Big Tree: Person Data

Tree Position

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19)	POS-REF-ALT (hg38)	Blocks	Names	Region	McDonald BED	combBED	STR	BigY3 B908902
19697556-C-CT	17585676-C-CT	DF25	Z17556	P5_Prx			8×T	A*
6326664-A-C	6458623-A-C	S6189		IR3_Dst				A*
6212883-G-A	6344842-G-A			IR3_Dst				A*
6260743-G-A	6392702-G-A			IR3_Dst				A*
18317104-A-G	16205224-A-G			P6_Prx				A*
19694264-G-A	17582384-G-A			P5_Prx				A*
20725834-T-C	18563948-T-C			P4_Prx				A*
24293157-C-T	22147010-C-T			P3_t1				A*
26107817-C-T	23961670-C-T			P1_Y1				A*
3523854-G-A	3655813-G-A							A*
26505375-C-CA	24359228-C-CA			P1_Y1				A*
25511591-G-A	23365444-G-A			P1_gr1				A*
19932968-C-T	17821088-C-T			P5_Prx				A*
	17833016-T-C			P5_Prx				A*
	23454772-C-T			P1_gr1				A*
2826066-C-G	2958025-C-G	DF25	DF25 S253		Y	Y		+
8381834-C-G	8513793-C-G	FGC3903/S5201	S5201 FGC3903 Y2890		Y	Y		+
9129841-T-G	9292232-T-G	S5199	S5199 Y2891 FGC3900			Y		+
9878915-C-T	10041306-C-T	DF21/S192	DF21 S192		Y	Y		+
18157337-C-T	16045457-C-T	S5199	CTS8704 S6375		Y			+
7278952-C-T	7410911-C-T	S6189	S6189 ZS608		Y	Y		+
6007325-G-A	6139284-G-A	BY23441	FT32218					+
6636478-G-T	6768437-G-T	BY23441	BY23441		Y	Y		+
6872337-G-C	7004296-G-C	BY23441	BY23452		Y	Y		+
7355393-A-G	7487352-A-G	BY23441	BY23483		Y	Y		+
14144916-C-T	12024210-C-T	BY23441	BY23804		Y	Y		+
15407925-A-G	13296045-A-G	BY23441	BY23897		Y	Y		+
15494228-T-C	13382348-T-C	BY23441	BY23902		Y	Y		+
15515256-C-T	13403376-C-T	S6189	Y23187		Y	Y		+
15924215-C-T	13812335-C-T		BY104913		Y	Y		+
16413936-A-T	14302056-A-T	BY23441	BY23963		Y	Y		+
16494143-A-G	14382263-A-G	BY23441	BY23970		Y	Y		+
16816878-G-A	14704998-G-A	BY23441	BY23990		Y	Y		+
17983215-G-GT	15871335-G-GT	BY23441						+
18028728-C-T	15916848-C-T	BY23441	BY24103		Y			+
19088870-C-T	16976990-C-T	BY23441	BY24188		Y	Y		+
21250363-G-A	19088477-G-A	BY23441	BY24274		Y	Y		+
21408138-A-G	19246252-A-G	BY41282	BY41282		Y			+
21445708-T-G	19283822-T-G	BY23441	BY24300		Y	Y		+
21896628-T-C	19734742-T-C	BY23441	BY24341		Y	Y		+
22603158-C-G	20441272-C-G	BY23441	BY24676		Y	Y		+
23999216-G-C	21853069-G-C	BY23441	BY24826		Y			+
24449279-A-G	22303132-A-G	BY24841	BY24841			Y		+
28778140-G-A	26631993-G-A	BY23441	BY24890					+
28813515-G-C	26667368-G-C		BY41283					+
5172952-G-A	5304911-G-A	S6189	FT7771					+
3361135-G-C	3493094-G-C	BY23441	FT227993					+
3586969-T-C	3718928-T-C	BY23441	FT228020					+
3820181-C-A	3952140-C-A	BY23441	FT228057					+
3980716-G-A	4112675-G-A	BY23441	FT349577					+
4983495-G-C	5115454-G-C	BY23441	FT228243					+
5013127-C-T	5145086-C-T	BY23441	FT228249					+
