Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z272 > S450 > Z295/S1217 > S25783 > CTS4065 > FGC23196 > FGC23175 > FGC32182

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
76755
FGC-BigY
AMLSX
8701198-T-TA 8833157-T-TA ++
13686053-G-C 11530377-G-C FGC32185 ++
16087179-G-A 13975299-G-A FGC32188 Y++
16377909-G-A 14266029-G-A FGC32189 YY++
16438348-C-G 14326468-C-G FGC32190 YY++
15822499-A-C 13710619-A-C FGC32187 YY++
24476089-T-G 22329942-T-G FGC32192 Y++
10048662-C-T 10211053-C-T **
7008136-C-A 7140095-C-A **
2758458-C-A 2890417-C-A **
22167212-C-G 20005326-C-G **
16624708-G-A 14512828-G-A **
22209209-G-T 20047323-G-T **
3273232-G-T 3405191-G-T **
3334983-G-T 3466942-G-T **
22085460-C-A 19923574-C-A **
22065033-C-A 19903147-C-A **
10048587-A-T 10210978-A-T **
16882024-C-A 14770144-C-A **
14180886-C-A 12060180-C-A **
17222575-C-A 15110695-C-A **
14717520-G-T 12605588-G-T **
14272860-C-A 12152154-C-A **
14355254-C-A 12234549-C-A **
14372083-C-A 12251379-C-A **
58985312-C-A 56839165-C-A **
58981502-C-A 56835355-C-A **
14565935-G-T 12454135-G-T **
14607774-C-A 12495976-C-A **
14960282-C-A 12848357-C-A **
13597258-C-A 11441582-C-A **
28625537-T-C 26479390-T-C **
15430617-G-A 13318737-G-A **
8078934-C-A 8210893-C-A **
23005838-A-G 20843952-A-G **
28546726-C-A 26400579-C-A **
4958377-G-T 5090336-G-T **
22542284-C-A 20380398-C-A **
16041187-C-A 13929307-C-A **
10048601-G-C 10210992-G-C **
10048615-G-T 10211006-G-T **
13494140-C-A 11338464-C-A **
10048604-T-A 10210995-T-A **
18730854-C-A 16618974-C-A **
21054409-C-A 18892523-C-A **
10025014-C-A 10187405-C-A **
18767305-C-T 16655425-C-T **
21340057-C-A 19178171-C-A **
22220574-C-A 20058688-C-A DYZ19 *****
27369590-G-C 25223443-G-C P1_g3 **
19325606-C-A 17213726-C-A **
21393628-C-A 19231742-C-A **
25103067-C-A 22956920-C-A g1 ***
26902197-G-A 24756050-G-A P1_r3 ***
25207703-G-C 23061556-G-C P2_r1 ***
24975975-T-G 22829828-T-G g1 ***
25207741-T-G 23061594-T-G P2_r1 ***
24794496-T-G 22648349-T-G P3_b2 ***
26880358-A-C 24734211-A-C P1_r3 ***
24777087-A-C 22630940-A-C P3_b2 ***
24721577-C-T 22575430-C-T P3_b2 ***
26880345-A-T 24734198-A-T P1_r3 ***
24671213-G-C 22525066-G-C P3_b2 ***
26914221-A-T 24768074-A-T P1_r3 ***
24673297-A-G 22527150-A-G P3_b2 ***
26810702-G-T 24664555-G-T P1_g2 ***
24595539-A-T 22449392-A-T P3_t2 ***
24595478-A-T 22449331-A-T P3_t2 ***
24595430-C-G 22449283-C-G P3_t2 ***
24535184-G-C 22389037-G-C P3_t2 ***
26914241-A-T 24768094-A-T P1_r3 ***
24387977-A-C 22241830-A-C ***
24387765-C-T 22241618-C-T ***
26990981-A-G 24844834-A-G P1_r4 ***
