Esposito

BigY3: 872433

Tree Position

R-M269 > PF7562 > 26595775-C-G

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
872433
20217960-T-TA 18056074-T-TA P5_Dst 13×AA+
9552215-T-C 9714606-T-C IR3_Prx A+
27602521-A-G 25456374-A-G P1_Y2 A+
28786006-A-G 26639859-A-G A*
13472380-G-A 11316704-G-A A*
13250436-C-T 11094760-C-T A*
16352456-C-CA 14240576-C-CA 21×AA*
6630512-C-CT 6762471-C-CT 15×TA*
28816614-G-A 26670467-G-A A*
13843923-A-AGGAAT 11723217-A-AGGAAT 14×GGAATA*
17711769-C-CT 15599889-C-CT 11×TA*
18863060-A-AT 16751180-A-AT 10×TA*
28785100-A-G 26638953-A-G A*
10755390-T-TACTCTA A*
10940378-T-C A*
10776187-C-T A*
10755481-C-T A*
10776554-T-C A*
56851258-C-T A*
8107510-C-CT 8239469-C-CT BY2931 10×TA*
10744335-A-G A*
28817786-G-T 26671639-G-T A*
19963239-C-A 17851359-C-A P5_Prx A*
18411877-G-GA 16299997-G-GA P6_Gap 10×AA*
6052742-A-AT 6184701-A-AT 10×TA*
28816609-G-T 26670462-G-T A*
10776521-C-G A*
56832622-G-C A*
10013312-C-T 10175703-C-T YA*
28812832-C-A 26666685-C-A A*
28812845-A-T 26666698-A-T FT462622 A*
28812782-C-A 26666635-C-A A*
13451626-C-A 11295950-C-A A*
28812794-T-A 26666647-T-A A*
13450761-C-T 11295085-C-T A*
56874808-T-AGC A*
56833577-C-A A*
13687366-G-T 11531690-G-T A*
6283626-G-T 6415585-G-T IR3_Dst A*
13449260-G-A 11293584-G-A A*
13451563-C-A 11295887-C-A A*
13687400-T-C 11531724-T-C A*
18343203-T-C 16231323-T-C P6_Prx A*
19945858-G-C 17833978-G-C P5_Prx A*
22232552-A-T 20070666-A-T DYZ19 A*
22291538-T-C 20129652-T-C DYZ19 A*
22305218-G-A 20143332-G-A DYZ19 A*
24293526-T-C 22147379-T-C P3_t1 A*
24298517-C-T 22152370-C-T P3_t1 A*
26169404-A-G 24023257-A-G P1_Y1 A*
56834206-C-G A*
9777036-T-G 9939427-T-G Y133928FGC21943 Y4×TTTG+
4075843-AAAAC-A 4207802-AAAAC-A 8×AAAC+
17196805-A-G 15084925-A-G YY+
18018000-G-A 15906120-G-A BY184583 FGC27007 Y+
7625963-A-G 7757922-A-G Y84490 YY+
10991230-C-A FT182977 +
14219628-T-C 12098922-T-C FT41481 Y+
10804971-ATCCAC-A +
9980687-C-A 10143078-C-A FT182979 Y+
17196807-G-A 15084927-G-A YY5×AGAA+
18381714-G-T 16269834-G-T FT43020 P6_Gap +
15227418-G-A 13115504-G-A Y+
10939463-G-A FT182978 +
3029913-G-C 3161872-G-C FT38204 +
3241146-G-T 3373105-G-T FT38324 +
3808211-T-C 3940170-T-C FT38641 +
4210533-T-C 4342492-T-C FT38914 +
4879250-C-T 5011209-C-T FT39303 +
5453461-T-G 5585420-T-G FT39612 +
5555984-T-C 5687943-T-C FT39678 +
5674335-A-G 5806294-A-G FT39760 +
5993525-G-T 6125484-G-T FT39957 +
6909820-T-G 7041779-T-G YY+
7664985-A-C 7796944-A-C YY+
7841084-G-A 7973043-G-A BY16680 YY+
7905031-G-T 8036990-G-T YY+
8898327-C-G 9030286-C-G Y+
9523452-G-A 9685843-G-A +
