N78050
MDKA Birth: England

Tree Position

A0-T-YP2191 > P305[A1] > A1b > BT/A1b2 > M168/PF1416[CT] > P143[CF] > M89/PF2746[F] > F1329/M3658[GHI > F929[HIJK] > IJK > K > M526[K2] > P295[P] > M207[R] > M173[R1] > L146/M420[R1a] > M459 > M198 > M417 > Z645 > Z283 > Z282 > Y2395 > Z284 > S4458 > S5301 > S5153 > S3449 > CTS3438 > BY2307 > 12943003-C-A

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
N78050
9734844-A-T 9897235-A-T IR3_Prx A+
9746301-A-G 9908692-A-G A+
23898463-G-A 21736577-G-A A+
56833678-C-CA A*
6113757-T-C 6245716-T-C A*
19667108-G-A 17555228-G-A P5_Prx A*
3070013-G-A 3201972-G-A FT14868 +
3227428-C-T 3359387-C-T FT15038 +
4456810-G-GT 4588769-G-GT +
5257040-A-G 5388999-A-G FT17362 +
8565903-C-T 8697862-C-T FT19981 YY+
9955521-C-T 10117912-C-T FT373492 Y+
10777147-C-A FT430738 +
10844664-A-G FT433791 +
13841530-G-T 11720824-G-T FT9008 +
14376398-G-C 12255694-G-C FT21311 YY+
14412525-C-T 12291822-C-T FT21341 YY+
14561243-G-A 12449444-G-A FT21479 YY+
15352994-A-G 13241113-A-G FT21963 YY+
15467084-T-C 13355204-T-C FT22060 YY+
16262404-A-G 14150524-A-G FT22571 YY+
17080343-C-T 14968463-C-T YY+
17101181-A-T 14989301-A-T FT23215 YY+
17352132-C-T 15240252-C-T YY+
17766839-A-G 15654959-A-G FT23765 YY+
17878963-G-A 15767083-G-A YY+
17952838-G-A 15840958-G-A FT23924 YY+
19475653-G-A 17363773-G-A FT25017 YY+
22437160-G-T 20275274-G-T FT456137 DYZ19 +
22470213-T-C 20308327-T-C FT265064 DYZ19 +
22663532-G-A 20501646-G-A BY168566 YY+
22770724-T-C 20608838-T-C FT26157 YY+
23184949-G-T 21023063-G-T FT26469 Y+
23638051-G-T 21476165-G-T FT26775 Y+
24579309-C-T 22433162-C-T P3_t2 *
24387373-C-CAT 22241226-C-CAT **
18060349-T-G 15948469-T-G **
3443808-C-T 3575767-C-T **
4941834-C-T 5073793-C-T FT241475 **
5066227-C-T 5198186-C-T **
13348047-A-T 11192371-A-T **
13482564-A-G 11326888-A-G **
13608679-T-C 11453003-T-C **
14848995-C-T 12737061-C-T **
18446-C-T **
15480111-ATTTT-A 13368231-ATTTT-A 21×T***
28634133-TA-T 26487986-TA-T 10×A***
6996696-CTTT-C 7128655-CTTT-C 15×T***
16855372-TAAA-T 14743492-TAAA-T 17×A***
56826837-CATTCCATTCGATTCCATTCCATTCAATTCC-C,CATTCCATTCGATTCCATTCCATTCGATTAG ***
23281361-ATT-A 21119475-ATT-A 14×T***
21700595-GAAAA-G 19538709-GAAAA-G 17×A***
16519316-CA-C,CAA 14407436-CA-C,CAA 15×A***
11021351-CTACTGCATTC-A ***
2651883-CT-C,CTT 2783842-CT-C,CTT 19×T***
15928371-CTTTTTT-C 13816491-CTTTTTT-C 26×T***
9361168-GAC-G,GACACAC 9523559-GAC-G,GACACAC 12×AC***
18060371-CAT-C 15948491-CAT-C ***
20631937-T-TACAC 18470051-T-TACAC P4_Prx 21×AC***
5492439-C-CTT 5624398-C-CTT 18×T***
4200055-CAAAAA-C 4332014-CAAAAA-C 23×A***
6776497-C-CAA 6908456-C-CAA 28×A***
3079630-G-A 3211589-G-A ***
6709761-T-C 6841720-T-C ***
7768448-G-A 7900407-G-A ***
8648172-GATATATATATATATAT-G 8780131-GATATATATATATATAT-G 14×AT***
13401487-G-T 11245811-G-T ***
13414272-T-C 11258596-T-C ***
15093938-T-C 12982026-T-C ***
18035665-CTTTTTT-C,CT 15923785-CTTTTTT-C,CT 30×T***
19469877-ACCC-A,ACCCC 17357997-ACCC-A,ACCCC 12×C***
21340450-C-A 19178564-C-A ***
21340462-A-G 19178576-A-G ***
23435682-CTTT-C,CTTTT 21273796-CTTT-C,CTTTT 21×T***
24904674-GT-G,GTT 22758527-GT-G,GTT g1 21×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.