25231924-T-G 23085777-T-G P2_r1 ***
25291221-C-A 23145074-C-A P2_r1 ***
26776111-A-T 24629964-A-T P1_g2 ***
25845139-T-A 23698992-T-A P1_b3 ***
26344131-A-C 24197984-A-C P1_Y1 ***
26239177-T-G 24093030-T-G P1_Y1 ***
26124396-T-A 23978249-T-A P1_Y1 ***
26463176-C-T 24317029-C-T P1_Y1 ***
25845158-G-A 23699011-G-A P1_b3 ***
26463200-A-T 24317053-A-T P1_Y1 ***
26495672-C-T 24349525-C-T P1_Y1 ***
26495684-A-G 24349537-A-G P1_Y1 ***
26505338-T-C 24359191-T-C P1_Y1 ***
26541557-T-A 24395410-T-A P1_g2 ***
26553411-G-T 24407264-G-T P1_g2 ***
25806700-T-G 23660553-T-G P1_b3 ***
26746958-C-A 24600811-C-A P1_g2 ***
26558014-T-C 24411867-T-C P1_g2 ***
25676403-G-T 23530256-G-T P1_b3 ***
26563820-G-T 24417673-G-T P1_g2 ***
25602271-T-A 23456124-T-A P1_gr1 ***
25504641-A-C 23358494-A-C P1_gr1 ***
25456411-C-A 23310264-C-A P2_r2 ***
25372091-A-T 23225944-A-T P2_r2 ***
26631849-T-C 24485702-T-C P1_g2 ***
26657066-C-A 24510919-C-A P1_g2 ***
25372080-G-A 23225933-G-A P2_r2 ***
26391451-G-A 24245304-G-A P1_Y1 ***
26661614-C-A 24515467-C-A P1_g2 ***
24807425-C-T 22661278-C-T P3_b2 ***
23449042-C-A 21287156-C-A ***
24278301-A-G 22132154-A-G P3_b1 ***
20809669-C-A 18647783-C-A P4_Gap ***
21577365-G-T 19415479-G-T ***
21515862-C-A 19353976-C-A 28×A***
21488867-G-A 19326981-G-A ***
21394605-C-A 19232719-C-A ***
21394390-C-A 19232504-C-A ***
21352815-C-G 19190929-C-G ***
21323452-A-G 19161566-A-G ***
21107041-C-G 18945155-C-G ***
21107030-C-A 18945144-C-A ***
21107026-T-G 18945140-T-G ***
20998297-T-C 18836411-T-C P4_Dst ***
20825432-C-A 18663546-C-A P4_Gap ***
20622565-G-A 18460679-G-A P4_Prx ***
22236302-A-G 20074416-A-G DYZ19 ***
20516715-A-C 18354829-A-C P5_Dst ***
20510724-T-A 18348838-T-A P5_Dst ***
20508737-A-G 18346851-A-G P5_Dst ***
20500988-T-G 18339102-T-G P5_Dst ***
20439204-A-T 18277318-A-T P5_Dst ***
20434742-C-T 18272856-C-T P5_Dst ***
19773617-C-A 17661737-C-A P5_Prx ***
19727576-A-T 17615696-A-T P5_Prx ***
19704252-A-G 17592372-A-G P5_Prx ***
19693500-C-T 17581620-C-T P5_Prx ***
19604795-G-T 17492915-G-T P5_Prx ***
19330184-G-T 17218304-G-T ***
19248303-C-A 17136423-C-A ***
22065068-A-G 19903182-A-G ***
22281946-A-G 20120060-A-G DYZ19 ***
24114319-T-A 21968172-T-A P3_b1 ***
23440697-C-A 21278811-C-A ***
24043795-A-G 21897648-A-G ***
24042742-G-A 21896595-G-A ***
24026947-G-T 21880800-G-T ***
24023926-T-A 21877779-T-A ***
23997440-A-G 21851293-A-G ***
23833034-A-C 21671148-A-C ***
23821107-T-A 21659221-T-A ***
23696326-A-C 21534440-A-C ***
23625493-A-G 21463607-A-G ***
23476223-C-G 21314337-C-G ***
23465387-G-T 21303501-G-T ***