9690429-A-G 9852820-A-G FT41141 IR3_Prx +
9981803-C-A 10144194-C-A FT373706 Y+
10762521-T-C FT424475 +
10890311-TACTCCATTCCACTCC-T +
11010225-A-G FT182976 +
13471254-C-A 11315578-C-A BY85857 +
14844417-C-T 12732483-C-T YY+
14944619-C-T 12832693-C-T YY+
15040015-A-T 12928105-A-T FT41825 YY+
15277548-A-T 13165637-A-T YY+
15771782-T-A 13659902-T-A YY+
16084651-A-T 13972771-A-T Y+
16556185-A-G 14444305-A-G YY+
16599750-G-A 14487870-G-A BY108902 YY+
17254471-C-G 15142591-C-G YY+
17371412-C-T 15259532-C-T YY+
18028352-C-T 15916472-C-T Y+
18065166-C-T 15953286-C-T YY+
18166049-T-C 16054169-T-C FT42964 YY+
19345952-T-C 17234072-T-C YY+
19367610-A-T 17255730-A-T YY+
19391722-C-A 17279842-C-A YY+
19432360-G-T 17320480-G-T YY+
19476353-C-T 17364473-C-T FT43447 YY+
21551899-A-G 19390013-A-G FT43686 Y+
21783320-A-G 19621434-A-G YY+
21810502-A-G 19648616-A-G YY+
22507059-G-C 20345173-G-C FT460678 DYZ19 +
22862715-TTTTTG-T 20700829-TTTTTG-T +
22862723-TTTTTTCCTAGGCTT-A 20700837-TTTTTTCCTAGGCTT-A +
23545826-C-T 21383940-C-T FT44319 YY+
23876210-G-A 21714324-G-A FT44409 +
24000964-C-T 21854817-C-T Y+
25530737-T-C 23384590-T-C FT182980 P1_gr1 +
28638128-A-G 26491981-A-G FT44585 +
28686097-T-C 26539950-T-C FT44607 +
28790273-G-A 26644126-G-A +
21317043-A-AATACATAC 19155157-A-AATACATAC 11×ATAC*
16514304-A-ATG 14402424-A-ATG 18×TG*
10755439-T-A *
10760684-T-TTTCCA *
10893706-T-C *
5773383-CTAA-C 5905342-CTAA-C *
10994683-GCACTC-G *
10676613-T-G *
22277203-T-C 20115317-T-C DYZ19 *
22862709-C-CT 20700823-C-CT *
3279734-T-TAAAC 3411693-T-TAAAC **
24302816-C-A 22156669-C-A P3_t1 24×A**
13140550-T-C 10630036-T-C **
13467301-A-G 11311625-A-G **
24302816-C-CA 22156669-C-CA P3_t1 24×A**
27967353-T-G 25821206-T-G P1_Y2 **
24386977-CTA-C 22240830-CTA-C **
24387699-C-A 22241552-C-A FTA43235 **
24387712-A-C 22241565-A-C **
59000479-G-C 56854332-G-C **
13467356-T-A 11311680-T-A **
13467364-T-A 11311688-T-A **
13467376-A-G 11311700-A-G **
13467394-C-A 11311718-C-A **
13467386-C-A 11311710-C-A **
13467350-T-C 11311674-T-C **
17821825-GAAA-G 15709945-GAAA-G 17×A**
11015170-T-C ***
13467303-A-T 11311627-A-T **
13467329-A-T 11311653-A-T **
13467343-A-C 11311667-A-C **
26066360-GT-G 23920213-GT-G P1_Y1 13×T**
18480329-G-T 16368449-G-T P6_Dst **
10923576-C-T **
22962008-GTTTTT-G 20800122-GTTTTT-G 27×T**
19759663-TC-T 17647783-TC-T P5_Prx **
20602630-C-A 18440744-C-A P5_Dst **
20602631-A-C 18440745-A-C P5_Dst **
20602638-T-C 18440752-T-C P5_Dst **
20602639-C-T 18440753-C-T P5_Dst **
20602646-T-C 18440760-T-C P5_Dst **
20602648-T-C 18440762-T-C P5_Dst **