6057761-A-T	6189720-A-T	BY23441	FT228400					+
13324982-G-T	11169306-G-T	BY23441	FT353723					+
17002122-T-A	14890242-T-A	BY23441	FT229194		Y			+
18343645-C-T	16231765-C-T	BY23441	BY154624	P6_Prx				+
	3701659-A-C							+
	4655899-T-C							+
	5893346-G-T							+
	6942583-G-A							+
	8932923-C-T							+
	9009274-G-C							+
	11687420-G-A							+
	13939119-T-C							+
	14439529-C-A							+
	14455528-T-A							+
	15402629-C-T							+
	15857413-C-T							+
	16762275-G-C							+
	20436610-T-G							+
	21568122-C-T							+
14379598-G-GATAC	12258894-G-GATAC							*
9519810-CTTTTTCTT-C,CTCTTTCTT	9682201-CTTTTTCTT-C,CTCTTTCTT							*
22093166-T-TTGTG	19931280-T-TTGTG						22×TG	*
	10764552-CTCCATTCCAT-C							*
4776622-A-AACAC	4908581-A-AACAC						20×AC	*
28592004-A-ATGTG	26445857-A-ATGTG						18×TG	*
13370806-G-A	11215130-G-A	Z30233	Z30233					**
15406358-C-CA	13294478-C-CA	S6189						**
19227469-ACTAT-A	17115589-ACTAT-A						4×CTAT	**
13714841-A-AGAATG	11559165-A-AGAATG						7×GAATG	**
	10781251-CTCCAT-C							**
13481383-T-C	11325707-T-C							**
13481366-G-A	11325690-G-A							**
13481407-A-G	11325731-A-G							**
	11014722-C-T							**
25858371-G-T	23712224-G-T			P1_Y1				**
26461473-A-T	24315326-A-T			P1_Y1				**
26480505-CA-C	24334358-CA-C			P1_Y1			9×A	**
20006010-T-C	17894130-T-C			P5_Prx				**
	14116017-AGAAGGAAG-A						8×GAAG	**
	15790454-T-C							**
24387728-C-CTA	22241581-C-CTA							**
23293596-GTGTATA-G	21131710-GTGTATA-G							***
17198461-AAGAGAG-A,AAG	15086581-AAGAGAG-A,AAG						18×AG	***
27862535-TGAGAGA-T,TGA	25716388-TGAGAGA-T,TGA			P1_Y2			22×GA	***
22254934-C-G	20093048-C-G			DYZ19				***
22288417-C-T	20126531-C-T			DYZ19				***
14656154-CAAAAA-C	12544219-CAAAAA-C						24×A	***
13481345-T-G	11325669-T-G							***
13481352-C-T	11325676-C-T							***
13481360-A-G	11325684-A-G							***
22317380-G-T	20155494-G-T			DYZ19				***
21830190-TAA-T	19668304-TAA-T						12×A	***
22147811-TTTCTTTTCTT-T,TTTCTTTTCTC	19985925-TTTCTTTTCTT-T,TTTCTTTTCTC							***
16868746-CATATATATATAT-C,CATATATAT	14756866-CATATATATATAT-C,CATATATAT						22×AT	***
	10243632-C-G							***
	10243634-G-T							***
	10243646-G-C							***
	10824134-CTCCATTCCATTCCAT-C,CTCCAT							***
	12003147-A-G							***
	13951323-CTTTCTTTCTTTC-C,CTTTCTTTCTTTCT							***
	14252178-CTATATATATATATATATATATATATATATATA-C,CTATATATATATATATATATATA						27×TA	***
	16353572-G-A			P6_Dst				***
	20173195-T-A			DYZ19				***
	20840967-GTATATATA-G,GTA						17×TA	***
	23384076-C-T			P1_gr1				***
	13528-T-C							***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Macgregor

Tree Position

Unique Mutations