Engelhorn

BigY3: 369210
MDKA Birth: Germany

Tree Position

A0-T-YP2191 > P305[A1] > A1b > BT/A1b2 > M168/PF1416[CT] > P143[CF] > M89/PF2746[F] > F1329/M3658[GHI > F929[HIJK] > IJK > IJ > J > J2

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
369210
4247182-A-G 4379141-A-G A+
25613568-C-G 23467421-C-G P1_gr1 A+
13256057-C-T 11100381-C-T A*
10807250-C-T A*
10934817-T-C A*
28817386-G-T 26671239-G-T A*
7470942-G-A 7602901-G-A IR1_L A*
13687243-G-A 11531567-G-A A*
19609551-A-G 17497671-A-G P5_Prx YA*
19700937-T-C 17589057-T-C P5_Prx A*
19733740-T-C 17621860-T-C P5_Prx A*
20793717-C-A 18631831-C-A P4_Prx A*
21766572-G-A 19604686-G-A BY39804Y20246 YY+
8050595-C-T 8182554-C-T BY42745 YY+
8988028-G-T 9150419-G-T +
9904099-G-A 10066490-G-A BY81941 Y+
7932593-G-A 8064552-G-A YY+
7908215-C-T 8040174-C-T FT19518 YY+
15706041-T-G 13594161-T-G FT216712 YY+
18060219-AAC-A 15948339-AAC-A +
4992283-A-G 5124242-A-G FT136342 +
17509940-A-G 15398060-A-G FTA24168 YY+
2854152-C-T 2986111-C-T YY+
3166093-C-T 3298052-C-T +
3750682-T-C 3882641-T-C +
3750852-G-A 3882811-G-A +
3938780-A-G 4070739-A-G +
3948661-T-C 4080620-T-C +
4104584-C-G 4236543-C-G +
4442176-G-T 4574135-G-T +
5210564-G-A 5342523-G-A +
6924131-G-A 7056090-G-A YY+
6932921-A-C 7064880-A-C YY+
7186408-A-G 7318367-A-G YY+
7508238-C-T 7640197-C-T Y+
7643909-TTAA-T 7775868-TTAA-T +
8611672-A-T 8743631-A-T YY+
8715534-G-A 8847493-G-A YY+
9404674-GAA-G 9567065-GAA-G +
9422426-A-G 9584817-A-G YY+
9439656-T-C 9602047-T-C YY+
9737769-C-G 9900160-C-G IR3_Prx +
9927493-G-A 10089884-G-A Y+
10862234-C-T +
10906529-G-C +
13235380-C-G 11079704-C-G +
13258455-C-T 11102779-C-T +
13705236-TGAATGGAATG-T 11549560-TGAATGGAATG-T 4×GAATG+
13815570-A-T 11694864-A-T +
14207074-C-G 12086368-C-G YY+
14309858-G-T 12189152-G-T YY+
14348347-G-A 12227642-G-A YY+
14498641-G-A 12386846-G-A YY+
14894553-T-C 12782619-T-C YY+
15030832-A-C 12918920-A-C YY+
15572051-A-G 13460171-A-G YY+
15981383-T-C 13869503-T-C YY+
16052050-A-T 13940170-A-T YY+
16072181-G-C 13960301-G-C Y+
16199045-G-A 14087165-G-A YY+
16569628-A-G 14457748-A-G YY+
17086464-T-C 14974584-T-C YY+
17388134-G-A 15276254-G-A YY+
17457276-CAG-C 15345396-CAG-C +
17591020-G-C 15479140-G-C YY+
17876871-T-A 15764991-T-A YY+
18392893-C-G 16281013-C-G P6_Gap +
18562412-C-T 16450532-C-T YY+
18746658-T-C 16634778-T-C YY+
18996621-A-T 16884741-A-T YY+
18997993-G-A 16886113-G-A YY+
19237459-T-A 17125579-T-A YY+
19382905-T-C 17271025-T-C Y+
19401875-G-T 17289995-G-T YY+