26991241-G-T 24845094-G-T P1_r4 ***
23355522-C-A 21193636-C-A ***
22329851-C-A 20167965-C-A DYZ19 ***
23355260-C-A 21193374-C-A ***
23317720-C-T 21155834-C-T 10×T***
23204566-C-A 21042680-C-A ***
23185234-C-A 21023348-C-A ***
23007836-G-T 20845950-G-T ***
22991049-C-G 20829163-C-G ***
22778370-C-A 20616484-C-A ***
22619591-A-G 20457705-A-G ***
22433956-A-T 20272070-A-T DYZ19 ***
22431981-T-G 20270095-T-G DYZ19 ***
22330463-T-C 20168577-T-C DYZ19 ***
22330453-G-A 20168567-G-A DYZ19 ***
22330445-T-C 20168559-T-C DYZ19 ***
26991212-G-T 24845065-G-T P1_r4 ***
27082234-A-G 24936087-A-G P1_r4 ***
26997316-A-T 24851169-A-T P1_r4 ***
15320672-A-AAGAAGAAGG 13208790-A-AAGAAGAAGG ***
20105750-C-CTATA 17993870-C-CTATA P5_Dst ***
20025482-T-TCCC 17913602-T-TCCC P5_Prx 14×C***
19743732-TAAAT-AAAAA 17631852-TAAAT-AAAAA P5_Prx ***
19727554-ACCT-CCCC 17615674-ACCT-CCCC P5_Prx ***
19682558-TGGGT-GGGGG 17570678-TGGGT-GGGGG P5_Prx ***
19510292-GTA-TTT 17398412-GTA-TTT ***
18454858-CCT-C 16342978-CCT-C P6_Dst 5×CTTT***
17950825-AATATATATATATATATATATATATATATAT-A 15838945-AATATATATATATATATATATATATATATAT-A 27×AT***
17006261-CTT-C 14894381-CTT-C 17×T***
16968150-CA-C 14856270-CA-C 26×A***
16692757-GA-G 14580877-GA-G 27×A***
16629335-CAA-C 14517455-CAA-C 19×A***
15491943-ATA-G 13380063-ATA-G ***
15477291-CAAAAAAA-C 13365411-CAAAAAAA-C 18×A***
15022824-GTTTT-G 12910913-GTTT-G 16×T***
20723277-C-CT 18561391-C-CT P4_Prx 15×T***
13688047-GAATGT-G 11532371-GAATGT-G ***
9714716-CT-C 9877107-CT-C IR3_Prx 13×T***
9731612-GTTTG-TTTTT 9894003-GTTTG-TTTTT IR3_Prx ***
9952198-GGAAATT-CGA 10114589-GGAAATT-CGA ***
13131575-AGCAA-TGCAC 10621061-AGCAA-TGCAC ***
13461183-CA-TG 11305507-CA-TG ***
13546989-ATT-A 11391313-ATT-A 16×T***
13723167-GG-TT 11567491-GG-TT ***
14937865-T-TTTCTTTTCTA 12825940-T-TTTCTTTTCTA ***
13744426-GGAAC-AGAAT 11588750-GGAAC-AGAAT ***
13846911-TATTTATTCG-AATTGTTTCA 11726205-TATTTATTCG-AATTGTTTCA ***
13846940-TAT-GAA 11726234-TAT-GAA ***
13857849-TAGAATT-CAGAATG 11737143-TAGAATT-CAGAATG ***
13857969-CCT-TCG 11737263-CCT-TCG ***
13898754-GT-G 11778048-GT-G 26×T***
20252992-TTTA-T 18091106-TTTA-T P5_Dst 6×TTA***
20872237-AT-A 18710351-AT-A P4_Dst 11×T***
9698168-CA-C 9860559-CA-C IR3_Prx ***
58981972-TCCAT-CCCA 56835825-TCCAT-CCCA ***
27641766-CTT-C 25495619-CTT-C P1_Y2 14×T***
28375653-TAA-T 26229506-TAA-T P1_gr2 14×A***
28793019-TCGG-ACGC 26646872-TCGG-ACGC ***
58978686-C-CTCCACTCCATTCCAT 56832539-C-CTCCACTCCATTCCAT ***
58978989-G-GCCACTCCATT 56832842-G-GCCACTCCATT ***
58981873-TG-CA 56835726-TG-CA ***
58982289-ATGCCA-TTCCCT 56836142-ATGCCA-TTCCCT ***