20602652-A-G 18440766-A-G P5_Dst **
20602660-A-G 18440774-A-G P5_Dst **
20602665-G-A 18440779-G-A P5_Dst **
20602674-T-A 18440788-T-A P5_Dst **
20602678-A-C 18440792-A-C P5_Dst **
20602680-G-A 18440794-G-A P5_Dst **
16395339-T-C 14283459-T-C **
26066344-G-T 23920197-G-T P1_Y1 **
7127994-C-T 7259953-C-T **
5253115-A-AT 5385074-A-AT **
10070944-T-C 10233335-T-C **
13445746-G-T 11290070-G-T **
14278808-T-C 12158102-T-C **
14683972-C-T 12572038-C-T **
16148998-A-AT 14037118-A-AT P8_Dst **
16162094-T-G 14050214-T-G P8_Dst **
16162096-A-ATT 14050216-A-ATT P8_Dst **
19203963-T-C 17092083-T-C **
19625930-A-C 17514050-A-C P5_Prx **
20727192-A-T 18565306-A-T P4_Prx **
26021526-G-T 23875379-G-T P1_Y1 **
56752224-TTCGAATGGAATGCAA-T **
10621-G-C **
13466920-G-A 11311244-G-A ***
58974951-G-C 56828804-G-C ***
18060422-TGA-T 15948542-TGA-T 10×GA***
13142948-GCATTC-G 10632434-GCATTC-G 11×CATTC***
8501689-CTCTTCT-C 8633648-CTCTTCT-C 18×TCT***
28577950-T-TAC 26431803-T-TAC 17×AC***
16723435-G-GTTTA 14611555-G-GTTTA 9×TTTA***
13466879-C-T 11311203-C-T ***
20804885-G-GTA 18642999-G-GTA P4_Gap 15×TA***
6402149-G-A 6534108-G-A ***
13463492-G-A 11307816-G-A FT443957 ***
58975272-A-T 56829125-A-T ***
4847447-TA-T 4979406-TA-T 11×A***
28542416-CAA-C 26396269-CAA-C 17×A***
5042180-GATATAT-G 5174139-GATATAT-G 17×AT***
10755422-CA-C ***
10755437-C-T ***
10787495-G-C FT431208 ***
21092191-CTTT-C 18930305-CTTT-C 18×T***
13465993-C-A 11310317-C-A ***
2845221-CAAA-C 2977180-CAAA-C 38×A***
13203566-CAAA-C 19×A***
16896539-CAAA-C 14784659-CAAA-C 17×A***
17604931-GTTTT-G 15493051-GTTTT-G 24×T***
10942650-TA-T,TC ***
21104437-TAAA-T 18942551-TAAA-T 22×A***
15138012-CTT-C 13026099-CTT-C 15×T***
10947389-A-T ***
21261826-TAAA-T 19099940-TAAA-T 26×A***
28817647-AGGAATGGAATGGAAT-A 26671500-AGGAATGGAATGGAAT-A 9×GGAAT***
7179734-GTTT-G 7311693-GTTT-G 25×T***
21122953-G-GA 18961067-G-GA 10×A***
4880892-ATT-A 5012851-ATT-A 17×T***
13465952-A-C 11310276-A-C ***
28474965-CAA-C 26328818-CAA-C 18×A***
56861855-C-A ***
13478112-AC-A 11322436-AC-A ***
56862632-TTTT-T,TTG ***
10990086-T-TACTCC ***
2857597-A-AT 2989556-A-AT 10×T***
28508007-CAA-C 26361860-CAA-C 14×A***
3248829-C-T 3380788-C-T ***
11001939-ATTATATTCGC-A,ATTCCATTATATTCGC ***
13466930-G-T 11311254-G-T ***
13466922-T-G 11311246-T-G ***
13466959-A-G 11311283-A-G ***
13450112-CACCCCATCCCATCCCATTCT-C,CACCCCATTCCATTCCTTTCC 11294436-CACCCCATCCCATCCCATTCT-C,CACCCCATTCCATTCCTTTCC ***
6093470-TGGG-T 6225429-TGGG-T 12×G***
19155945-C-T 17044065-C-T ***
22345390-G-T 20183504-G-T DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.