Big Tree: Person Data

Tree Position

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19)	POS-REF-ALT (hg38)	Blocks	Names	Region	McDonald BED	combBED	STR	BigY3 154059
5049610-A-G	5181569-A-G							A+
22334158-A-T	20172272-A-T			DYZ19				A+
58980226-C-T	56834079-C-T							A*
58979155-G-A	56833008-G-A							A*
	56832036-T-C							A*
13451766-C-T	11296090-C-T							A*
13451739-C-A	11296063-C-A							A*
	56832622-G-T							A*
6215056-C-A	6347015-C-A			IR3_Dst				A*
6285029-G-C	6416988-G-C			IR3_Dst				A*
19676229-T-C	17564349-T-C		BY27213	P5_Prx				A*
19839759-T-TA	17727879-T-TA			P5_Prx				A*
20046721-T-C	17934841-T-C			P5_Prx				A*
20056059-T-C	17944179-T-C			P5_Prx				A*
22230722-G-A	20068836-G-A			DYZ19				A*
22312883-C-G	20150997-C-G			DYZ19				A*
25559976-A-G	23413829-A-G			P1_gr1				A*
25572601-A-G	23426454-A-G			P1_gr1				A*
25859969-G-A	23713822-G-A			P1_Y1				A*
25972835-G-A	23826688-G-A			P1_Y1				A*
26071765-T-G	23925618-T-G			P1_Y1				A*
26177491-C-G	24031344-C-G			P1_Y1				A*
	56831651-C-T							A*
7814875-C-T	7946834-C-T	S845	FGC8536 Y14299		Y	Y		+
6867506-G-A	6999465-G-A		F4065		Y	Y		+
13944775-G-A	11824069-G-A		BY91984		Y	Y		+
21551807-ATG-A	19389921-ATG-A							+
3280861-T-C	3412820-T-C		FT33072					+
3485666-C-T	3617625-C-T		FT287317					+
3502674-C-T	3634633-C-T		FT33116					+
4014075-C-T	4146034-C-T		FT33212					+
5131639-A-C	5263598-A-C		FT287521					+
5664028-A-G	5795987-A-G		FT33561					+
6134925-G-C	6266884-G-C		FT33661					+
6439711-G-GAATC	6571670-G-GAATC							+
7009672-C-T	7141631-C-T		FT33769		Y	Y		+
7732025-A-G	7863984-A-G		BY176489		Y	Y		+
7749797-C-T	7881756-C-T		BY176490		Y	Y		+
7842351-C-T	7974310-C-T		FT287798		Y	Y		+
7928607-C-A	8060566-C-A		BY176508		Y	Y		+
8183161-G-A	8315120-G-A		BY176539		Y	Y		+
8300008-C-T	8431967-C-T				Y	Y		+
8475254-G-A	8607213-G-A				Y	Y		+
8682181-AG-A	8814140-AG-A							+
9051576-T-C	9213967-T-C					Y		+
9436270-A-T	9598661-A-T		FT287965		Y	Y		+
9437824-C-G	9600215-C-G				Y	Y		+
9889815-T-A	10052206-T-A		FT34216		Y			+
	11005588-T-G							+
14394141-T-C	12273437-T-C		FT34379		Y	Y		+
14787172-C-T	12675242-C-T		FT288162		Y	Y		+
15901393-G-T	13789513-G-T		FT34578		Y	Y		+
16836680-C-T	14724800-C-T				Y	Y		+
17244896-T-C	15133016-T-C		FT34766		Y			+
17310943-T-C	15199063-T-C		FT34774		Y	Y		+
17546614-C-A	15434734-C-A		FT34822		Y	Y		+
17957586-C-T	15845706-C-T				Y	Y		+
19023665-C-G	16911785-C-G		FT288660		Y	Y		+
19279710-A-G	17167830-A-G		FT288691		Y	Y		+
21042238-C-T	18880352-C-T		FT35109		Y			+
21276794-C-A	19114908-C-A		FT288761		Y			+
21305815-T-C	19143929-T-C				Y	Y		+
21403912-C-A	19242026-C-A		FT35162		Y	Y		+
21558248-C-A	19396362-C-A				Y	Y		+
21937918-G-T	19776032-G-T		FT35246		Y	Y		+
22255992-G-A	20094106-G-A		FT453717	DYZ19				+
22273012-C-T	20111126-C-T		BY183872	DYZ19				+
22445415-C-G	20283529-C-G		FT292829	DYZ19				+
23972682-G-A	21826535-G-A		BY177478			Y		+
24875842-G-A	22729695-G-A		BY27216	g1				+
28483266-C-A	26337119-C-A		FT35519					+
28754258-T-A	26608111-T-A		FT292786					+
28754334-G-A	26608187-G-A							+
	11015866-ACCATTCCATT-A							*
21551789-G-A	19389903-G-A				Y			*
21551793-G-A,GTA	19389907-G-A,GTA							*
22225073-C-T	20063187-C-T		FT453012	DYZ19				*
22235426-A-G	20073540-A-G			DYZ19				*
22276980-T-G	20115094-T-G			DYZ19				*
22300001-T-C	20138115-T-C			DYZ19				*
22277533-T-G	20115647-T-G			DYZ19				**
8321435-CTTTT-C	8453394-CTTTT-C						15×T	**
18238869-A-AAT	16126989-A-AAT							**
13705524-T-A	11549848-T-A							**
28347914-T-TA	26201767-T-TA			P1_gr2				**
16290939-C-T	14179059-C-T							**
2894522-C-A	3026481-C-A							**
3335902-GT-G	3467861-GT-G							**
3543121-C-T	3675080-C-T							**
4378111-G-A	4510070-G-A							**
4741629-T-C	4873588-T-C		FT33367					**
8090878-A-G	8222837-A-G							**
9784727-T-C	9947118-T-C							**
	10923671-TCCCCCA-T							**
13359842-C-A	11204166-C-A							**
13429156-C-G	11273480-C-G							**
14919473-A-AT	12807538-A-AT							**
16290946-A-G	14179066-A-G							**
24286453-A-C	22140306-A-C			P3_t1				**
28725182-G-A	26579035-G-A		FT35557					**
23380162-TTATTTATTTATG-T	21218276-TTATTTATTTATG-T	Y20420						***
15399419-G-GAA	13287539-G-GAA						15×A	***
21141094-T-C	18979208-T-C							***
2685644-CTTTT-C	2817603-CTTTT-C						20×T	***
8660550-CAAAA-C	8792509-CAAAA-C						18×A	***
7984040-TAAA-T,TAAAA	8115999-TAAA-T,TAAAA						21×A	***
5945467-CTTTTT-C	6077426-CTTTTT-C						25×T	***
28522376-CT-C,CTT	26376229-CT-C,CTT						18×T	***
2673768-T-A	2805727-T-A							***
2759845-TA-T	2891804-TA-T							***
2766707-T-A	2898666-T-A							***
7347034-G-A	7478993-G-A							***
13455898-TCATTCCATTCCATTC-T,TCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTC	11300222-TCATTCCATTCCATTC-T,TCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTC						10×CATTC	***
17609661-T-C	15497781-T-C							***
18877671-A-G	16765791-A-G							***
18890443-A-C	16778563-A-C							***
22280273-G-A	20118387-G-A			DYZ19				***
23389545-T-A	21227659-T-A							***
23389546-T-A	21227660-T-A							***
28804297-G-T	26658150-G-T							***
28804315-G-GTGGAC	26658168-G-GTGGAC							***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Jones

Tree Position

Unique Mutations