27302667-GTA-G 25156520-GTA-G P1_g3 ***
58992976-AG-TT 56846829-AG-TT ***
58997064-ACCAG-TCCAA 56850917-ACCAG-TCCAA ***
59004300-TA-T 56858153-TA-T 9×A***
8555543-G-GTTTTTT 8687502-G-GTTTTTT ***
23293598-GTA-G 21131712-GTA-G 20×TA***
13452332-GATTCCATTCCATTCCATTCCATTCC-G,GATTCCATTCCATTCCATTCC 11296656-GATTCCATTCCATTCCATTCCATTCC-G,GATTCCATTCCATTCCATTCC 12×ATTCC***
27583038-GTTCTATTG-TTTTTTTTT 25436891-GTTCTATTG-TTTTTTTTT P1_Y2 ***
26814944-TA-T 24668797-TA-T P1_g2 12×A***
20998300-CAAA-C 18836414-CAAA-C P4_Dst 28×A***
24743954-T-TA 22597807-T-TA P3_b2 9×A***
21515841-CGAC-GGAA 19353955-CGAC-GGAA ***
22330439-CC-AA 20168553-CC-AA DYZ19 ***
24052805-CT-C 21906658-CT-C P3_b1 10×T***
24325455-AT-A 22179308-AT-A P3_t1 11×T***
24458760-CA-C 22312613-CA-C 18×A***
24575875-TC-T 22429728-TC-T P3_t2 ***
25335133-GT-G 23188986-GT-G P2_r1 11×T***
26415697-GAAAG-AAAAA 24269550-GAAAG-AAAAA P1_Y1 ***
25445990-ATT-A 23299843-ATT-A P2_r2 17×T***
25456371-C-AAA 23310224-C-AAA P2_r2 ***
25536736-CA-C 23390589-CA-C P1_gr1 8×A***
25702689-GA-G 23556542-GA-G P1_b3 13×A***
25939403-CT-C 23793256-CT-C P1_Y1 11×T***
26376499-CAAAA-C 24230352-CAAAA-C P1_Y1 18×A***
9702967-G-GA 9865358-G-GA IR3_Prx 11×A***
9372603-C-CT 9534994-C-CT 13×T***
26997343-G-A 24851196-G-A P1_r4 ***
27714328-C-T 25568181-C-T P1_Y2 15×T***
27398367-T-A 25252220-T-A P1_g3 ***
27418028-C-T 25271881-C-T P1_g3 ***
27546693-C-T 25400546-C-T P1_Y2 ***
27618315-A-C 25472168-A-C P1_Y2 ***
27700177-C-A 25554030-C-A P1_Y2 ***
27700196-T-A 25554049-T-A P1_Y2 ***
27808443-C-A 25662296-C-A P1_Y2 ***
27337868-T-A 25191721-T-A P1_g3 ***
27872495-G-A 25726348-G-A P1_Y2 ***
27872517-C-A 25726370-C-A P1_Y2 ***
27872528-G-A 25726381-G-A P1_Y2 ***
27916433-G-A 25770286-G-A P1_Y2 ***
28008071-T-G 25861924-T-G P1_Y2 ***
28008078-T-A 25861931-T-A P1_Y2 ***
27346551-G-T 25200404-G-T P1_g3 ***
27289878-G-T 25143731-G-T P1_g3 ***
28293266-T-C 26147119-T-C P1_b4 ***
27082215-G-A 24936068-G-A P1_r4 ***
26997351-G-T 24851204-G-T P1_r4 ***
27001764-T-G 24855617-T-G P1_r4 ***
27001837-A-G 24855690-A-G P1_r4 ***
27001841-A-T 24855694-A-T P1_r4 ***
27016157-C-T 24870010-C-T P1_r4 ***
27082179-T-G 24936032-T-G P1_r4 ***
27082225-A-G 24936078-A-G P1_r4 ***
27254610-A-C 25108463-A-C P1_g3 ***
27082230-G-A 24936083-G-A P1_r4 ***
27082231-A-G 24936084-A-G P1_r4 ***
19146371-C-A 17034491-C-A ***
27151202-G-T 25005055-G-T P1_g3 ***
27161532-T-A 25015385-T-A P1_g3 ***
27222179-A-C 25076032-A-C P1_g3 ***
28027960-C-T 25881813-C-T P1_Y2 ***
28293284-T-C 26147137-T-C P1_b4 ***