21359802-T-G 19197916-T-G YY+
21434204-A-AT 19272318-A-AT +
21663300-G-A 19501414-G-A YY+
21992330-C-T 19830444-C-T YY+
23334325-C-T 21172439-C-T YY+
28571055-G-A 26424908-G-A +
28617283-A-G 26471136-A-G +
28795724-T-A 26649577-T-A +
28814474-T-A 26668327-T-A +
5957089-T-TAC 6089048-T-TAC Z2956 12×AC*
13814595-A-AGGAATGGAAT 11693889-A-AGGAATGGAAT 10×GGAAT*
9371457-CATATATAT-C,CAT 9533848-CATATATAT-C,CAT 22×AT*
3509668-T-TTA 3641627-T-TTA 9×TA*
5930670-TAGATA-T 6062629-TAGATA-T *
4439204-C-A 4571163-C-A *
5295886-C-T 5427845-C-T *
6934397-A-ATTGTTG 7066356-A-ATTGTTG 10×TTG*
20570221-T-C 18408335-T-C P5_Dst *
21386167-T-TTTATTA 19224281-T-TTTATTA 10×TTA*
22536983-TAAAA-T 20375097-TAAAA-T 16×A**
20217961-A-AAT 18056075-A-AAT P5_Dst **
13461301-G-T 11305625-G-T **
20713106-A-T 18551220-A-T P4_Prx **
13222276-A-G 11066600-A-G **
4763687-A-ATT 4895646-A-ATT 24×T**
20625189-T-C 18463303-T-C P4_Prx **
28477992-CAA-C 26331845-CAA-C 17×A**
13222283-G-GGA 11066607-G-GGA **
3652636-TGAAG-T 3784595-TGAAG-T **
5251168-TG-T 5383127-TG-T **
7359786-T-C 7491745-T-C **
9143469-C-T 9305860-C-T **
11023170-T-C **
13222272-G-GA 11066596-G-GA **
17538312-G-A 15426432-G-A **
17988633-G-A 15876753-G-A P7_Prx **
18212490-G-A 16100610-G-A **
21915085-A-G 19753199-A-G **
21991478-C-G 19829592-C-G **
22289109-T-C 20127223-T-C DYZ19 **
25566836-T-A 23420689-T-A P1_gr1 **
25885649-C-A 23739502-C-A P1_Y1 **
27676367-A-G 25530220-A-G P1_Y2 **
28813317-G-C 26667170-G-C **
23293599-TATATA-T 21131713-TATATA-T ***
9094829-TAT-T,TAC 9257220-TAT-T,TAC ***
17081246-T-A 14969366-T-A FTA6039 ***
7195307-CAA-C,CA 7327266-CAA-C,CA 16×A***
5937208-ATCTC-A,ATC 6069167-ATCTC-A,ATC 17×TC***
10956561-CTCCATTCCATTCCAT-C,CTCCAT ***
6031388-A-G 6163347-A-G FT422124 ***
13455084-C-G 11299408-C-G ***
3428727-TATAT-T,TATAC 3560686-TATAT-T,TATAC ***
3462246-T-C 3594205-T-C ***
6024536-TTG-T,TTGTGTGTGTG 6156495-TTG-T,TTGTGTGTGTG 15×TG***
10789374-CCATTCCATTCCATTCCATTCCATTG-C,CCATTCCATTCCATTCCATTCCATTC ***
13923530-CAAAAA-C,CAAA 11802824-CAAAAA-C,CAAA 29×A***
16364083-TATATATATATATATATATATATATATATACAC-T,TATAC 14252203-TATATATATATATATATATATATATATATACAC-T,TATAC ***
17081250-TATATATATATATATATAA-T 14969370-TATATATATATATATATAA-T ***
18758921-CTCTTTC-C,CTCTT 16647041-CTCTTTC-C,CTCTT ***
18872206-T-A 16760326-T-A ***
19127640-AAAAAT-A 17015760-AAAAAT-A ***
22827467-AAAAT-A,AAAATA 20665581-AAAAT-A,AAAATA ***
23825064-ATTT-A,AT 21663178-ATTT-A,AT 25×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.