8408465-TCCCT-CCCCG 8540424-TCCCT-CCCCG ***
14858666-AT-A 12746732-AT-A 19×T***
14118245-G-GT 11997539-G-GT 13×T***
24264513-CT-C 22118366-CT-C P3_b1 18×T***
58974222-ATTCG-TTTCC 56828075-ATTCG-TTTCC ***
2790303-C-CT 2922262-C-CT 15×T***
5242452-ATG-A 5374411-ATG-A 10×TG***
25553754-A-AT 23407607-A-AT P1_gr1 13×T***
25514627-C-CT 23368480-C-CT P1_gr1 13×T***
58993862-G-A 56847715-G-A ***
26906694-G-GA 24760547-G-GA P1_r3 19×A***
2840099-CAAAAA-C 2972058-CAAAAA-C 20×A***
6298773-GCA-CCC 6430732-GCA-CCC IR3_Dst ***
6298790-ATTTA-TTTTC 6430749-ATTTA-TTTTC IR3_Dst ***
6359640-TAAA-T 6491599-TAAA-T 22×A***
8333480-TTTCTTCTTCTTC-T 8465439-TTTCTTCTTCTTC-T 31×TTC***
58996189-A-T 56850042-A-T ***
58992977-G-T 56846830-G-T ***
28311636-A-T 26165489-A-T P1_b4 ***
28742302-C-A 26596155-C-A ***
28516670-C-A 26370523-C-A ***
28542473-C-A 26396326-C-A ***
28556315-A-G 26410168-A-G ***
28584514-G-T 26438367-G-T ***
28588291-A-T 26442144-A-T ***
28609258-C-A 26463111-C-A ***
28760041-C-A 26613894-C-A ***
58982267-C-A 56836120-C-A ***
28765009-C-A 26618862-C-A ***
28765033-C-A 26618886-C-A ***
58887384-A-G 56703487-T-C ***
58972112-C-A 56825965-C-A ***
58979172-C-A 56833025-C-A ***
58981376-C-A 56835229-C-A ***
19155941-C-A 17044061-C-A ***
18304398-T-C 16192518-T-C P6_Prx ***
19040874-G-T 16928994-G-T ***
6948226-C-A 7080185-C-A ***
7383846-T-C 7515805-T-C ***
7383844-C-T 7515803-C-T ***
7381628-C-A 7513587-C-A ***
7311836-C-A 7443795-C-A ***
7307851-A-G 7439810-A-G ***
7166515-C-A 7298474-C-A ***
7160569-C-A 7292528-C-A ***
7116135-C-A 7248094-C-A ***
7111789-C-A 7243748-C-A ***
7110944-C-A 7242903-C-A ***
7107436-C-A 7239395-C-A ***
7100091-C-A 7232050-C-A ***
7084498-C-A 7216457-C-A ***
7030914-C-A 7162873-C-A ***
6828549-C-A 6960508-C-A ***
7428142-A-C 7560101-A-C ***
6828523-C-A 6960482-C-A ***
6714497-C-A 6846456-C-A ***
6642578-C-A 6774537-C-A ***
6509565-C-A 6641524-C-A ***
6471372-C-A 6603331-C-A ***
6414349-C-A 6546308-C-A ***
6403692-G-T 6535651-G-T ***
6402804-C-A 6534763-C-A ***
6298772-T-C 6430731-T-C IR3_Dst ***
6246925-A-T 6378884-A-T IR3_Dst ***
6246915-A-T 6378874-A-T IR3_Dst ***
6246897-A-C 6378856-A-C IR3_Dst ***
6246870-A-C 6378829-A-C IR3_Dst ***
6246860-A-C 6378819-A-C IR3_Dst ***
7423697-C-A 7555656-C-A ***
7428171-A-C 7560130-A-C ***
6150009-G-A 6281968-G-A A3687 IR3_Dst 19×TA***
9564485-T-G 9726876-T-G IR3_Prx ***
9944963-G-A 10107354-G-A ***
9944956-A-T 10107347-A-T ***
9944161-C-A 10106552-C-A ***
9944104-A-T 10106495-A-T ***
9942949-T-A 10105340-T-A ***
9940888-T-C 10103279-T-C ***
9940805-C-A 10103196-C-A ***
9750687-T-G 9913078-T-G ***
9712962-T-A 9875353-T-A IR3_Prx ***
9707400-A-G 9869791-A-G IR3_Prx ***
9707361-T-G 9869752-T-G IR3_Prx ***
9707326-T-G 9869717-T-G IR3_Prx ***
9602730-T-G 9765121-T-G IR3_Prx ***
9564490-T-G 9726881-T-G IR3_Prx ***
9540246-C-T 9702637-C-T IR3_Prx 18×T***
7490092-C-A 7622051-C-A IR1_L ***
9402587-C-A 9564978-C-A ***
9365773-A-G 9528164-A-G ***
9365761-T-G 9528152-T-G ***
9365755-T-G 9528146-T-G ***
9355440-A-G 9517831-A-G ***
9347422-A-G 9509813-A-G ***
9345062-T-G 9507453-T-G ***
9344064-A-C 9506455-A-C ***
9344043-A-C 9506434-A-C ***
9344034-A-C 9506425-A-C ***
9173188-C-A 9335579-C-A ***
8389723-C-A 8521682-C-A ***
7577977-T-C 7709936-T-C ***
7490578-A-C 7622537-A-C IR1_L ***
6213709-C-T 6345668-C-T IR3_Dst ***
6102379-C-A 6234338-C-A ***
9952644-G-A 10115035-G-A ***
13509654-G-T 11353978-G-T ***
10064327-C-G 10226718-C-G ***
2758748-T-A 2890707-T-A ***
28807706-G-A 26661559-G-A ***
26102008-C-T 23955861-C-T P1_Y1 ******
26064837-C-A 23918690-C-A P1_Y1 ***
24213969-CTTAATA-C 22067822-CTTAATA-C P3_b1 ***
24212724-A-C 22066577-A-C P3_b1 ******
22441666-T-A 20279780-T-A DYZ19 ******
22433018-G-T 20271132-G-T DYZ19 ***
22346721-C-T 20184835-C-T DYZ19 ******
22303786-C-A 20141900-C-A DYZ19 ***
22298470-T-A 20136584-T-A DYZ19 ***
22289581-G-T 20127695-G-T DYZ19 ***
17218300-C-T 15106420-C-T 16×T***
13435066-A-G 11279390-A-G ***
13460486-A-G 11304810-A-G ***
5179541-T-C 5311500-T-C Z38491 8×AC***
13718864-T-C 11563188-T-C ***
58982238-C-T 56836091-C-T ***
10048601-GCTT-CCTA 10210992-GCTT-CCTA ***
13739747-T-G 11584071-T-G ***
28581630-GATATAT-G 26435483-GATATAT-G 19×AT***
20025478-T-C 17913598-T-C P5_Prx ***
18354216-AAG-A 16242336-AAG-A P6_Prx ***
13733372-A-G 11577696-A-G ***
58985458-A-T 56839311-A-T ***
58984376-C-T 56838229-C-T ***
9700815-G-A 9863206-G-A IR3_Prx ***
9311499-T-G 9473890-T-G ***
25889836-G-GTAA 23743689-G-GTAA P1_Y1 9×TAA***
10064335-T-C 10226726-T-C ***
10064309-C-T 10226700-C-T ***
5873871-C-A 6005830-C-A ***
4874297-T-A 5006256-T-A ***
5864653-T-C 5996612-T-C ***
5863954-C-A 5995913-C-A ***
5824172-C-A 5956131-C-A ***
5294351-C-A 5426310-C-A ***
5267020-C-A 5398979-C-A ***
5242618-C-A 5374577-C-A ***
5199815-C-A 5331774-C-A ***
5172095-C-A 5304054-C-A ***
5170236-A-T 5302195-A-T ***
5170228-C-A 5302187-C-A ***
5022024-G-A 5153983-G-A ***
4969686-G-T 5101645-G-T ***
4959824-C-A 5091783-C-A ***
4951459-C-T 5083418-C-T ***
4271315-C-A 4403274-C-A ***
17629796-T-C 15517916-T-C ***
4262437-C-A 4394396-C-A ***
4243714-A-C 4375673-A-C ***
4208690-C-A 4340649-C-A ***
3389912-T-C 3521871-T-C ***
3340941-G-A 3472900-G-A ***
3060960-A-T 3192919-A-T ***
2803629-C-A 2935588-C-A ***
2784473-C-A 2916432-C-A ***
2773498-C-T 2905457-C-T ***
2769703-G-T 2901662-G-T ***
2758620-T-A 2890579-T-A ***
22473640-C-T 20311754-C-T DYZ19 ***
22302505-C-G 20140619-C-G DYZ19 ***
58985182-G-T 56839035-G-T ***
9945500-A-T 10107891-A-T ***
9952647-G-C 10115038-G-C ***
18959136-A-C 16847256-A-C ***
15746080-C-A 13634200-C-A ***
16941548-C-A 14829668-C-A ***
16705395-C-A 14593515-C-A ***
16540097-G-T 14428217-G-T ***
16516250-C-A 14404370-C-A ***
16292609-C-T 14180729-C-T ***
16270986-C-A 14159106-C-A ***
16245323-C-A 14133443-C-A ***
16241483-T-A 14129603-T-A ***
16118208-A-G 14006328-A-G P8_Prx ***
16113102-T-G 14001222-T-G P8_Prx ***
16107522-A-T 13995642-A-T P8_Prx ***
16029013-C-A 13917133-C-A ***
15773517-G-T 13661637-G-T ***
15773507-T-C 13661627-T-C ***
15655450-G-A 13543570-G-A ***
16989182-C-A 14877302-C-A ***
15532593-T-A 13420713-T-A ***
15397194-A-G 13285314-A-G ***
15179854-G-T 13067940-G-T ***
15168247-C-A 13056333-C-A ***
15084563-C-A 12972653-C-A ***
15066214-C-A 12954305-C-A ***
15012664-T-C 12900752-T-C ***
14992506-C-A 12880591-C-A ***
14784797-C-T 12672867-C-T ***
14764956-C-A 12653025-C-A ***
14563046-C-A 12451246-C-A ***
14562380-C-A 12450580-C-A ***
14561285-G-T 12449486-G-T ***
14516806-A-G 12405007-A-G ***
16942136-C-A 14830256-C-A ***
17042694-C-A 14930814-C-A ***
14490233-T-C 12369502-T-C ***
18369705-A-G 16257825-A-G P6_Prx ***
18933726-C-A 16821846-C-A ***
18928637-C-T 16816757-C-T ***
18926870-C-A 16814990-C-A ***
18819341-A-G 16707461-A-G ***
18752895-C-A 16641015-C-A ***
18468408-T-G 16356528-T-G P6_Dst ***
18465454-C-A 16353574-C-A P6_Dst ***
18447620-A-T 16335740-A-T P6_Dst ***
18447616-G-T 16335736-G-T P6_Dst ***
18375975-A-G 16264095-A-G P6_Prx ***
18369731-A-G 16257851-A-G P6_Prx ***
18369727-C-G 16257847-C-G P6_Prx ***
18369724-A-C 16257844-A-C P6_Prx ***
18369709-A-G 16257829-A-G P6_Prx ***
24807426-G-A 22661279-G-A P3_b2 ***
17098564-C-A 14986684-C-A ***
18304366-G-C 16192486-G-C P6_Prx ***
18187687-C-A 16075807-C-A ***
18089400-C-A 15977520-C-A ***
18079291-C-A 15967411-C-A ***
18041608-G-T 15929728-G-T ***
18035721-A-C 15923841-A-C ***
18035703-A-G 15923823-A-G ***
17953931-A-G 15842051-A-G ***
17629692-G-A 15517812-G-A ***
17616854-C-A 15504974-C-A ***
17597955-C-A 15486075-C-A ***
17545939-C-A 15434059-C-A ***
17355768-C-A 15243888-C-A ***
17103948-C-A 14992068-C-A ***
14490777-T-C 12370046-T-C ***
14490225-A-G 12369494-A-G ***
9952663-A-C 10115054-A-C ***
13325275-A-G 11169599-A-G ***
13461201-G-A 11305525-G-A ***
13461200-A-G 11305524-A-G ***
13461180-A-G 11305504-A-G ***
13461165-G-T 11305489-G-T ***
13460978-C-T 11305302-C-T ***
13460502-T-A 11304826-T-A ***
13460463-T-A 11304787-T-A ***
13437247-G-C 11281571-G-C ***
13435051-C-G 11279375-C-G ***
13429924-G-T 11274248-G-T ***
13347972-C-A 11192296-C-A ***
13326027-A-C 11170351-A-C ***
13325299-G-A 11169623-G-A ***
13325292-C-G 11169616-C-G ***
13324762-T-C 11169086-T-C ***
13468282-G-T 11312606-G-T ***
13305639-T-G 11149963-T-G ***
13298547-C-A 11142871-C-A ***
13291361-A-G 11135685-A-G ***
13291356-T-C 11135680-T-C ***
13255390-C-A 11099714-C-A ***
13239447-A-T 11083771-A-T ***
10064274-G-T 10226665-G-T ***
10064260-C-T 10226651-C-T BY3656 ***
10064226-G-T 10226617-G-T ***
10064180-G-A 10226571-G-A ***
10011768-C-T 10174159-C-T ***
9974158-G-A 10136549-G-A FGC32303 ZS9810 ***
9952674-T-A 10115065-T-A ***
9952664-G-A 10115055-G-A ***
13461245-G-T 11305569-G-T ***
13494118-C-A 11338442-C-A ***
14490216-T-G 12369485-T-G ***
13733634-C-A 11577958-C-A ***
14372031-C-A 12251327-C-A ***
14297352-C-A 12176646-C-A ***
14074406-C-A 11953700-C-A ***
14074315-G-A 11953609-G-A ***
14035957-C-A 11915251-C-A ***
13996573-C-A 11875867-C-A ***
13946139-C-A 11825433-C-A ***
13937509-A-G 11816803-A-G ***
13935989-C-A 11815283-C-A ***
13887613-C-A 11766907-C-A ***
13744806-T-G 11589130-T-G ***
13741474-A-C 11585798-A-C ***
13739741-C-T 11584065-C-T ***
13739548-G-C 11583872-G-C ***
13733628-A-G 11577952-A-G ***
13494328-C-A 11338652-C-A ***
13603141-C-A 11447465-C-A ***
13513035-C-A 11357359-C-A ***
13513558-C-A 11357882-C-A ***
13547007-C-A 11391331-C-A ***
13552721-C-T 11397045-C-T ***
13553334-C-A 11397658-C-A ***
13585200-C-A 11429524-C-A ***
13603217-C-A 11447541-C-A ***
13733614-A-G 11577938-A-G ***
13637263-C-A 11481587-C-A ***
13643010-C-A 11487334-C-A ***
13643943-C-A 11488267-C-A ***
13708068-A-G 11552392-A-G ***
13718854-T-A 11563178-T-A ***
13718874-C-G 11563198-C-G ***
19500593-GAGAA-G,GAGAAAGAA 17388713-GAGAA-G,GAGAAAGAA 15×AGAA***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
Bjorkman1324141111-15121213131329188-911112514182915-15-15-17111019-231515171736-40121211915-1671010810101223-231610121218812222013121113101112123415916122727191212141210912121011113012132412101022151813241712152512231810141691211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 767551104636180686718161964
Used in age calculations1104636180686718161964
Counts of SNPs44
Variant counts last updated 2017-11-05 23:05:41.



Big Tree Main Page